CA2253582A1 - Method for dissociating biotin complexes - Google Patents

Abstract

A method for dissociating a complex of a biotin compound and a biotin-binding compound, by contacting the complex with an amine, is disclosed.

Description

CA 022~3~82 1998-10-30 wo 97/43617 PCT/USg7/08052 METHOD FOR DISSOCIATING BIOTIN COMPLEXES

~n~ ofthe Tnv~nti~n Today many powerful teçhniques, derived from l ~isear~ in moleclllqr biology, are ready to be used in routine ~li~nostic or forensic app!ic~tion~. Prorninent 0 PY~mples are the polymerase chain reactiQn~ PCR (Saiki et al., Science, 230, 1350-1355, 1985), based on a cyclic, template-directed primer extension reaction; the analysis of restriction fragment length polymorphisms (Kan Y.W. and A.M. Dozy, Lancet 2: 910-912 (1978)); and the ligase chain reaction (Barany, F. (1991) Proc.Natl.Acad.Sci. USA, 88, 189-193) to detect known point mutations at the ligation site of adjacçnt oligonucleotides.

It appears likely that in the near future, application of these ter.hniq~es for analysis of DNA will augment or supplant conventional di~gnostic procedures based, for example, on the detection of disease-associated met~olites.

Currently, the most common tool for the analysis of DNA is fragment separation by gel electrophoresis. However, in many cases, electrophoretic analysis and subsequent detection of labeled fr~gments is more time-con~.~mine than pe-ro~ming the enzymatic reaction, and ther~rore is a time-limiting step.

Detection techniques are under development which will enhance signal acquisition and provide automated and parallel sample proce~sing, and will likely lead to cost-efflcient and time-saving sample processing in diagnostic and forensic applications.
Also, large DNA sequen~ing projects, such as the Human Genome Initiative, that seek to sequence genes or entire genomes, for research or diagnostic purposes, require automated techniques with a high throughput to ensure timely completion of the project.

A promising tool, which meets at least some of these criteria, is the analysis of DNA fr~gment~ by matrix assisted laser desorption/ionization time-of-flight CA 022~3~82 1998-10-30 (MALDI-TOF) mass sl)c~ u~ y (Karas, M. andHill~n~mp, F. (1988) Anal.Chem., 60, 2299-2301).

The biotin-streptavidin system is a cûmmon and useful tool for the s purification of biotinylated materials (X. Tong and L.M. Smith (1992) AnaL Chem., 64, 2672-2677), e.g., products from PCR or sequencing reactions. Streptavidin (and also avidin) are bacterial prûteins which forrn tight complexes with biotin, inçh1~1in~ biotin conjugated to other molecules such as nucleic acids. The stability of the biotin-streptavidin complex during intensive washing permits removal of non-specifically bound 10 and non-biotinylated material, which is of great importance for the success of reaction product analysis. The properties of the biûtin-streptavidin complex can be used in systems employing biotin binding to streptavidin on a solid support and immobilization of biotinylated molecules. The solid phase, including the complexed biotinylated molecules, can be physically collected for further manipulations, including i) removal of excess 5 reaction components like buffer salts, enzymes or deoxynucleotide triphosphates (dNl Ps) or ii) pelÇûllllance of enzymatic reactions like nucleolytic digests and solid phase sequenclnf~

A broad spectrum of applications for the biotin-streptavidin system is 20 known and even techniques not yet develûped will be adaptable to this system (see, e.g., Stahl et al. Nucleic Acids Research (1988) 16, 3025-3038; Hultman et al. Nucleic Acids Res. (1989) 17, 4937-4946; Hornes et al. Gene~. Anal. (1990) 7, 145-150).

Although the biotin-streptavidin complex is the result of non-covalent 2s bonding, the affinity of streptavidin for biotin is about one million times more powerful than those of most antibody-antigen interactions. However, for the analysis of reaction products, it is important to provide conditions for an effective dissociation of the complex to recover the analyte molecules without modification.

Currently, the recovery of biotinylated substances is based on biotin-sllepta\/idin complex dissociation using substances like phenol, urea or most preferably .. . . .

CA 022~3~X2 1998-10-30 95% foll"al~,ide at te~.,pelal~lres between 25 and 100~C. (Cocuzza et al., U.S. Patent No.
5,484,701, 1996).

However, the use of formamide has been shown to be harmful for sample s cryst~lli7.~tion, a n~cçs~ry process for MALDI-TOF analysis, and for various enzymatic reactions (e.g. reactions employing alkaline phosphatase). Therefore methods based on the use of rolll,al,lide are only useful for subsequ~nt gel electrophoretic analysis, but are harmful if enzymatic reactions should be performed involving the isolated material or other analytical tools are applied. The endo- or exonucleolytic digest, for example, of PCR
0 products would benefit from a method allowing isolation of single stranded PCR products which can be digested after purification.

Gel electrophoresis, the time and sample throughput limiting factor in DNA di~gnostics, will be replaced by more efficient techniques in the near future.
Summary of the Ipventioll In one aspect, the invention provides a method for dissociating a complex comprising a biotin compound and a biotin-binding compound. The method includes cont~cting the complex with an effective amount of an amine, under conditions such that 20 the complex is dissociated, thereby forming a biotin compound and a biotin-binding compound.

In p,ef~ d emborlimçnts, the complex is contacted with an amine at a temperature of be~ e.- about 25~ and about 100~. In p~efelled embod;...~l-ts, the biotin 2s compound is a biotinylated macromolecllle. In prerelled embodiments, the biotinylated macromolecule is sPlected from the group consisting of a biotinylated nucleic acid sequence, a biotinylated protein, a biotinylated carbohydrate, and a biotinylated lipid. In plefe -ed emborlim~ntc, the biotin-binding compound is selected from the group consisting of avidin, streptavidin, and derivatives thereof.
In p~e~lled embodiment.c, the biotin-binding compound is immobilized on a solid support. In pl~lled embodimçntc, the solid support is a m~~nçtic bead.

CA 022~3~82 l998-l0-30 In certain prere.,ed embodim~nts, after the contActi~ step, the biotin compound is separsted from the biotin-binding compound. In prere"ed embo~ x~
after the separation step, the biotin compound is purified. In prefelled embo~ 7 the s biotin compound is purified by a method selected from the group con.~i~ting of Iyophili7~tion, pleç;p;l~l;on, filtration, and dialysis.

In prerelled embodim~nt~, prior to the contacting step, the complex is purified.

In other prefe,l ed embodiments, the biotin compound is immobilized on a solid support.

In pr~Çe"ed emborlim~nt.c, after dissociation ofthe complex, at least one of 5 the biotin compound and the biotin-binding compound is analyzed by mass spectrometry.

In certain p,~re,. ed embodiments, after dissociation of the complex, the biotin-binding compound retains biotin-binding activity. In pl efelled embodiments, after dissociation of the complex, the biotin moiety of the biotin compound remains 20 substantially intact.

In particularly plef~l,ed embodiments, the amine is ammonia. In other plt;~l,ed embodim~nt.~ the amine is a primary amine.

2s In another aspect, the invention provides a method for analyzing a biotinylated nucleic acid. The method includes the steps of contActing the biotinylated nucleic acid with a biotin-binding compound, thereby forming a biotinylated nucleic acid:biotin-binding compound complex and contacting the complex with an effective amount of an amine, under conditions such that the complex is dissociated, thereby rele~cing a biotinylated nucleic acid and a biotin-binding compound; and ana}yzing the biotinylated nucleic acid.

... _ T

In prere..ed embo~lim~nts~ the nucleic acid is DNA. In ple~lled embo~lim~nt~, the biotin-binding compound is immobilized. In pre~.led embo~im.ont~, the biotinylated nucleic acid is analyzed by mass spectrometry. In prere~ ~ ed embo-lim~nts, 5 the amine is ~mmoni~

Thus, in one embodiment, the subject method provides a process for isolating biotinylated single stranded or double stranded DNA from enzymatic reactions for the purpose of purification and sample conditioning, which can be followed by 0 subsequent analysis (e.g., by mass spectrometry) or further enzyrnatic reactions.

