CA2216997A1 - Molecular diagnostic of glaucomas associated with chromosomes 1 - Google Patents
Molecular diagnostic of glaucomas associated with chromosomes 1 Download PDFInfo
- Publication number
- CA2216997A1 CA2216997A1 CA 2216997 CA2216997A CA2216997A1 CA 2216997 A1 CA2216997 A1 CA 2216997A1 CA 2216997 CA2216997 CA 2216997 CA 2216997 A CA2216997 A CA 2216997A CA 2216997 A1 CA2216997 A1 CA 2216997A1
- Authority
- CA
- Canada
- Prior art keywords
- oligonucleotide
- mutant allele
- seq
- nucleotide
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention discloses the discovery that in an autosomally inherited disease, a homozygote mutant is found to be phenotypically normal and the uses of such a knowledge thereof. The present invention has designed an easy and efficient means to detect mutations in the GLC1A/TIGR gene.
Description
TITLE OF THE INVENTION
MOLECULAR DIAGNOSTIC OF GLAUCOMAS
The present invention relates to the identification of mutations in the GLC1A gene and the detection of these mutations in individuals. The invention also relates to individuals being genotypically homozygote mutant in an autosomal dominant inherited disease yet 10 being phenotypically normal.
BACKGROUND OF THE INVENTION
Glaucoma encompasses a complex of ocular-disease entities characterized by an optic neuropathy in which degeneration of 15 retinal ganglion cells leads to a characteristic excavation of the head of the optic nerve (Shields et al., 1996, The Glaucomas, _:717-725). Such damage causes progressive narrowing of the visual fields and, when unconl~olled, blindness. Affected people often have ocular hypertension defined as intraocular pressures consistently >21 mm Hg in both eyes.
20 Although ocular hypertension is no longer an obligatory diagnostic criterion for glaucoma, it is still recognized as one of the most important risk factors (Wilson et al., 1996, The Glaucomas, _:753-763). Until now, a diagnosis of glaucoma is made after observation of the characteristic atrophy of the optic nerve, which is associated with typical visual field 25 defects.
In 1992, the World Health Organization estimated that, in the global population, 5.2 million people were blind as a result of glaucoma (Thylefors et al., 1994, World Health Organ. Bull., 72:323-326), making it the third leading cause of blindness worldwide. The most con"non form is adult-onset primary open-angle glaucoma (MIM 137760;
McKusick, 1994, Johns Hopkins University Press, p. 272), which 5 represents -50% of all cases of glaucoma. Among Caucasians, this form of the disorcler affects ~2% of the population >45 years old (Leske, 1983, Am. Epidemiol., 1 18:166-191; Thylefors et al., 1994, supra; Wilson et al., 1996, supra). In African Americans, prevalence of adult-onset open-angle glaucoma is three to four times higher than that observed in White 10 Americans. More than 15 million North Americans may have some form of glaucoma, but at least half of them may not be aware of it.
The glaucomas traditionally have been grouped into three categories: open angle, closed angle (also termed "angle closure"), and congenital. Each subtype has been further arbitrarily subdivided into 15 primar~, when the anterior chamber of the eye appears normal and no cause for glaucoma can be identified, or secondary, when glaucomas are caused by underlying ocular or systemic conditions (Shields et al., 1996, supra). Whereas the division between open and closed angles refers to the configuration of the irido-corneal angle in the anterior chamber of the 20 eye, congenital glaucoma is used to define one of the many types of developmental gl~ucoma that usually occurs within the 1 st year of life.
The majority (60%-70%) of primary glaucomas are of the open-angle type. Primary open-angle glaucomas have been further subdivided into two groups according to age at onset, severity, and mode of inheritance:
25 the more prevalent is middle- to late-age-onset chronic open-angle glaucoma (COAG), by convention diagnosed after age 35 years and characterized by its slow, insidious course (Shields et al., 1996, supra;
Wilson et al., 1996, supra). The less common form, juvenile open-angle glaucoma (JOAG), occurs between 3 years of age and early adulthood and generally manifests highly elevated intraocular pressures with no angle abno,l"alilies (Goldwyn et al., 1970, Arch. Ophtalmol., 84:579-582;
Francois, 1980, Am. J. Ophtalmol., 3:429-449; Jo~mso" et al., 1 996a, The Glaucomas, 1:39-54).
Although the precise molecular defects leading to open-angle glaucomas remain partly unknown, numerous advances in basic and clinical sciences have begun to identify the molecular basis of glaucomas by mapping the gene loci involved in the disease process.
Due to recent mapping successes, the difrerent forms of glaucoma will be further identified by the names of the loci to which they have been localized. According to the Human Genome Organization/Genome Database nomenclature, "GLC' is the general symbol for the glaucoma genes; "1", "2", and "3" are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma; and "A", "B", and "C" refer, respectively, to the first, second, or third gene mapped in each subgroup.
JOAG is a rare but aggressive form of glaucoma that usually segregates in an autosomal dominant fashion with high penetrance (Stokes, 1940, Arch. Ophthalmol., 24:885-909; Crombie et al., 1964, Br. J. Ophtalmol., 48:143-147; Lee et al., 1985, Ann.
