CA2264154A1 - Solid phase synthesis - Google Patents

Abstract

The present invention relates to a support system for solid phase synthesis of oligomers, such as oligonucleotides, wherein the starting compound is bound to the support via a disiloxyl linkage. Furthermore, the invention relates to a method for synthesis of oligonucleotides on a solid support. The support system comprises a stable disiloxyl linkage providing high nucleoside loadings to the support and the method allows convenient non-laborious oligomer synthesis.

Description

WO 98/08857101520253035CA 02264154 1999-02-26PCT/SE97/01418SOLID PHASE SYNTHES ISTechnical fieldThe present invention relates to a support system for solidofFurthermore, the invention relates to a method for synthesisphase synthesis oligomers, such as oligonucleotides.of oligonucleotides on a solid support.Background of the inventionOligonucleotides are polymers built up by polycondensationof (RNA) (DNA)phosphates.ribonucleoside or deoxyribonucleosideOligonucleotides can be assembled by repetitive addition ofmethods. the(11.13.nucleotide monomers using solid-phase Sinceintroduction of solid-phase synthesis Merrifield, u.Am. Chem. Soc. 85 (1963) 2149], the following requirementshave been worked out: (1) The solid support must beinsoluble and preferably’ unswellable in the solvent used.(2) Functional groups on the solid support must allowcovalent binding of the first nucleoside in a reproducible(3)reagents used duringmanner. chemically inert toallmost commonly used supports are controlled pore glass beadsThe solid support must besynthesis and deprotection. The(CPG), silica, or polystyrene beads.Below the synthesis cycle of the commonly usedphosphoramidite method is described:1. Deprotection of the 5'—hydroxyl group in order togenerate the parent hydroxyl compounds. This is normallydone by treatment of the support with di- or trichloroaceticacid in an organic solvent (for removal of protectinggroups)2. The support is washed in order to remove traces of acid.3. The 5'—hydroxyl group is reacted with the 3‘-phosphoramidite moiety of a properly protected incominCA 02264154 1999-02-26WO 98/08857 PCTISE97/014182nucleotide (A, C, G or T) in the presence of an activator(e.g. tetrazole) to form a 3'—5'—phosphite triester.4. Excess reagents are removed. by washing with. anappropriate solvent.5 5. Unreacted S‘-hydroxyl groups are blocked as acetates(capping).6. The capping reagent is removed by washing.7. The phosphite triester is then oxidated to the1015203035corresponding phosphate triester. This is normally done bythe action of aqueous iodine.8. The oxidation reagents are removed by washing.The process is repeated until the desired oligonucleotidesequence has been synthesized. After synthesis, allprotecting groups are removed and the oligonucleotide iscleaved from the solid support.In the synthesis, defective oligonucleotides are produced asa consequence of several effects, prominently prematuretermination of synthesis, followed by capping, which resultsin 5' truncated molecules, and. depurination during thesynthetic cycles that is followed by strand scission duringdeprotection. Recently, attention has also been directed atthe internally deleted products —al, (1995),[Fearon. et al,appearance of shorter, so[Temsamani etl84l-l844],-2754-2761] .called n—l and n-2 fragmentsNucleic Acids Research 23(ll),(1995) Nucleic acids Res., 23(14),The is exemplified by therequirement for high quality products in antisense therapy(1996),47-53],need for pure oligonucleotides[Gelfi al, Antisense and Nucleic Acid Drug5,or for physicochemical and structural studies(1994) 22(8), 1404-12].cloning impure oligonucleotides frequently reduce efficiencyetDevelopment, in routine diagnostics applications[Agback et al,Nucleic Acids Res, Also in molecularand complicate interpretation of results [McClain et a_,CA 02264154 1999-02-26WO 98/08857 PCTISE97/014183 7(1986) Nucleic Acids Res. l4(16), 6770]; [Nassal, (1988)Gene, 66(2), 279-94].l0l520253035Preparative gel electrophoresis provides the best resolutionfor purification of oligonucleotides. The method is howeverlaborious, often leading to considerable loss of material,and it is poorly suited for automation and scale—up.Chromatographic separation can solve some of these problems,offering a pmmential for scale—up with minimal losses andusing fully automatized instruments. These positive aspectsare off—set by the rather poor resolving power of mostchromatographic systems. As a partial solution to thisproblem chromatographic separation of oligonucleotideslabeled with affinity tags has been used. The commonly usedtrityl—on oligonucleotide separation on reversed—phasecolumns, or capture of 5'—thiol labelled or biotinylatedoligonucleotides on respective thiol—affinity [Bannwarth etal, (1990), Helv. Chim. Acta, 73, 1139-1147] or avidincolumns [Olejnik