The above and further features and advantages of the instant invention will become clearer from the following detailed description and claims.

5 Brief Descril?tion Of The Fi~ures Figure 1 is a sch~m~tic drawing of the purification of biotinylated PCR
products where the reaction was carried out in solution.

Figure 2 is a schem~tic drawing of two di~. el~l means for detecting Sanger sequenring products.

Figure 3 is a sch~m~tic drawing of di~renl means for detecting PCR
digest products with single- or double-stranded specific endo- or exomlcle~ces to generate DNA sequence information.

Figure 4 shows a MALDI-TOF MS spectrum of a biotinylated 20mer oligodeoxynucleotide (SEQ ID NO: 1) immobilized on streptavidin Dynabeads and recovered using the method as described in Example 1.

.. . , , ~, ~ ....... . . . ..

CA 022~3~82 1998-10-30 WO 97/43617 PCT/US97/~8052 Figure S shows a MALDI-TOF MS spectrum of a PCR product from the hep~titi~ B core antigen coding DNA region, purified with streptavidin Dynabeads and recovered from the beads using ammonium hydroxide, as described in Example 2.

Figure 6 shows a mass spectrum of the A-reaction of the Sanger sequencing reaction purified with M-280 streptavidin Dynabeads.

Figure 7 shows a mass spectrum of an exonucleolytic digest of a 60 mer PCR product.

Figure 8 shows a mass spectrum of an exonucleolytic digest of a biotinylated 25mer immobilized on Dynabeads.

Detailed Description of the Invention In general, the invention features a method for dissociating biotin compounds, incl~1tling biotin conjugated (biotinylated) carbohydrates, proteins,polypeptides, peptides and nucleic acid molecules (e.g., double-stranded or single-stranded DNA or RNA), from biotin-binding compounds, including streptavidin or avidin compounds. Once isolated, the biotin compound (or biotin-binding compound) can be analyzed using various detection methods and/or employed in further enzymatic reactions.

The term "biotin compound", as used herein, refers to biotin and biotin derivatives and analogs. Thus, "biotin compounds" include compounds such as biotin, imminobiotin, and covalent or non-covalent adducts of biotin with other moieties.
2s ~reÇe, .ed biotin compounds retain the ability to bind to avidin or streptavidin, or other biotin-binding compounds. For example, biotin has been used to derivatize a variety of molecules, including both small molecules (for example, chelating agents, e.g., '86Re-chelators conjugated to biotin, see, e.g., U.S. Patent 5,283,342 to Gustavson et al.) as well as large molecules, inclllrlin~ biomolecules (e.g., nucleic acids (including DNA, RNA, DNA/RNA chimeric molecules, nucleic acid analogs, and peptide nucleic acids), proteins (including enzymes and antibodies), carbohydrates, lipids, and the like). Methods of conjugating biotin to other molecules ("biotinylation") are well known in the art, and a CA 022~3~82 1998-10-30 variety of biotinylating reagents are commercially available (from, e.g., Pierce, Rockford, IL). A variety of coupling or crosslinkine agents such as protein A, carbodiimicle, ~im~l~imide, dithio-bis-nitrobenzoic acid (DTNB), N-sucGinimidyl-S-acetyl-thioacetate (SATA), and N-succinilnidyl-3-(2-pyridyldithio) propionate (SPDP), 6-5 hyd. ~zinonicotimide ff~YNIC), N3S and N2S2 can be used in well-known procedures to synth~ci7e biotin amide analogs or biotin compounds. For example, biotin can be conj~ ted via DTPA using the bicyclic anhydride method of Hnatowich et al Int. J. Appl.
Radia~. Isotop. 33: 327 (1982). In addition, sulfosuccinimidyl 6-(biotin~mido) hexanoate (NHS-LC-biotin (which can be purchased from Pierce), "biocytin", a Iysine conjugate of o biotin, can be useful for making biotin compounds due to the availability of a primary amine. In addition, corresponding biotin acid chloride or acid precursors can be coupled with an amino derivative by known methods. Thus, preparation of a variety of moieties conjugated to a biotin compound is possible. Furthermore, a biotin compound can be conjugated to a solid support, if desired.

The term "conj~.g~ted~" as used herein, means ionically or covalently linked or ~tt~ched (e.g., by use of a derivatizing reagent).

The term "biotin-binding compound" refers to a compound which can 20 tightly but non-covalently conjugate with biotin compounds. Biotin-binding compounds include avidin and streptavidin, as well as derivatives and analogs thereof, inçllldin~ avidin or streptavidin conjugated to other moieties (such as other proteins). Plefel~ed biotin-binding compounds include avidin, streptavidin, covalent adducts of avidin and streptavidin, and fusion proteins having a domain which has biotin-binding activity. In 25 certain embodimerlts~ anti-biotin antibodies can be used as the biotin-binding compound.
The covalent linkage of biotin-binding compounds such as streptavidin is well known, and some streptavidin-conjug~ted solid supports are commercially available (e.g., Dynabeads m~gnetiC microbeads, Dynal, Hamburg, Germany). Thus, biotin-binding compounds linked to an insoluble support are useful in the present invention.

... ... . . .. . . .. .... .. . . . ..

CA 022~3~82 1998-10-30 A "solid support" refers to a support which is solid or insoluble material (e.g. a material that can be separated from a reaction mixture by filtration, precip;lalion, ma{~P,tic separation, or the like). Exemplary solid supports include beads (such as Sepharose, Seph~dex, polystyrene, polyacrylamide, cçlllllosç, Teflon, glass, (inc~
s controlled pore glass), gold, or pl~tinllm); flat supports such as membranes (e.g., of cellulose, nitroc~ll.llose, polystyrene, polyester, polycarbonate, polyamide, nylon, glass fiber, polydivinylidene difluoride, and Teflon); glass plates, metal plates (incl~ldin~ gold, pls~timl~, silver, copper, and st~inl~s steel); silicon wafers, rnictrotiter plates, and the like.
Flat solid supports can be provided with pits, ch~nnçle~ filter bottoms, and the like, as is 0 known in the art.

A "biotin compound:biotin-binding compound complex" refers to a non-covalent complex formed by the binding of a biotin compound to a biotin-binding compound.
The term "analyzing," as used herein, refers to detection of, or characterization of, a molecule or moiety. Thus, a molecule can be analyzed by a variety of known te~hn:~ues, inclu~lin~ spe1l.ornetric techniques such as W/VIS, lR~ or NMR
spectroscopy, mass specl-on.el,y, chromatography, electrophoresis, or other methods known in the art, or colllbhl~lions thereof. "Analyzing" can also include methods such as sequen~ing of nucleic acids.

The term "anunollia", as used herein, refers to NH3, or any salt thereof.
Thus, depending upon the solvent used, and the pH of the solvent, ammonia may bepresent as NH3, or may be in the form of an ammonium salt or compound. For example, ammonia in aqueous solution can exist largely as ammonium hydroxide (depending on the pH), but is generally referred to herein as "ammonia."