et al, (1996), 24(2), 361-366] offer thepossibility to isolate fragments with intact 5'~ends.However, the 5' part of depurinated. molecules notoriouslycontaminate oligonucleotides purified by this method.A mild basic system has been proposed for partialdeprotection and cleavage of apurinic—sites with theoligonucleotides still bound to the solid support. In thismanner the 5' ends of depurinated molecules can be discardedbefore the oligonucleotides are released from the support,followed by isolation of molecules with intact 5' ends [Hornet al, (1988), Nucleic Acids Res, l6(24), 11559-71]. Inpractice, this strategy was accompanied by a substantialloss of products, due to inadvertent release ofoligonucleotides during cleavage of depurinated sites.In WO92/09615 there is described the use of an alkoxysilylgroup linker‘ of the oligonucleotide to the support.an *\5.3 C\CA 02264154 1999-02-26WO 98/08857 PCTISE97/014184 -This linker is inert during the synthetic cycles and itl0l520253035resists conditions that cleave apurinic sites. The linker isfinally cleaved from the solid with tetra(TBAF)separation of DMTr—containing material,with both 3'» and 5'-thissupport butylammonium fluoride to obtain, after reversed—phasean oligonucleotideends intact. However, synthesis ofsupport was laborious and inconvenient. Due to lowreactivity of the functional group of the linker the degreesubstitution of the support becomes low which leads toThus, thisofinsufficient nucleoside loadings of the support.method is not suitable for preparation of support useful forlarge scale synthesis.Summary of the inventionAccording to a first aspect, the invention provides asupport system for solid phase synthesis of oligomers. Thesupport system comprises a support, a linker and a startingcompound of the oligomer. The starting compound is bound tothe support via a disiloxyl linkage. The disiloxyl functionis linked to a hydroxyl group on the support. The functionalgroups connected to the disiloxyl group are very reactiveallowing for reproducible and controlled loading of thestarting compounds.The support system of the invention is easier to producecompared to prior art systems and provides for high loadingsto the support. According to the invention high loadingvalues are obtained for the starting nucleoside. Theseloadings, often higher than 200 umol/g, are required forcost—effective large scale synthesis.The linkage is inert during the synthesis cycles and resistsconditions that cleave apurinic sites.preferred embodiment, the starting compound is aand theIn anucleoside solid phase synthesis is used for thesynthesis of oligonucleotides.WO 98/088571015253035CA 02264154 1999-02-26PCT/SE97/01418Supports with immobilized oligonucleotides can be used ashybridization affinity matrices. some possible applicationsof such supports are: purification of DNA—binding proteins,affinity’ purification of plasmids, as a support for geneassembly (from oligonucleotides) and for diagnosticpurposes, etc.In the new support system of the present invention the firstnucleoside is bound to the support via a disiloxyl linkageand. the system ix; preferably’ represented kn! the followingformula (I).Formula (I)R1430$3 ‘is(x ),—-(A9-Y )n*~(A9-Z )m”‘( A )k—0‘9,»i‘0‘S,i 0 R2R4 R6whereinB is a ribonucleoside or deoxyribonucleoside base; R2 is —H,-OH, or OR7 in which R7 is a protecting group; R1 is aprotecting group; R3, R4, R5, R5 taken separately eachrepresent alkyl, aryl, cycloalkyl, alkenyl, aralkyl,cycloalkylalkyl, alkyloxy, aryloxy, Cycloalkyloxy,alkenyloxy and aralkyloxy; Supp is a solid support; X is ananchoring group used for covalent bonding to the support;(p—Y)n and (p—Z)m are oligophosphotriester linkers, whereinp represents a pmosphotriester, HT and Z are independentlyselected from a nucleoside and a rest of a diol, A is anor aromatic group, n is a number between 0-50,and k, l,with the proviso that when m and n are 0 then 1 and k are 01 then k is O and X is Oalifaticpreferably 0-10, m are each a number of O or 1,and with the proviso that when m =or S.W0 98l08857l0l52O253035CA 02264154 1999-02-26PCT/SE97/01418The R1usually used for protection of 5’and 2’protecting groups and R7 are protecting groupsposition of ribo-and deoxiribonucleosides. R1 may bee selected from a trityl,monomethoxy trityl, dimethoxytrityl, pixyl or other higheralkoXy—substituted trityl— protecting groups.R7 may bee selected from tertbutyldimehylsilyl (TBDMS),methoxytetrahydropyranoyl (MTHP), tetrahydropyranoyl, methylor allyl.In a preferred embodiment of the invention R3, R4, R5, R5are isopropyl. The choice of R3, R4, R5 is dictated bylability requirements of the disiloxyl linker.R5,stability vs.It is known that these properties can easily be controlledbysubstituents.modifying electron donating parameters of theX can be any anchoring group, preferably 0, S or an amidefunction, provided