The term "amine", as used herein, refers to a compound having the structure NR'3, or N+R'4 in which R' is a hydrogen, alkyl (inc.11l~1ing cycloalkyl), alkenyl, alkynyl, or aryl group, and can be independently selected for each occurrence. Two or CA 022~3~82 1998-10-30 more R' groups can be selected such that they form, together with the nitrogen atom to which they are ~tt~çhe-l, a cyclic amine (for example, pyrrolidine or piperidine). In certain embodiments, aromatic amines such as pyridine are contemplated for use in the subject methods. Where an R' group is alkyl, the alkyl group can have from one to twelve carbon s atoms in a straight or branched chain. Lower alkyls (having from one to six carbon atoms in a branched or straight chain) are pre~, I ed. A prere~ I ed aryl group is phenyl, which can be substituted or unsubstit~lted Exemplary amines include ammonia, methylamine, diethylamine, aniline, and diisopropylethylamine. Further, quaternary amines, such as tetrabutyl ammonium (e.g., as tetrabutylammonium hydroxide), can be used in the 10 methods ofthe invention. Other nitrogen-cont~ining compounds, inrl~lding hydrazine, and derivatives and analogs thereof, can also be used in the invention.

It is believed that small amines (i.e., those molecules with small steric bulk, e.g., where at least one R' is hydrogen or a small alkyl group such as methyl) are more effective than larger amines at dissociating biotin compound - biotin-binding compound complexes. Thus, amines in which each R' is sterically small (e.g., hydrogen or a small alkyl group such as methyl) are p, t;~" ed. In particular, primary amines are more prerelled than secondary amines, which are in turn more plefelled than tertiary arnines, which are in turn more prefel I ed than quaternary amines. In general, an amine will be 20 selected according to factors such as cost, efficacy, ease of h~n~ling, ease of purification of the desired products, and the like. Ammonia is a most preferred amine, at least in part because amrnonia effectively cleaves biotin complexes and is inexpensive, readily h~n~led as either the gas or arnmonium hydroxide in solution, and easily removed when reaction is complete (e.g., by Iyophilization). As described in more detail below, the use of ammonia 2s as the cleaving reagent permits facile purification of biotin compounds by removal of excess ammonia under a vacuum. Thus, in certain embo-iiment~, an amine that is sufficiently volatile to be removed by Iyophilization is preferred. However, other methods of purifying a biotin compound or biotin-binding compound (or a mixture of both) can be employed, inclllding, for example, dialysis, gel electrophoresis, capillary zone30 electrophoresis, affinity chro~latography, cryst~lli7~tion, column chrolllatography (e.g., gel or ionic eYc.ilqnge cl~omdtography), E~'LC, and the like.

.. .. . . ...

CA 022~3~82 1998-10-30 The m.oth~ulc of the invention are particularly useful in purification of biotinylated compounds. For P.Y~mplç, a biotinylated compound can readily be separated from non-biotinylated compounds simply by collt~cting a reaction lni~.lure with s immobilized biotin-binding compound, e.g., covalently bound to a solid support, followed by separation and washing of the immobilized complex of the biotin compound with the biotin-binding compound. The biotinylated molecule can then be isolated by dissociation of the biotin - biotin-binding compound complex, followed by separation of the biotin compound from the solid support. The purified biotinylated compound can then be 0 Iyophilized, further purified by conventional techniques, or the like. The skilled artisan will appreciate that a biotin-binding compound can be purified by an analogous process, e.g., by cont~r.ting a reaction mixture con~aining a biotin-binding compound with an immobilized biotin compound to form a complex, followed by purification and subsequent dissociation of the complex.
In the case of biotinylated nucleic acids, the biotin-streptavidin system can be used for the isolation of either single- or double-stranded nucleic acids, e.g., DNA. A
prerel. ed application is the isolation of a double-stranded PCR product, the subse~uent removal of the non-biotinylated strand and the downstream processing of the single 20 strands (Mitchell, L. G., et al. (1994) "Advances in Biomagnetic Separation," Eaton Publishing, Natick, MA, USA, p. 31-48). Currently, denaturing of double-strandedproducts on streptavidin Dynabeads is preferably done using 0.1 M NaOH. Other applications include the purification of PCR and LCR products as well as purification of DNA seq~ncing products (Jurinke, C., et al., (1996) Anal. Biochemis~7y, 237, in press).
The exact mode of action of ammonia and other amines on biotin decomplexation is not known. It is believed that the pH of the reaction system is impol la~ll to effectively decomplex biotin and biotin-binding compounds within a reasonable time. However, it is known that biotin complexes are stable up to relatively 30 high pH in the absence of ammoni~ In particular, 0. lN sodium hydroxide solution (at a pH of about 13) is less effective at cleaving biotin compound:biotin-binding-compound CA 022~3~82 1998-10-30 WO 97143617 rCTlUS97/08052 complexes than is 25% ammonium hydroxide solution. Ammonia is known to be a strong hydrogen bond donor-acceptor. Without wishing to be bound by any theory, it is believed that the ammonia molecules are small enough to diffuse into the biotin complex and disrupt the bonding (e.g., hydrogen bonding) of the biotin moiety with a biotin-binding s compound. The biotin compound retains the ability to bind to a biotin-binding compound after tre~tm~nt with ammoni~J and the biotin moiety can remain subst~nti~lly intact.

Thus, the pH of the reaction mixture can affect the rate of complex dissociation. In pref~l l ed embodiments, the pH of the reaction mixture is in the range o from about 7.0 to about 14.0, more preferably from about 8.0 to about 13Ø
The concentration of the ammonia or other amine is also important. A
prere..ed concentration is at least about 5% ammonia or amine, more preferably at least about 10%, and still more preferably at least about 15% (w/v). Higher concentrations will generally result in more rapid complex dissociation. Accordingly, a concentration of about 25 - 28% is plefelled. An ammonia concentration of 25 -28% can be readily achieved with commercially available ammonium hydroxide solutions.

The t~l--pe-~L.lre at which the cleavage reaction is performed also affects the rate of complex dissociation. The temperature will be chosen according to considerations such as the rate of reaction (which will be faster at higher temperatures) and the stability of the components (e.g., the biotin compound and biotin-binding compound), which will generally be less stable at higher temperatures. In pr~rel I ed embodiment.~ the temperature is in the range of from about 25~C to about 100~C, more preferably from about 40~C to about 80~C. A preferred temperature is about 60~C. In certain embodiments it may be pl ~rel I ed to perform the cleavage reaction under pressure (e.g., in the range of 1-200 atm), or in a sealed reaction vessel (such as a sealed tube or bomb).

The reaction mixture can be an aqueous mixture such as a solution or suspension, or a non-aqueous solvent can be employed, including, e.g., met~l~nol, ethanol, CA 022~3~82 1998-10-30 ~cetonitrile, dimethylro....~ le, and the like. Mixtures of solvents can also be employed (e.g., water/~ h~nol or water aeetonitrile). The solvent will in general be selected to be co,..palil)le with at least one of the biotin compound, the biotin-binding compound, or the amine. The choice of an approp.iale solvent will be routine to the skilled artisan.
5 Aqueous solvents are generally pl erel ~ed.

Of course, the skilled artisan will appreciate that not all biotin compounds (or biotin-binding compounds) will be stable to all reaction conditions. For example, where a biotin compound is a biotinylated protein (e.g., a biotinylated antibody), vigorous o conditions such as high pH and high temperature can denature the protein moiety. Thus, condition~ will in general be selected to avoid undesired denaturation or destruction of at least one of the biotin compound or biotin-binding compound.

The method of the invention can be used to purify a biotin compound. For 5 example, in a pl~ rel~ed embodiment, the method comprises the steps of cont~cting a biotin compound:biotin-binding compound complex with an effective amount of ammonia, under conditions such that the complex is dissociated, thereby forming a biotin compound and a biotin-binding compound. In certain preferred embodiments, the method inçhldes7 prior to the dissociating step, the step of purifying the biotin compound:biotin-binding 20 compound complex by se,oal aling the complex from at least one impurity. Thus, by cont~cting a reaction mixture comprising a biotin compound with a solid support comprising an immobilized biotin-binding compound, followed by purification of the complex and subsequent release of the biotin compound from the complex by ll e~
with an amine, the biotin compound can be purified from a complex reaction mixture.
2s Examples of the purification of, e.g., nucleic acids, by the methods of the invention are provided below. It has been found that the inventive methods are particularly useful where a biotin compound is to be analyzed by mass spectrometry subsequent to complex dissociation. In this embodiment, use of ammonia as the amine is prerel l ed.

Thus, in a pl erel I t;d embodiment, the invention provides a simple method for isolating biotin-conjugated molecules from biotin-streptavidin complexes. The method CA 022~3~82 1998-10-30 is coll.pa~ilJle with subsequent mass spe~ on,el. ic analysis of the isolated biotin-conjugated mqlecllles The subject method provides a mass spectrometric-co..,palil,le process for 5 rele~cing intact and non-modified biotinylated molecules from biotin-streptavidin comrlçY~s by a brief treatment of a complex with an amine (e.g., ammonia, which can be supplied as ammonium hydroxide), preferably at slightly elevated temperatures. Several mass spectrometer formats can be used for detection of the recovered products, inr.lul1ing ionization by matrix assisted laser desorption / ionization (MALDI), continuous or pulsed 10 electrospray (ES), or massive cluster impact (MCI); and detection formats inelu-lin~ linear or reflectron time-of-flight (TOF), single or multiple quadrupole, single or multiple m~gnetic sector, Fourier Tl~n~rolln ion cyclotron resonance (ICR), ion trap, andcombinations thereof. For ionization, numerous matrix/wavelength co...binalions (MALDI) or solvent con.bil-ations (ESI) can be employed.

This new method is of out.ct~ntli. g importance for all processes which are based on a fast and qu~ntit~tive recovery of biotin-conjugated materials from biotin-streptavidin complexes and subsequent enzymatic reactions and analysis via techniques negatively inflllenced by organic impurities such as formamide. These include, for 20 example, analysis of PCR- or DNA sequencing products with mass spectrometry for diagnostic purposes.

Figure 1 illustrates one embodiment of the invention. Figure 1 is a sch~ tic drawing of the purification of biotinylated PCR products where the reaction 25 was carried out in solution. In this scheme A ~ ~pl esenls the biotinylated PCR product, R
represents reaction components and impurities and 11 represents the streptavidin coated solid support (e.g. streptavidin Dynabeads or multititer plates).

In step 1 of this embodiment a PCR reaction is carried out with at least one 30 biotinylated primer. The biotin group can be attached either on the 5'-hydroxyl group of the primer or at an internal base. By choosing approp- iate conditions, as are known in the ~ -- ., . . ~ . .

CA 022~3~82 1998-10-30 art, in the presence of buffer, templ~t~, deoxynucleotides and a thermostable DNA
polymerase (collectively depicted as R) a biotinylated PCR product (A) will be generated.
Since short primers will immobilize more efficiently than longer PCR
products, in step 2 of Figure 1, the non-eYten(led primer is removed by ultrafiltration s through si~ze-eYcl~lQ;cn n,e~.lb,anes~ according to procedures described in the art. After ulll&lilllalion, the PCR product will sometimes be accompanied by enzyme and/or some buffer components (R). For further purification, the PCR product can be compl~Yed to a solid support (H) having a biotin-binding compound immobilized thereon (e.g., streptavidin or avidin). The complexation conditions may vary; suitable conditions include 10 in~.ub~tion at ambient te...pe-alure in the presence of 2M sodium chloride or ammonium chloride, and a pH of around 7.5. The nature of the solid support may vary, and include, e.g., m~netic particles (e.g., beads), multititer plates with or without filter plates, glass, silicon wafers with or without pits, plastic, paper, flat arrays, capillaries, agarose or sepharose. Streptavidin-coated m~gnetic beads (Dynabeads, Dynal, Inc) are preferred.
In step 3 of Figure I, due to the stability of the biotin-streptavidin complex, intensive washing can be pelro--ned to remove all excessive reaction components prior to the recovery of the PCR product. The complexed and purified PCR product is then treated with a small volume of 25% ammonium hydroxide, preferably at about 50 - 60~C, 20 to overcome the biotin-streptavidin interaction.

In step 4 of Figure l, the pure PCR product is accompanied only by ammonium hydroxide. The ammonium hydroxide can easily be removed by Iyophilization or ethanol pl ecipilation, both methods well known in the art. The pure PCR product is 25 redissolved, most preferably in ultrapure water. Other conditions can be chosen, for example varying buffers as a solvent. The PCR product now can be employed in dowl~sLI~anl applications, e.g., enzymatic reactions or detection, for example, via mass specl.ometry or gel electrophoresis in slab gels or capillaries, as described in the art.

Using ~mmoni~ for the dissociation of the biotin-streptavidin complex is of special interest for detection of DNA using mass spectrometry. It is known that CA 022~3~82 1998-10-30 heterogenity of cations leads to a bro~denin~ of mass signal and interferes with the detection process. Thus, mass spectrometric detection would benefit if cation homogeneity could be achieved. The methods of the invention provide DNA with a homogeneous cation distribution, because after treatment with ammonia, most of the s phosphate groups will carry an ammonium counterion. Another advantage is that DNA
with ~mmonium counterions is known to have preferred properties for mass spectrometric (e.g. MALDI-TOF) MS analysis.

A second embodiment of the subject method is illustrated in Figure 2. It 0 features the detection of Sanger seq~lencing products and the use of a biotin-streptavidin complex in the process. Figure 2 is a sçh~m~tic drawing of two different means for detecting Sanger sequ~ncing products. On the left side of this scheme, a biotinylated primer is used and the reaction is carried out in solution with subsequent imrnobilization, purification, a~ l.onium hydroxide tre~tmpnt and detection. On the right side, the reaction 5 is performed as a solid phase reaction. In this scheme B represents biotinylated primer extension products, R represents reaction components and impurities, C represents template DNA, and ~I represents the streptavidin-coated solid support.

As shown in Figure 2, le~ column, in the first step, a Sanger sequerlcirtg 20 reaction is carried out in solution with a biotinylated primer. The products arising from this primer extension reaction are double stranded nucleic acids consisting of the extended biotinylated primer (B) and the template strand (C). In the second step, as show in Figure 2, the biotinylated complex is immobilized on a streptavidin-coated solid support (H) (as described above). Due to the stability of the biotin-streptavidin complex, the immobilized 25 col..plex can be separated from excess reaction components, by-products and impurities (R) as previously described. In the third step the template DNA is denatured from the biotinylated primer extension products (B) by mèthods well known in the art. A solution of 8 M urea was used for the purpose of denaturation. Further washing steps, preferably with ultrapure water, were employed to remove the urea and the template strand. In the 30 fourth step, the purified biotinylated sequencing product (B) was recovered through L~ .el~l with 25% ammonium hydroxide. Removal of ammonium hydroxide can be . . ~ . . .

CA 022~3~82 1998-10-30 pe,rol",cd using ethanol p~cc~ l;on or Iyophilization, as described above. The biotinylated products can be resuspended in ultrapure water and analyzed by massspe~,~,o,l,et~y or gel electrophoresis or subjected to further enzymatic re~ctiol c.

s In a variation of this second embo-liment the sequçn~ ing reaction is carried out on a solid support. Figure 2, right column, illustrates this variation. In the first step, the biotinylated primer is immobilized on a streptavidin-coated solid support (H). In the second step, a t~.mpl~te strand is annealed to the immobilized biotinylated primer. In the third step, a sequencing reaction, such as Sanger sequencing, is carried out. In the fourth lo step, reaction components and impurities (R) are removed through washing. The template is denatured from the biotinylated extended primer using urea as described above, and further washing steps are carried out. In step 5 the purified biotinylated extension products (B) are recovered through treatment with ammonium hydroxide as described above, and subjected to analysis, for example, via mass spectrometry, electrophoresis or further enzymatic reactions.