it is stable to the conditions used undersynthesis and the reagent to cleave apurinic sites. The same(p—Z)m. Thus,proviso applies also to the (p—Y)n linker andthere are no other restrictions on Y and Z.Z is exemplified by a tetraethylene glycol residue.A wide range of porous as well as non—porous solid supportscan be used as supports in methods according to the presentinvention. The group of preferred. supports includes crosslinked polystyrenes, silica, polysaccharides, crosslinkedpolysaccharides and various glasses.when the oligophosphotriester‘ linker‘ (p—Y)n is present inthegreater oligonucleotide purity than without said linker.resulting jJl evenByabove formula a support is providedpreparing the supports through a series of synthetic cyclesofof the desired oligonucleotide, anybefore addition the cleavable disiloxyl linker andsynthesis nonspecificWO 98/08857l0l520253035CA 02264154 1999-02-26PCT/SE97/01418sites of synthesis will be neutralized. This linker givesimproved contact between the starting nucleoside and anincoming reagent and ensures that also oligonucleotidesstarting from sites not intended for synthesis on thesupport none the less contribute to the production of thedesired oligonucleotide.According to a second aspect the invention provides a methodfor oligonucleotide synthesis on a solid support Supp. Themethod comprises the steps:(i)(ii)preparing a support system as defined above;condensation of nucleotides onto the first nucleosideto synthesize an oligonucleotide;alltheof apurinic sites formed during acid—catalysed deprotection;of the support systemofoligonucleotide exept(iii) removal protecting groups on the5'~protecting group, and cleavage(iv) cleavage of the full length product from the support;and(v) purification of the oligonucleotide.In step (i) an oligophosphotriester linker (p-Y)n issynthesized on the solid support and a starting nucleosideis bound to the linker via a (p—z)m linker and a disiloxylgroup.the method,is cleaved selectively’ according to known methodsW.T., 1979, (M)with a compound containing fluoride beforeAccording to one embodiment of the disiloxyllinkage(Markiewicz Journal of Chemical Reserche0181-0197) ions,step (v). A preferred fluoride containing compound is tetraalkyl ammonium fluoride. Trityl ammonium hydrogene fluorideThDis also suitable. purification is performed by reversedphase chromatography, "using the 5'—protecting group as anaffinity handle.to alternative embodiment of the methodtoAccording anaccording the invention, step {vi is performed byWO 98/08857l01520f\)Ul30CA 02264154 1999-02-26PCT/SE97l014l8exonuclease treatment whereby non~protected oligonucleotideswill be digested. This embodiment is especially suitable forin situ synthesis where chromatography is not possible.Detailed description of the inventionThe beassociation with an Experimental part and the accompanyinginvention will described more closely below indrawings, in whichFigure 1 shows starting points for oligonucleotide(14and the support after accomplishedsynthesis with or without an oligonucleotide linkerand 13, respectively)synthesis (15).Figure 2 shows the results of synthesis of a purine rich(GA)4Q oligonucleotide. A) A reverse phase HPLCchromatogram showing the trityl containing material. Theproduct from a standard support appears as a much broaderpeak with a large proportion of material appearing latercompared to the sharp and symmetrical peak from the novelsupport. B)5' labelledgel. An autoradiogram showing the oligonucleotide obtainedusing a standard support on the top and materialC and D)Products collected from the peaks in A wereand separated on a denaturing polyacrylamidesynthesized on the novel support below. The samegel as in B was scanned on a Phosphorimager (MolecularDynamics). The data are presented as line graphs withstandard support in C and the novel support in D. The n~1and n—2 peaks are marked in C.Figure 3 shows circularization of a 9l—mer padlock probe.The term “padlock probe“ means a probe which is able tocircularize on its target sequence and is described inNilsson, M., Malmgren, H., Samiotaki, M., Kwiatkowski, M.,Chowdahry, B.P. and Landegren, U. (1994) Science, 265(5181), 2085-8, to which reference is made. Theoligonucleotide was labelled at the 5'-end and the twoCA 02264154 1999-02-26WO 98/08857PCT/SE97l0l4l8ends were ligated using an excess of a complementaryoligonucleotide as template. The reaction was performedfor several cycles of denaturation and ligation using athermostable ligase.51,length (n)round of ligation.2 and 3 cycles of ligation,Lane 1: no ligase. Lanes 2,3 and 4:respectively. All fulloligonucleotides were circularized in the firstThe preparation of the support system according to theinvention can be performed according to scheme 110 illustrated below: SCHEME 115DMTr-O B DMTr-O B:0: I TiPDSiC|2(2) ]/o: I——-—-—-—-————-—-—>—rOH ('1 ;_ <3)20 /§{ I(1) B=T,C8=,AB=,G8= *7 0\ /*Si—( ‘cliIII25 B 7 Bom:-o DMTr-O7:5 7:5n0‘ }~ O\Si‘O‘ \< —l/ OxSix IN-< si\30 —{ 0-H-O-P\O . o—n\/\CN35WO 98/08857101520253035CA 02264154 1999-02-26PCTISE97/0141810 ‘fThis procedure comprises the following steps:1. Silylation of the 5'-dimethoxytritylated andappropriately protected nucleosides using 1,3-dichloro—1,l,3,3—tetraisopropyl disiloxane in dry pyridine withaddition of imidazol.(3)tetraethylene glycol to obtain derivativewith an(4).3.Introduction of phosphoramidite function to the free2. Reacting of the formed monochloroderivativediol e.g.hydroxyl group located at the end of the 3'—linker.According to the invention the homobifunctional, readilyavailable reagent l,3—dichloro—1,l,3,3—tetraisopropyl(2)(scheme l) thereagent used in the present invention has two reactivedisiloxane was used. In other words,functions which enables high and controllablesubstitution.A disiloxyl residue was applied as a stable linkerfunction between a nucleoside and a solid support. The(3) (5)respectively according to Scheme 1 above.reactive intermediates or were synthesized in oneor three steps,(3),therefore silylation of appropriately protected(1)The addition of an excess of an l3—atoms longNo attempts were made to isolate intermediatenucleosidesof (2).chain diolwere performed using only a slight excessresulted in the formation(4),subsequently for the synthesis of phosphoroamidite(tetraethyleneglycol)of an unsymmetrical disiloxyl derivative used(5).The invention requires a support functionalized withhydroxyl groups linked to the support throughnonhydrolyzable bonds. Mono R, hydroxyalkyl-derivatizedpolystyrene particles (from Pharmacia) was used withoutmodifications. Derivatization of CPG proceeded accordingto Scheme 2, below.CA 02264154 1999-02-26WO 98/08857 PCT/SE97/01418SCHEME 2HO/fi\/\/\/NH2 (5)10 J ao2Hs~o j\/\/\/NH2 (7)l b15HNC2Hs'O \n/\/\OH (8)Ocl H N20 C2H5-O ‘n/\/\o-DMTr (9)0d HHO N\n/\/\O-DMTr (10)25 J 8 O/E\ /fi\/\/\/Hhbuho O N71/\/\o-Drwrr (11)0f30V \ a) thionyl chloride, ethanol; b) "rbutyrolacton, tzriethylamine;c) dimethoxyrtityl chloride, pyridine; cl) NaOI-i, triethylamine,e) isobutyl chloroformate; f) aminopropyl—CPGWO 98/08857101520253035CA 02264154 1999-02-26PCT/SE97/0141812This scheme includes the following reactions:a) refluxing of 6—aminohexanoic acid in dry ethanol withaddition of thionyl chloride to achieve esterification ofcarboxyl group.b) acylation of the amino group with y—butyrolactone to(8).c) protection of the introduced hydroxyl group withform compounddimethoxytrityl group performed by DMTrCl in dry pyridine.d)hydrolysis of the ester group with NaOH and formation ofthe triethylammonium salt of the resulting acid.e) activation of the carboxyl group by preparing a mixedanhydride upon addition of isobutyl chloroformate.f) coupling of the activated reagent to the CPG supportderivatized with amino functions to form support (12).The CPG was activated by conventionalaminopropylsilanizing [Pon, (1993) In Agraval, S. (ed ),Methods in Molecular Biology. Protocols forOligonucleotides and Analogs. Humana Press Inc ]. Prior tofurther derivatization, the amino CPG support was treatedwith trichloracetic acid in dichlormethane according to(1993), (10)high yield starting from an inexpensive 6—aminohexanoicPon [Pon, supra]. Compound was prepared inacid andy—butyrolacton. It was conveniently converted to(11) in a reaction withisobutylchloroformate, and immediately used for couplingto CPG, (11)the mixed anhydridesee Scheme 2. Using different ratios of and asolid support, loadings ranging from 15 to 60umol/g wereobtained. The derivatized support was exhaustively cappedwith acetic anhydride and silanized withtrimethylsilylchloride, TMSCl.EXPERIMENTAL PROCEDURES(CPG) (1000 A) was obtained from CPGand was aminopropylsilanized accordingl993,Controlled—pore glassInc. (Fairfield, USA)to Pon et al. [Pon, supra}. Crosslinked polystyreneWO 98/08857101520253035CA 02264154 1999-02-26PCTISE97/0141813 ‘7particles (10 um diameter) derivatized with hydroxylalkylfunctions (Mono R) (from Pharmacia, Uppsala, Sweden).Oligonucleotide syntheses were performed either on. an .ABI394 DNA SynthesizerPlus(Perkin Elmer)(Pharmacia Biotech. AB)or on a Gene Assemblerinstrument. Analytical liquidchromatography of the synthesized oligonucleotides wasperformed on a Hitachi—Merck La Chrom HPLC system equippedwith a Lichrospher RP 18 (5 mm) column (Merck) and using alinear gradient of solvent A: acetonitrile S % V/v inacetate 0.1 M, pH 7.0 and solvent B:triethylammoniumacetonitrile 40 % v/v in triethylammonium acetate 0.1 M, pH7Ø(Pharmacia Biotech AB)Preparative separations were made on an FPLC systemusing a reversed—phase Pep RPC 10/10column (Pharmacia) and the above solvent gradient.Example 1: Synthesis of nucleoside derivatives5'—Dimethoxytrityl-3'-O—1,1,3,3~tetraisopropyl-3-tetraethylen-glycoloxy—disiloxyl thymidine (4)(B=T).5'~DMTr—thymidine (1) (1.30 g, (0.32were dried by coevaporation with dry pyridinel,3—Dichloro—(0.75 g, 2.4 mmol) was2.3 mmol)and imidazolg, 4.8 mmol)and dissolved in 20 ml of dry pyridine.l,1,3,3—tetraisopropyl disiloxane (2)added and. the mixture was stirred at 20°C for 3 hrs toachieve consumption of material.