A third embodiment of the instant invention is illustrated in Figure 3.
Figure 3 is a sch~m~tic drawing of different means for detecsing PCR digest products with single- or double-stranded specific endo- or exo-nucleases to generate DNA sequence information. In this scheme A . e,orescn~s biotinylated PCR product; D I e~ol esen~s digested biotinylated PCR product; E rt;presents biotinylated single-stranded PCR digest product;
F represe.~ lnriigested biotinylated single-stranded PCR digest product; G represe.ll~
digested biotinylated single-stranded PCR digest product; ~I represents a streptavidin coated solid support; and R J epresellLs reaction components and impurities.

This embodiment features the sequencing of PCR products with endo- or exo-nucleases and the use of the biotin streptavidin complex in this process. In the first step, as shown in Figure 3, le~ column, a PCR reaction is carried out with one biotinylated primer. Prior to further reactions unincorporated primers are removed using ultrafiltration through a molecular weight cutoffmembrane (as described above). In the second step, the biotinylated PCR product (A) is subjected to digestion with double-CA 022~3~82 1998-10-30 strand specific enzyrnes. This can be carried out using, for example, DNaseI, which nicks the double strand DNA st~ti~ 11y at each phosphodiester bond. The reaction can be carried out in a way such that each double strand arising from the PCR reaction is nicked once st~ti~ti~ y ~Low, C. M. L. e~ al. (1984) Nucleic Acic~s Res. 12 4865-4879). A
s second approach is the use of exonuclease III, which digests double strand DNA from the 3 end of the molec~lle. A third approach uses type 2 restriction-endon~ e~s~s to carry out RFLPs in combination with subsequent analysis, for example, via mass spe.;l.~r.e~ly or electrophoresis. In the third step, the biotinylated digestion products (D) of step 2 are immobilized on a streptavidin coated solid support (H) (as described above). In step 4, lo the immobilized biotinylated products are separated from reaction components and impurities (R~ (as described above) and the hybridized non-biotinylated products are removed using a denaturing agent like urea (as described above for the second embodiment). The biotinylated products (E) are released from the solid support by t.eaLl..cnt with ammonium hydroxide. After removal of the ammonium hydroxide using 5 ethanol precipitation or lyophili7~ion, the biotinylated products (E) can be resuspended in, for example, u}trapure water and analyzed, for example, via mass spectrometly or electrophoresis .

A variation of this embodiment features the sequençing of PCR products 20 with single strand specific endo- or exo-nucleases and the use of a biotin-streptavidin complex in the process. It is illustrated in figure 3 ("Variation l "). The biotinylated PCR
product (A) is immobilized on a streptavidin coated solid support (H) after ultrafiltration (step 2). In step 3, the non-biotinylated strand is denatured using urea, and further washing steps are carried out. In step 4, the imrnobilized biotinylated single-stranded PCR
2s product (F) can be digested with a single strand specific endo- or exo-nucle~ce. For endonuclease digestion, mung bean nuclease or S 1 nuclease is prerel l ed, while for exonuclease digestion, calf spleen or snake venom phosphodiesterase are prefe-l ed, with the latter being particularly pl ererl ed. The immobilized digestion products (G) are purified with further washing in step 5, and are recovered from the solid support using 30 Lle~ ent with amrnonium hydroxide. As described previously, the recovered biotinylated products (G) can be analyzed after ethanol precipitation or Iyophilization.

., . .. . . . . .. . , . . . , .. . .. , . ~ . .. ... . . . . .. .

CA 022~3~82 1998-10-30 In another variation of this embodiment (shown in Figure 3 as "Variation 2"), in step 5, an immobilized single-strand PCR product (F) (as described above in step 3) is treated with ammonium hydroxide to recover the biotinylated single strand PCR
s product (F). The ~.. onium hydroxide is removed using, e.g., ethanol plecip;~alion or lyophili7~tion and the DNA is resuspended in ultrapure water. In step 5, the isolated single stranded PCR product (F) is digested with a single-strand specific endo- or exo-mlr,le~$e, pre~.~bly mung bean nuclease, Sl nuclease or snake venom phosph~ r~i~st~rase, respectively.

In step 6, the digestion products (G) are then analyzed, for example, via mass spe~;l,on.el-y or electrophoresis.

Among the advantages of the methods of the invention are: i) there is no 15 need to use harsh, denaturing or toxic organic compounds such as phenol or form~mide, ii) biotin-streptavidin complexes can be cleaved under mild conditions, iii) volatile amines, such as ammonia, can be easily and rapidly removed (for example by Iyophilization), iv) the recovered material can be subjected to enzymatic reactions or, e.g., mass ~e~i~.ullletric analysis, without further purification, v) a simultaneous biotin-streptavidin 20 compl_~. cleavage and cation exchange. Accordingly, the process of the invention will considerably extend the applicability of the biotin-streptavidin system by providing a mild and selective procedure to recover the biomolecules after immobilization for further el~y...~lic reactions or analysis.

In another aspect, the invention provides a kit for analyzing a biotinylated biomolecule. In one embodiment, the kit includes a biotin-binding compound immobilized on a solid support, and an amine. The biotin-binding compound and amine are preferably sealed in separate containers. In prerel.ed embodiments, the kit further includes instructions for dissociating a biotin compound:biotin-binding compound complex with the amine.

CA 022~3~82 1998-10-30 F.~npl~ication The following examples illustrate, but do not lirnit, the process of the present invention.

s E~lllples 1-5 illustrate the utility of the subject methods in various applications in diagnostics and DNA sequencing. In general, the illustrated examples involve at least some of the following steps:

1. Pel~,lning (a) an enzymatic reaction employing biotinylated DNA in 0 solution or (b) DNA immobilized on a solid support via a biotin-streptavidin complex, ~ esl~ec~ ely.
2. Separation of excess biotinylated primer, if necessary, using size exclusion ultrafiltration men,bl anes.
3 . Immobilization of the products of step 1 a by complexing the biotinylated DNA to a biotin-binding protein supported on a solid phase.

4. Sepa~ g the complex of step 3 or step Ib from the liquid phase.
Further options include washing to remove reaction contents and impurities, conditioning of immobilized nucleic acids, enzymatic reactions and isolation of the non-biotinylated strand of a DNA duplex for downstream applications.

5. Treating the separated and manipulated complex of step 4 with ammonium hydroxide for isolation of biotinylated molecules.

6 Complete removal of ammonium hydroxide by Iyophilization or precipitation with ethanol.

7. Dowl,~Lreal,l processing of isolated material, e.g. analysis of products by 2s MALDI-TOF MS or further enzymatic reactions.

As described above, the effect of ammonium hydroxide on the irnmobilized nucleic acids is a function of temperature and time of incubation. If the immobilized material is incubated for short times at ambient temperature, the main process is the 30 denaturation of the immobilized double-stranded molecules. However, incubation of CA 022~3~82 1998-10-30 immobilized DNA with ammonium hydroxide at elevated temperatures (preferably 37-80~C) leads to the dissociation of the biotin-streptavidin complex.

Example 1 s M.A~ .1 )I-TOF MS spectrum of a biotinylated oli~odeoxynucleotide cleaved fromstreptavidin Dyn~heads ll~in~p ammonium hydroxide For this example, 100 pmol biotinylated oligodeoxynucleotide (20mer), S'd(bio-AGCTCTATATCGGGAAGCCT)3 ' (SEQ ID NO: 1), were immobilized on 50~11 l0 streptavidin Dynabeads M-280. The beads were prepared according to the instructions of the m~mlf~ctllrer The beads were finally resuspended in 50 ~1 of B/W-buffer (10 mM
Tris-HCI, pH 7.5, lmM EDTA, 2 M NaCI). The oligodeoxynucleotide was added in a volume of 1~,11 and the reaction mixture was incubated for 30 minlltes at ambient temperature. After immobilization, the beads were washed twice with 100 ~11 of s ammonium citrate buffer (0.07 M). The beads were washed once with ultrapure water, 25 111 of a 25% solution of ammonium hydroxide was added, and the beads were carefully resuspended. The suspension was incubated at 60~C for 10 mimltes, and the beads were separated from the solution using a magnetic particle collector (Dynal, Hamburg,Germany). The supernatant was saved and the procedure was repeated once. Both 20 supernatants were collected in a single tube. The solution was Iyophilized for 30 minute and redissolved in 4 ill of ultrapure water. From this solution 0.5 1ll were analyzed with MALDI-TOF mass spectrometry (Figure 4) as described in example 2, step 4.