(3.9 g,(see Scheme 1)complete startingadded to themixture was23 mmol) wasand theTetraethylene glycolformed compound (3)was isolated as an oilstirred for 6 hr. Pure compound (4)(1.62 g, 72%), following standard bicarbonate work~up,extraction with dichloromethane, evaporation of the organicphase, and flash column chromatography. lH—NMR (CDCl3):0.85-1.05 (m, 28 H), 1.43 (S, 3 H), 2.25-2.42 (m, 2 H), 2.85(S, broad, l H), 3.27-3.52 (dd, 2 H), 3.54-3.76 (m, 21.2 H),3.79 (S, 3 H), 3.80-3.85 (m, 2 H), 4.09 (m, l H), 4.68 (m. lCA 02264154 1999-02-26WO 98/08857 PCT/SE97/0141814 _H), 6.40 (t, l H), 6.83 (d, 4 H), 7.23-7.40 (m, 9 H), 7.63(d, 1 H), 9.19 (s, broad, 1 H).101520253035The other three nucleoside derivatives were obtained in asimilar manner.Example 2: Synthesis of phosphoramiditesSynthesis of a (2—cyanoethyl) N,N-diisopropylphosphoramidite(5) (B=T). The thymidine derivative (4) (1.50 g, 1.53 mmol)was dried by coevaporation with toluene (20 ml) anddissolved in anhydrous dichlormethane (15 ml). To thismagnetically stirred solution dry triethylamine (0.85 ml,6.0 mmol) was added followed by 2—cyanoethyl-N,N—diisopropylaminophosphochloridate (710 mg, 3.0 mmol). After15 min stirring at 20°C, TLC showed consumption of allstarting" material and formation of a single product. Thereaction mixture was quickly partitioned between saturatedaqueous sodium bicarbonate and dichloromethane and extracted(2x5O ml).evaporation of the organic phase was dried by coevaporationwith. dichlormethane The residue obtained afterwith. toluene and purified. on a short silica gel column,prepared and eluted with CH2Cl2/Et3N 9/1 V/v. Fractionscontaining the desired product were combined, evaporated invacuo, coevaporated with drytriethylamine, and dried in high vacuum to yield 1.57 g (87%) of an. oil; 3lP—NMR. (CDCl3 -+ 2 drops of triethylamine)148.61 ppm.The remaining amidites were prepared as above.Example 3: Construction of hydroxyalkyl-derivatized CPGsupport (14) (See Fig. 1)Asymmetrical anhydride (11) (see Scheme 2) was used forderivatization of aminopropylated CPG. The substitutionWO 98/08857l01520253035CA 02264154 1999-02-26PCTISE97/0141815 'level was analyzed based on DMTr cation release as describedin [Gait, (ed) (1984) Oligonucleotide synthesis; a practicalapproach.. IRL Press]. CPG derivatized to the extent of 28umol/g was selected for further experiments. Several DNAsynthesis columns were loaded with this support (ca 10 mgeach), and they were subjected to 10 coupling cycles with astandard thymidine amidite,(5)supports were used for oligonucleotide synthesis.followed by coupling of one ofthe nucleoside amidites to obtain support (14). TheseMethod A: Construction of support (13), Fig. 1.Several portions of a cross—linked polystyrene support (Mono(O,5O g)pyridine and suspended in pyridine(3) (Scheme 1),(10 ml),R)(from Pharmacia) were dried by coevaporation with(2 ml).prepared at a 2L mmol scale inDifferent volumesof compoundpyridine see Example IL above, were added. to theabove suspensions and the mixtures were shaken at 20°C for 2hr.reactionAll activated sites that could theoretically form in theof (2) with thequenched by the addition of methanolunreacted solid support were(5 ml). After 1 hrshaking, the mixture was filtered, dried by washing with drywhere(4—amounts ofthewere checked spectrophotometrically' aspyridine, and transferred back to the stoppered flask,unreacted hydroxyl groups were capped with Ac2O/DMAPThesupportdimethylaminopyridine)/pyridine for 2 hrs.DMTr to thedisiloxyl bondbound directly via(13)thymidineabove.Fig. 1derivatized with hydroxyalkylofinstrumentMethod B: Construction of support (14),A polystyrene support (10 mg),cassettes forAssemblerinto synthesisPlusgroups, was packedoligonucleotides on a Gene(Pharmacia). These packed supports were subjected to onecoupling cycle using a standard thymidine amidite that was 5WO 98/0885710152O253035CA 02264154 1999-02-26PCT/SE97/0141816times more diluted than recommended in standard coupling(10 min)Under the aboveprocedures. The support was extensively capped onthe machine operating in a manual mode.conditions the DMTr release experiments gave valuescomparable to those from the orginal 0.2 umol supports. Allsupports were further derivatized by coupling 9 consecutivethymidine nucleotides, followed by coupling of theappropriate amidite (5) from Example 2 above. Thesecouplings were performed using standard amiditeconcentrations and synthesis protocols.Example 5: Solid—phase synthesis of oligodeoxynucleotides(15), Fig. 