Figure 4 shows a MALDI-TOF MS spectrum of a biotinylated 20mer 2s oligodeoxynucleotide (SEQ Il~ NO: 1) immobilized on streptavidin Dynabeads and recovered using the method described above. The theoretical mass value of the biotinylated oligodeoxynucleotide is 6522 Da. The mass value obtained is 6529.8 Da, in agreement with the predicted mass. The spectrum demonstrates that a biotinylatedpoligodeoxynucleotide is removed from the beads. Signals marked with an asterisk are 30 due to depurination which occurs in the process of ionization and desorption also if ammonium hydroxide is not applied.

This F.Y~mplc demonstrates that biotinylated DNA can be recovered from a biotin-streptavidin complex using ammonium hydroxide at elevated temperatures. The oligodeoxynucleotide and the ~tt~ched biotin group remain intact and unmodified during this process This can be conrl~ded because no change of molecular weight of the s original molecule was observed by MALDI-TOF mass spectrometric analysis after subjecting an oligodeoxynucleotide to the described procedure. Further exp~.;n.enls demonstrated that the recovered biotinylated molecule can be complexed again to streptavidin, also sug~estine an intact biotin group.

0 Example 2 MALDI-TOF M.~ ~n~lysis of PCR products purified via streptavidin Dyn~heads and subsequent removal from the beads usin~ ammonium hydroxide Step 1 PCR was perforrned with I ~,ll of a first set of PCR primers directed against the gene for the core protein of hep~titi~ B virus. The nested amplification product has a length of 67 bp. 100 pmol of each primer, 2.5 u Pfu(exo-) DNA polymerase (Stratagene, Heidelberg, Germany), a final concentration of 200 llM of each dNTP and 5 ~ll l0x Pfu buffer (200 mM Tris-HCl, pH 8.75, 100 mM Kcl, 100 mM (NH4)2SO4, 20 mM MgSO4, 20 1% Triton X-l00, 1 mg/ml BSA, Stratagene, Heidelberg, Germany) were used in a final volume of 50 ~,IL The reactions were performed in a thermocycler (OmniGene, MWG-Biotech, Ebersberg, Germany) using the following temperature program: 94~C for 1minute, 60~C for 1 minute and 72~C for I minute with 20 cycles. Sequence of oligodeoxynucleotide primers (purchased HPLC-purified from MWG-Biotech, Ebersberg, 2s Gerrnany):
HBV13: 5'-d(TTGCCTGAGTGCAGTATGGT-)3' (SEQ ID NO:2) ~VI 5bio: 5 'd(bio-AGCTCTATATCGGGAAGCCT)3 ' (SEQ ID NO:3) Purification of the PCR products obtained in step 1, above, was done according to the following procedure: Ultrafiltration was performed using Ultrafree-MC

CA 022~3~82 1998-10-30 filtration units (Millipore, Eschborn, Germany) according to the protocol of them~mlf~ctllrer, with centrifugation at 8000 rpm for 20 minutes 25 ~1 (10~1g/,ul) streptavidin Dynabeads M280 (Dynal, Hamburg, Germany) were prepared according tothe instructions of the m~mlfActllrer and resuspended in 25 111 of B/W buffer (10 mM Tris-s HCI, pH 7.5, lmM EDTA, 2 M NaCI). This suspension was added to the PCR samples (still in the filtration unit) and the mixture was incub~ted with gentle ~h~kin~ for 15 mimltes at ambient temperature. The suspension was transferred to a 1.5 ml Eppendorf tube and the supernatant was separated with the aid of a magnetic particle collector, MPC, (Dynal, Hamburg, Germany). The beads were washed twice with 50 1ll of 0.07 M
0 ammonium citrate solution, pH 8.0 (the supernatant was removed each time using the MPC).

Step 3 To remove the PCR product (a double strand of 67 base pairs), the beads were resuspended in 25 ~11 of 25% NH40H Suprapur (Merck, Darmstadt, Germany) andinr,~lb~ted at 60~C for ten min-~tes The supernatant was removed and saved, and the NH40H treatment was repeated once. Both supernatants were dried in a speedvac and resuspended in 4 1ll of ultrapure water (MilliQ UF plus, Millipore, Eschborn, Germany).
For MALDI-TOF MS analysis, 0. 5 ~11 of this preparation was used.
Step 4 Half a microliter (0.5 1ll) of the sample was pipetted Ol1tO the sample holder, then immedi~tely mixed with 0.5 ~11 of matrix solution (0.7 M 3-hydroxypicolinic acid in 50% acetonitrile, 70 mM ammonium citrate). This mixture was dried at ambient 2s te",i)e, ~lure and introduced into the mass spectrometer (Figure 5). All spectra were taken in positive ion mode using a Finnigan MAT Vision 2000 (Finnigan MAT, Bremen, Germany), equipped with a reflectron (5 keV ion source, 20 keV postacceleration) and a 337 nm nitrogen laser. Calibration was done with a mixture of a nucleic acid 40mer and a 1 00mer. Each sample was measured with various laser energies. In the negative (control) samples, the PCR product was not detected at low or high laser energies. In the positive CA 022~3~82 l998-l0-30 sa..lp'es, the PCR product was detected at dirrelenl places ofthe sample spot and also with varying laser energies.

Figure S shows a MALDI-TOF MS spectrum of a PCR product from the hep~titi~ B core antigen coding DNA region, purified with streptavidin Dynabeads and recovered from the beads using prnmoni~m hydroxide, as described above.

The theoretical mass value of the non-biotinylated strand is 20792.4 Da.
The theoretical mass value ofthe biotinylated strand is 20886.9 Da. The average mass of both strands is 20839.7 Da. The mass value ofthe signal obtained is 20812.5 Da. Since double stranded DNA molecules are denatured during the process of ionization anddesorption, the PCR products are detected as single-stranded molecules and the mass value obtained represe"ls the average mass of both single strands.

This Example demonstrates that MALDI-TOF MS analysis of PCR
products is compatible with the method described herein. Compared to the purification procedures currently used, the introduced combination of a streptavidin-coated solid support, a biotinylated analyte molecule and the recovery of the PCR product, using al~llllonium hydroxide, led to improved sample processing and analysis.
Example 3 MALDI-TOF MS an~l~sis of Sanger sequencing products ~urified usin~ streptavidin Dynabeads and subsequent treatment with ammonium hydroxide 2s For the streptavidin-biotin purification, a biotinylated USP (universal sequenring primer), which was supplied HPLC-purified from Pharmacia Biotech (Freiburg, Germany), was used. The primer sequence was designed so that 10 basesdownstream from the primer binding site would be sequenced. The reaction was carried out using the reagents from the sequencing kit for Sequenase Version 2.0 (Amersham, Arlington Heights, Illinois, USA) , .. . .. . --, . --, . . . . . . . , . . ~ ... .

CA 022~3~82 1998-10-30 Step 1 For ~nn~ling primer and template, 40 pmol bioUSP (1 1ll) and 40 pmol of template (1 ~11) were incubated with 4 Ill of Sequenase-Buffer (5X), heated to 6~~C for 2 rnin. and then slowly cooled down to ambient temperature. To the annealing mixture, 1 s Mn-buffer (supplied in the kit by the m~mlf~cturer), 1 111 dithiothreitol (DTT), 2 ~
ultrapure Water (MilliQ, Millipore, Eschborn, Gerrnany) and 2 ~,11 diluted SequPn~e 2.0 (6 U, diluted with pyrophosphatase) were added.