1Using the ABI 394 DNA Synthesizer and CPG supportsThe CPG support (14) described above was used foroligonucleotide synthesis. All couplings were performedusing amidites protected by a benzoyl group at the exocyclicamine functions, under conditions recommended by themanufacturer for 0.2 umol scale synthesis, except thatnucleoside amidites were used at half the recommendedconcentrations. The final DMTr groups were left on thesynthesized oligonucleotide.Synthesis on a Gene Assembler (Pharmacia) using thepolystyrene supportAll syntheses were done at the 0.2 umol scale using PACamidites (Pharmacia Biotech AB), according to themanufacturer's instructions and without any changes in theconcentrations. Supports constructed(13) (14)see also Fig. 1.recommended amiditeaccording to methods A or B in Example 4 abovewere used,Normal scale reaction of standard nucleoside amidites or the(5)resulted ixi a very high loading.modified amidite with hydroxyalkyl—polystyrene supportQuantitative analysis ofWO 98/08857l0l520253035CA 02264154 1999-02-26PCT/SE97l014181 7 ‘the released DMTr—group revealed loadings of as much as 250to 290umol/g. Also functionalizations involving an excess ofreagent (3) gave a relatively high degree of substitution.Reaction of 0.5 mmol of (3) per 1 g of solid support at 20°Cfor 2 hrs resulted in a support loaded at 180 umol/g. Thesecomparatively large numbers were a consequence of the highdensity of hydroxyl groups on the support and of the highreactivity’ of the reagents used. Such highly derivatizedsupports are valuble for large—scale synthesis of shorttherapeutic oligonucleotides. For the synthesis ofrelatively long oligonucleotides measures had to be taken tolimit this high degree of substitution. A satisfactoryloading (38Lmml/g) could be obtained by using only 0.1 mmolof (3) per‘ 1 g of support. Several—fold. dilution of (5)under the recommended 0.1 M concentration was the bestmethod for direct incorporation of (5) on the polystyrenesupport. The same dilution method was applied to the firststandard amidite used for synthesis of the polystyreneversion of the support (14). All coupling reactionsdescribed above were followed by an extensive cappingprocedure to block any unreacted hydroxyl groups.Example 6: Deprotection. and, purification of the syntheticoligodeoxynucleotidesDifferent deprotection procedures were used, depending onthe type of support that was applied in the synthesis.CPG—anchored oligonucleotides. A syringe filled with amixture of Et3N/EtOH 1:1 v/v" was connected to a cassettecontaining support for oligonucleotide synthesis. Treatmentof the support with base proceeded for 3 hrs at 20°C, withthe occasional addition of a new aliquot of the solvent tothe cassette. The support was washed with ethanol (2 ml),water (2x2 ml), dried with acetonitrile (3x2 ml), and afteropening the cassette the solid support was transfered to aCA 02264154 1999-02-26WO 98108857 PCT/SE97/0141818 6‘Sarstedt screw—lock tube. Tetrabutyl ammonium fluoride(TBAF) 0.5 M in dry tetrahydrofuran (THF) (200ul) was addedl0l520253035and the mixture was incubated for 4 hr at 20°C. The cleavageof the disiloxyl linker could alternatively be done using200 ml of 0.5 M TBAF in dry DMF at 65°C for 30 min.(2 ml)65°CConcentrated aq. NH3 was introduced and the mixturewas placed in a oven for 12 hrs. After partialconcentration the oligonucleotide was desalted on a NAP 10Sephadex column (Pharmacia Biotech AB) and analyzed by HPLCon 51 RP 18 column. Preparative runs were done on an FPLCusing a reversed—phase Pep RPC column. Care was taken not tofractionate the hydrophobic trityl—containing product butrather to collect the whole peak,RPAfter evaporation,which closely resemblesseparations disposable cartridges (Sep-Pak,USA).DMTr groups was done using 80% aq.on C18,Waters, the final removal of theacetic acid for 20 min at20°C, with subsequent evaporation of the acid. Alternatively,oligonucleotides phosphorylated at their 5'—position by theTr—S were finally deprotected(1987)phosphorylatingaccording to theTetrahedron Lett ,reagentpublished procedure28(4), 463-466].[Connolly,Polystyrene support-anchored oligonucleotides. Aftercompleted. synthesis, the support was transfered from thecassette into a Sarstedt tube and subjected to treatmentwith concentrated aq. NH3 for 90 min at 65°C. After cooling,the particles were briefly centrifuged and the upper liquidphase was removed. The solid—support was washed 3 times with2 ml of water and dried by washing with acetonitrile. Twohundredul of 0.5 M TBAF in THP was added and the mixture wasincubated for 4 hr. Finally, the mixture was diluted with0.8 ml water and the oligonucleotide was desalted on a NAP10 Thepurification steps follow exactly those described for CPS-Sephadex column. further deprotection andbound oligonucleotides.WO 98/08857l01520253035CA 02264154 1999-02-26PCT/SE97/0141819Example 