After the addition of the Sequenase, 3 ~11 of the reaction mix were pipetted into each of the four te~ "~ a~ion mixes (A~ C, G and T, each 4 ,11). The mixtures were incubated at 34~C for 20 min~lte~ Each reaction was stopped with 1.5 ~11 500 mM
EDTA.
Step 2 A~er stopping the termination reaction with EDTA, the sequencing products were immobilized on streptavidin beads prepared according to the protocol of the m~nllf~cturer. To each reaction, 20 ~,ll of prewashed beads were added and incubated at ambient temperature for 15 minutes under gentle shaking. After immobilization, the beads were washed twice with B/W-buffer (see above) and once with ultrapure water.
The template was then denatured from the immobilized strand with ultrapure water at 95~C for 2 mimltes After denaturation the beads were washed twice with 0.07 M
amrnonium citrate and once with ultrapure water.

Step 3 The immobilized sequencing products were cleaved from the beads with 20 ~1 of 25% ammonia at 60~C for 10 minlltes; the cleavage reaction was performed twice and the supernatants combined. The samples were then Iyophilized, resuspended in 4 ultrapure water and directly used for MALDI-TOF-MS.

Step 4 The reaction products were analyzed using MALDI-TOF MS (Fig~re 6) according to the procedure described in example 2, step 4.

CA 022~3~82 1998-10-30 Primer 17 mer (molecular weight 5744.4 Da):
5'd(bioGTAAAACGACGGCCAGT)3'( SEQ ID NO:4), T~mrl~te 50 mer (molecular weight 15338 Da):
s S ~ d(TTGCGTACACACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCTC) 3' (SEQ ID NO:5) Both primer and template were synthe~i7.ed (about 0.2 ~lmol) on a Milligen 7S00 using ~-cyanoethylphosphoamidite chemistry (Sinha, N. D., et al. (1984) Nucleic o Acids Res. 12, 4539-4577), and purified via RP-HPLC.

Figure 6 shows the reaction of the Sanger sequenc.ing reaction purified with M-280 streptavidin Dynabeads. The sequçnring reaction was carried out in solution and the sequencing products were captured with Dynabeads. The reaction contents, such as salts, enzymes, dNTPs and dideoxynucleotide triphosphates (ddNTPs), were removed by washing, and the sequ~ncing products were recovered for MA~DI-TOF-MS analysisusing ammonium hydroxide, as described above.

Three termination products were expected in the A-reaction with a length of 22-, 26- and 27 bases, respectively. These products are represented by the signals at 7282.6 Da, 8502.5 Da and 8809.5 Da, respectively. The signals at 5721.3 Da and 15325 Da I epresen~ primer and template, respectively. The signal at 9131.5 Da is due to a single-nucleotide extension of the run-through product.

2s This Example, and Example 4 and 5, infra, demonstrate the utility of the subject methods in DNA sequencing . This Example shows that the method is compatible with the analysis of conventional Sanger sequçncing E~ample 4 ~AT l)I-TOF-M.~ ~n~lysi~ of exonucleolytic digestion~ of PCR produr.t~

Step 1 s The reaction mix contained 200 ~lM dCTP, dTTP and 200 IlM C7-deaza dATP and C7-deaza dGTP, 100 pmol offorward and reverse primer, 100 ng M13mpl8 RF, and 2.5 U of P.,fi. (exo-) DNA polymerase (Stratagene, Heidelberg, Germany) in a buffered solution (20 mM Tris-HCI, pH 8.75, 10 mM Kcl, 10 mM (NH4)2SO4, 2 mM
MgSO4, 0.1% Triton X-100, 0.1 mg/ml BSA, Stratagene, Heidelberg, Germany) of 1000 ~1. The reactions were performed in a therrnocycler (OmniGene, MVVG-Biotech, Ebersberg, Germany) using the following temperature program: Initial denaturing step of 3 min. 94~C, followed by 25 cycles of 94~C for I minute, 48~C for 1 minute and 72~C 1 minute.

The reverse primer was synthesized (about 0.2 ~mol) on a Milligen 7500 and purified with RP-HPLC. The biotinylated forward primer was purchased HPLC
purified from Pharmacia Biotech.

Sequences:
Forward primer: 5'd(bio-GTAAAACGACGGCCAGT)3' (SEQ ID NO:6) Reverse primer: S'd(GAGATCTCCTAGGGGCC)3' (SEQ ID NO:7) Step2 The PCR product was separated from unincorporated primer by 2s ultrafiltration through a 10.000 Da molecular weight cutoffmembrane. IJltrafiltration was done using Ultrafree-MC filtration units (Millipore, Eschborn, Germany) according to the protocol ofthe provider with centrifugation at 8000 rpm for 20 minutes.

25 ~1 (10~g/111) streptavidin Dynabeads M-280 with a nominal size of 2.8 ~lm (Dynal, Hamburg, Germany) were prepared according to the instructions of them~nl~f~cturer and resuspended in 25 ,ul of B/W buffer (10 mM Tris-HCI, pH 7.5, lmM
EDTA, 2 M NaCI). This suspension was added to the PCR samples (still in the filtrat}on CA 022~3~82 1998-10-30 unit) and the mixture was incub~ted with gentle shaking for 15 minutes at ambient temperature. The suspension was transferred to a 1. 5 ml Eppendorf tube and the supelllalanl was separated with the aid of a Magnetic Particle Collector, MPC, (Dynal, Hamburg, Germany). After immobilization the double stranded PCR product was s denatured using 20 ~,11 8 M urea. A~cer removing the urea (co~ the non-biotinylated strand) the beads were washed twice with 50 ~ll of 0.07 M ammonium citrate solution, pH

8.0 (the supclllalalll was removed each time using the MPC). To perform the cleavage reaction and recover the biotinylated single stranded PCR product, the beads were resuspended in 25 1ll of 25% NH40H suprapur (Merck, Darrnstadt, Germany) and incub~ted at 60~C for ten minllte~ The supernatant was removed and saved, the NH40H
tre~tm~nt was repeated once. Both supernatants were dried in a speedvac and resl~p~.n~ed in 2 111 of ultrapure water (MilliQ UF plus, Millipore, Eschborn, Germany).

Step 3 I ~11 ofthe resuspended DNA from step 2 was mixed with 0.2x10-3 U of snake venom phosphodiesterase (Boehringer M~nnheirn, Germany) and incubated for 20 min. at 37~C. The reaction was mixed with 1 1ll matrix solution (0.7 M 3-hydroxypicolinic acid in 50% acetonitrile, 70 mM ammonium citrate) and directly used for MALDI-TOF-MS analysis.
Step 4 The reaction products were analyzed using MALDI-TOF MS (Figure 7) according to the procedure described above.

2s Figure 7 shows a spectrum of an exonucleolytic digest of a 60 mer PCR
product. The biotinylated PCR product was immobilized on streptavidin Dynabeads and denatured with 8 M urea. The biotinylated single strand was recovered from the beads using treatm~nt with ammonium hydroxide. A~er Iyophilization, the single stranded 60mer was digested with snake venom phosphodiesterase. As described in example 4, the spectrum lep-~,s~ s a digestion time of 20 minutes at 37~C.

CA 022~3~82 1998-10-30 Example 5 MAT l )I-TOF MS analysis of an exonucl~ digestion of immobilized oli~onucleotides s steV I
400 pmol of the biotinylated 25mer oligonucleotide were incubated with 2 mg of Dynabeads according to the protocol of the provider in a final volume of 100 Step 2 The immobilized oligonucleotide was digested by addition of 3 ~,ll snake venom phosphodiesterase (6x10-3 U) (Boehringer Mannheim, Germany) at room temperature.