7: Electrophoretic analysis of oligonucleotidesbeatoligonucleotides tolabelled with 329analyzed5'—endelectrophoretically weretheir using polynucleotidekinase in a Soul reaction volume of 50 mM KAC,210 mM MgCl2,10 mM Tris—HAc (pH 7.5), 10 uCi (g—3 P)ATP (3000 Ci/mmol),and 10 U polynucleotide kinase (Amersham) at 37°C for 30 min.The labelling reaction was stopped by desalting on aSephadex G—5O spin column, followed by incubation at 65°C for5 min. All oligonucleotides analyzed electrophoretically inthis study were synthesized with a 5'—phosphate to ensurethat cleaved apurinic oligonucleotides would label with thesame efficiency as the full-length molecules. Afterseparation on a denaturing 6% polyacrylamide gel theradioactivity was recorded by autoradiography (AmershamHyperfilnn or, for quantitative measurements of bandintensities, scanned on a Phosphorimager instrument(Molecular Dynamics).Example 8: Purine-rich oligonucleotidesThe risk of depurination of an oligonucleotide increaseswith the number of purines and the total length of theoligonucleotide. An increased amount of purines in anoligodeoxynucleotide gives a high. probability‘ of itsdepurination and the following brake—down. To show thecapability of the new method to eliminate these shortsequences, two 81-mer (AG)40T sequences were synthesized inparallel using standard and novel CPG—based supports (14),respectively. Partially deprotected 5'—DMTr—substitutedoligonucleotides were analyzed and. isolated. by HPLC. Bothproducts were detritylated, 5'—32P kinased andelectrophoretically separated on a denaturing polyacrylamidegel. Theof theresults, presented in Fig. 2 show the superiorityinvention compared to prior art. This superiorityWO 98/08857l0l520253035CA 02264154 1999-02-26PCTISE97/0141820could already be anticipated by comparing the shapes of the(A).standard synthesis reflects the presence of the shorter andHPLC chromatogram The much broader peak obtained in thetherefore more hydrophobe tritylated fragments. It is clearfrom the scanned presentation of the gel separation (B) thatthe product synthesized according to the present inventionis practically free of all truncated and depurinatedsequences. Moreover, this material contains substantiallylesser amount of n—l fragments [(D) compared to (C)].Example 9: Circularization of a padlock probe(Ml3C9l: 5'-p-GCCTGCAGGTCGACTCTAGA(T)5QCGGCCAGTGCCAAGCTTGCA-3')synthesized according to the invention in order to test howA 91—mer oligonucleotidewereit would work as a padlock probe [Nilsson. et al (1994),supra] that is able to circularize in presence of anoligonucleotide template (Ml350comp: 5'-TTTTTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTTTTT~3 ' ) and aDNA—ligase.A The ligation reaction. was performed. using‘ 0.3pmol of 5'—labelled. probe and. 5.5 pmol of template in avolume of 10 ul 20 mM Tris-HCl ( pH 8.3), 25 mM KCl, 10 mMMgCl2, l mM NAD, 0.01% Triton X-100 and lO U of Tth DNAligase. The sample were subjected to one, two or threecycles of 94°C for 15 seconds and 55°C for 10 min. Thereactions were cooled on ice and stopped by adding 10 ul ofloading buffer containing 50 % formamide and 10 mM EDTAfollowed by a incubation at 65°C for 10 min. The reactionswere analyzed on a denaturing polyacrylamide gel as above.The result of the ligation is shown in Fig. 3 which clearlyshows that all full—length oligonucleotides are ligatable asas would be expected ifthewell as most of the n—l products,the distributed throughoutofwere evenlythedeletionssequence. It also shows presence many shorterWO 98/0885710152025CA 02264154 1999-02-26PCT/SE97l0l4l821products that are ligatable and thus having intact 5‘— and3'— ends thereby revealing deletion events of more than onenucleotide. Consequently, all nonligating shorter sequencesmust contain deletions that prevent effective hybridizationto the targed DNA.The present invention. delivers products free of truncatedand post—depurination cleaved fragments, morover, theisolated products contain much less n—l fragments. Theamount of this n—l material was estimated, in a studyperformed. on a short 5~mer sequence and. using" a standard(1995), 14(6) 1349-13571),By applying pre—cap proceduresynthesis protocolto be([Iyer et al,roughly 3 to 5 %.according to Iyer et al and short Contact time of ammoniawith the CPG support it was possible to lower this figure to1.5 to 2 %. In contrast, in an experiment according to theinvention for of a 20—mer using CPGsupport (14),found to be 1.9 %.present synthesisthe amount of contaminating n—l sequences wasThe support system of the present invention is not limitedto the so1id—phase synthesis of oligonucleotides describedabove. Another contemplated possibility is to use it as alinker between support and hydroxyl containing components inthe combinatorialchemistry ([Plunkett et al,6006—6007]).(1995), J. Org. Chem., 60(19),

Claims (10)

1. A support system, for solid phase synthesis of oligomers, comprising a support, a linker and a starting compound of the oligomer, characterized in that the starting compound of the oligomer is bound to the support via a disiloxyl linkage.

2. A support system according to claim 1, characterized in that the starting compound is a nucleoside and the synthesis is an oligonucleotide synthesis.

3. A support system according to claims 1 or 2, characterized by having the formula wherein a is a nucleoside or deoxynucleoside base; R2 is -H, -OH, or OR7 in which R7 is a protecting group; R1 is a protecting group; R3, R4, R5, R6 taken separately each represent alkyl, aryl, cycloalkyl, alkenyl, aralkyl, cycloalkylalkyl, alkyloxy, aryloxy, cycloalkyloxy, alkenyloxy and aralkyloxy;
Supp is a solid support; X is an anchoring group use~ for covalent bonding to the support;
(~-Y)n and (~-Z)m are oligophosphotriester linkers, wherein ~ represents a phosphotriester, Y and Z are independently selected from a nucleoside and a rest of a diol, A is an aliphatic or aromatic group, n is a number between 0-50, preferably 0-10, and k, l, m are each a numbers of 0 or 1, with the proviso that when m and n are 0 then 1 and k are 0 and with the proviso that when m > 0 then k is 0 and X is O
or S.

4. A support system according to claim 3, characterized in that the anchoring group is O, S or an amide function.

5. A support system according to any one of the above claims, characterized in that R1 is a trityl, monomethoxy trityl, dimethoxytrityl, pixyl or other higher alkoxy-substituted trityl- protecting groups, and B is adenine, guanine, cytosine, uracil, thymine, or inosine.

6. A support system according to any one of the above claims, characterized in that R3, R4, R5, R6 are isopropyl

7. A method for synthesis of oligonucleotides on a solid support, characterized by the following steps:
(i) preparing a support system as defined in claim 3;
(ii) condensation of nucleotides onto the first nucleoside of the support system to synthesize an oligonucleotide;
(iii) removal of all protecting groups on the oligonucleotide exept the 5'-protecting group, and cleavage of apurinic sites formed during acid-catalysed deprotection;
(iv) cleavage of the full length product from the support;
and (v) purification of the oligonucleotide.

8. A method according to claim 7, characterized in that in step (i) an oligophosphotriester linker (p-Y)n is synthesized on the solid support and that a starting nucleoside is bound to the linker via a (p-z)m linker and a disiloxyl group.

9. A method accoraing to claim 7, characterized in the disiloxyl linkage is cleaved selectively with tetra alkyl ammonium fluoride before step (v) and the purification is performed by reversed phase chromatography, using the 5'-protecting group as an affinity handle.

10. A method according to claim 7, characterized in step (v) is performed by exonuclease treatment whereby non-protected oligonucleotides will be digested.