Step 3 Aliquots of 20 ~,ll were taken after digestion for 4, 10, 15, 20 and 25 min~ltes and were subjected to the same purification procedure as described in Example 2, step 2, supra.

Step 4 The reaction products were analyzed using MALDI-TOF MS according to the procedure described above (Figure 8).

For the digestion, a 5'-biotinylated oligonucleotide purchased HPLC
purified from Biometra (Gottingen, Germany) was used.
2s Sequence: 5'd(bio-TACATTCCCAACCGCGTGGCACAAT)'3 (SEQ ID NO:8) Figure 8 shows an exonucleolytic digestion of a biotinylated 25mer immobilized on Dynabeads. After 4 minutes of digestion with snake venom phosphodiesterase the products where purified and removed from the beads, as described 30 above. From this spectrum, the base sequence from base 13 to base 25 can be seen.

CA 022~3~82 l998-l0-30 FY~mrles 4 and 5 demonstrate that the method described herein can be used for isolation of single stranded DNA accç~sit le for subsequent enzymatic degradation. Example 4 shows an application where formation of a biotin-streptavidin con-ple;., followed by l~ .ç ~I with ammonil~rn hydroxide, is used to isolate a single s strand PCR product for the purpose of digestion with a single-strand-specific exon-lcle~e to determine the nucleotide seq~lçnce. This experiment also demonstrates that the recovered biotinylated material remains unmodified and acces.cible for enzymaticreactions. In çY~n~rle 5, the digestion was carried out while the single-stranded PCR
product was still imrnobilized and the products were recovered using the cleavage method o introduced herein As can be seen from the Examples, the subject method provides a process for purification and analysis of biotinylated molecules. The inventive method isco...palil,le with mass spe.,l.onlel,ic analysis, and with the potential of pe~ro~ ing further 5 enzymatic rç~ctio~

The contents of all reference and published patent applications cited throughout this specification are hereby incorporated by reference in their entirety.

20 Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimçnt~tion~ numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.
2s CA 022~3~82 1998-10-30 SEQUENCE LISTING

~1) GENERAL INFORMATION:
s (i) APPLICANT: Jurinke, Christian, et al.
(ii) TITLE OF lNV~nlION: A Method for Dissociating Biotin Complexe~
(iii) NUMBER OF SEQUENCES: 8 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Foley, Hoag ~ Eliot LLP
(B) STREET: One Post Office S~uare (C) CITY: Boston (D) STATE: Ma~sachu~etts (E) COul~.~Y: USA
(F) ZIP: 02109-2170 (v) COMPUTER p~nART.~ FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (Vi) ~UKREh~ APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 13 MAY 1997 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/649,876 (B) FILING DATE: 13 MAY 1996 (viii) AL-ORN~/AGENT INFORMATION:
(A) NAME: Beth E. Arnold (B) REGISTRATION NUMBER: 000000 (C) REFERENCE/DOCKET NUMBER: SQA-022.25 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617)832-1294 (8) TELEFAX: (617)832-7000 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CA 022~3~82 1998-10-30 W O 97/43617 PCTrUS97/08052 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pair6 (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) s~:Q~N~ DESCRIPTION: SEQ ID NO:3:

(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GTAAAACGAC GGCCAGT l7 (2) INFORMATION FOR SEQ ID NO:5:
(i) S~Q~N~ CHARACTERISTICS:
(A) LENGTH: 50 ba~e pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CA 022~3~82 1998-10-30 W O 97/43617 PCTrUS97/08052 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 ~ase pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:B:

Claims (41)

CLAIMS:

1. A method for dissociating a biotin compound:biotin-binding compound complex, the method comprising:
contacting the complex with an effective amount of an amine under conditions such that the complex is dissociated;
thereby forming a biotin compound and a biotin-binding compound.

2. The method of claim 1, wherein the amine is ammonia.

3. The method of claim 1, wherein the amine is a primary amine.

4. The method of claim 1, wherein the complex is contacted with an amine at a temperature of between about 25° and about 100°.

5. The method of claim 1, wherein the complex is contacted with an amine at a pH of between about 7 and about 14.

6. The method of claim 1, wherein the complex is contacted with an amine at a concentration of between about 5% and about 28%.

7. The method of claim 1, wherein the biotin compound is a biotinylated macromolecule.

8. The method of claim 7, wherein the biotinylated macromolecule is selected from the group consisting of a biotinylated nucleic acid sequence, a biotinylated protein, a biotinylated carbohydrate, and a biotinylated lipid.

9. The method of claim 1, wherein the biotin-binding compound is selected from the group consisting of avidin, streptavidin, and derivatives thereof.

10. The method of claim 9, wherein the biotin-binding compound is immobilized on a solid support.

11. The method of claim 10, wherein the solid support is a magnetic bead.

12. The method of claim 1, wherein, after the contacting step, the biotin compound is separated from the biotin-binding compound.

13. The method of claim 12, wherein, after the separation step, the biotin compound is purified.

14. The method of claim 13, wherein the biotin compound is purified by a method selected from the group consisting of lyophilization, precipitation, filtration, and dialysis.

15. The method of claim 1, wherein, prior to the contacting step, the complex is purified.

16. The method of claim 1, wherein the biotin compound is immobilized on a solid support.

17. The method of claim 1 wherein, after dissociation of the complex, at least one of the biotin compound and the biotin-binding compound is analyzed by mass spectrometry.

18. The method of claim 1, wherein, after dissociation of the complex, the biotin-binding compound retains biotin-binding activity.

19. The method of claim 1, wherein, after dissociation of the complex, the biotin moiety of the biotin compound remains substantially intact.

20. The method of claim 1, wherein:
the amine has the formula NR'3 or N+R'4, in which R' is hydrogen, alkyl (including cycloalkyl), alkenyl, alkynyl or aryl, and is independently selected for each occurrence.

21. The method of claim 1, wherein:
the amine is selected according to steric bulk, pH or hydrogen bonding capability to bring about dissociation.

22. A method for analyzing a biotinylated nucleic acid, comprising:
contacting the biotinylated nucleic acid with a biotin-binding compound, thereby forming a biotinylated nucleic acid:biotin-binding compound complex;
contacting said complex with an effective amount of an amine, under conditions such that a complex is dissociated;
thereby releasing a biotinylated nucleic acid and a biotin-binding compound; and analyzing the biotinylated nucleic acid.

23. The method of claim 22, wherein the nucleic acid is DNA.

24. The method of claim 22, wherein the biotin-binding compound is immobilized on a solid support.

25. The method of claim 22, wherein the biotinylated nucleic acid is analyzed by mass spectrometry.

26. The method of claim 22, wherein the amine is ammonia.

27. The method of claim 22, wherein, after the first contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

28. The method of claim 27, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

29. The method of claim 10, wherein, prior to the contacting step, the complex is purified.

30. The method of claim 22, wherein, after the second contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

31. The method of claim 22, wherein, before the first contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

32. The method of claim 30, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

33. The method of claim 31, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

34. The method of claim 24, wherein, after the first contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

35. The method of claim 24, wherein, after the second contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

36. The method of claim 24, wherein, before the first contacting step, the biotinylated nucleic acid is subjected to an enzymatic reaction.

37. The method of claim 34, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

38. The method of claim 35, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

39. The method of claim 36, wherein the enzymatic reaction comprises treatment with an enzyme selected from the group consisting of endonucleases and exonucleases.

40. The method of claim 22, wherein:
the amine has the formula NR'3 or N+R'4, in which R' is hydrogen, alkyl (including cycloalkyl), alkenyl, alkynyl or aryl, and is independently selected for each occurrence.

41. The method of claim 22, wherein:

the amine is selected according to steric bulk, pH or hydrogen bonding capability to bring about dissociation.