Ophtalmol., 17:739-741; Johnson et al., 1993, Ophthalmology, 100:524-529). In a single large American pedigree affected by an autosomal dominant form of JOAG, Sheffield et al. (1993, Nat. Genet., _:47-50) located a gene responsible for this condition, at 1 q21 -q31. This locus, being the first open-angle glaucoma locus to be mapped, was named "GLC1A." The GLC1A disease gene consistently was associated with onset of the JOAG phenotype before the age of 70 years, highly elevated intraocular pressures, and typical excavation of the head of the optic nerve. Gonioscopy showed open angles with no anterior-chamber 5 abnol",alities. The GLC1A has subsequently been reported by Nguyen et al. in US Patent 5,606,043 to encode the trabecular meshwork induced glucocorticoid response (TIGR) gene. The gene sequence was first submitted (13-JAN-1997) by Nguyen et al. to the GeneBank accession # U85257. The TIGR sequence was modified on 19 April 1997 in 10 GeneBank following modifications by Nguyen submitted on 02-APR-1997. The accession number stayed the same # U85257.
Genetic maps of the human genome can be exploited to rapidly locate human monogenic disorders. The final version of the Généthon linkage map, which spans close to 100 % of the human genome, was published in March 1996 (Dib et al., 1996, Nature, 380:152-154). This map consisls of 5,264 short tandem (AC/TG)n repeat polymorphisms with a mean heterozygosity of 70%.
The nomenclature system for the markers is well known in the field. The nomenclature used is decided by the Human Genome 20 Organization (HUGO) nomenclature committee. It is as follows: for anonymous DNA sequences, the convention is to use D which is equivalent to DNA followed by 1-22, X or Y to denote the chromosomal number and location, then S stands for a unique segment and finally a serial number. For example, marker D2S2161 is a DNA marker located 25 on chromosome 2 representing a unique segment. Its serial number is 2161 .
The nomenclature for the glaucoma genes is the following:
"GLC' is the general symbol for the gl~ucoma genes; "1", "2", and "3"
are, respectively, the symbols for the open-angle, angle-closure, and 5 congenital subtypes of glaucoma; and, "A", "B" and "C" refer, respecti~ely, to the first, second, or third gene mapped in each subgroup.
For example, the GLC1A locus was the first open-angle glaucoma locus to be mapped, in this case to chromosome 1 q23-q25 in 1993. It was later identified as the trabecular meshwork inducible glucocorticoid response gene product (TIGR) (Stone et al, 1997, Science, 275: 668-670).
These markers are ~ccessible to all individuals. The central data resource for the human gene mapping effort is the Genome Data Base (GDB). It was established at Johns Hopkins University, School of Medicine. GDB is updated regularly. It collects, organizes, stores and distributes human genome mapping information. GDB is ~ccessible electronically at WWW-URL: http://gdbwww.gdb.org/.
Alternatively, all the markers disclosed herein, except D6S967, are short (CA)n repeat markers that have been developed in the Généthon laboratory near Paris, France. These markers are also accessible electronically at WWW-URL: http://www.genethon.fr/.
Therefore markers are accessible either at GDB or at Généthon.
The first mutations identified in the TIGR gene that have been shown to give rise to glaucoma were first reported by Stone et. al (Science, 1997, 275:668~70). There are three mutations reported. No other mutations relating to the TIGR gene have been reported. The methodology used to identify these mutations was by amplifying overlapping regions by polymerase chain reaction (PCR) performing single-strand conformational polymorphism (SSCP) on the amplification products and sequencing those DNA products that produced aber,a"l band pattern on the SSCP. No quick method for mutational analyses for the TIGR has been proposed.
The prior art as a whole teaches that a homozygote mutant for an autosomal dominant disease should display a higher penelrance than a heterozygote mutant. Heterozygote for an autosomal dominant disease often exhibits variable penetrance.
The present description refers to a number of documents the content of which is herein incorporated by reference.
SUMMARY OF THE INVENTION
The invention concerns the mutational analyses in the GLC1A gene locus encoding the nGR gene (GeneBank accession no. U85257).
The present invention provides means to identify at least two nucleolide changes in the DNA sequence coding for TIGR that result in an amino acid change in the TIGR gene.
The invention further demonstrates that these amino acid changes result in mutations producing a disease state in individuals the disease being glaucoma.
The early detection of individuals at risk for developing glaucoma is an i",po,lanl aspect of this invention. Early detection allows for intervention prior to the genesis of the disease process and disease progression and may obviate the sy"~pto,ns and the onset of the disease.
A method for mutation analyses called amplification rer,actory mutation system (ARMS), that is simple and quick is disclosed herein. The proposed invention relates to the inclusion of primers and probes for the amplification and detection of all mutations in the TIGR
gene. The invention teaches the use of the method of ARMS as related 5 to glaucoma but the invention is not limited to this method for mutation analyses. Other methods known in the field for mutation analyses such as allele specific oligonucleotide (ASO), denaturing gradient gel electrophoresis (DGGE) and artificially created restriction site (ACRS) can also be used.
These mutation detection and analyses can be performed on either genomic DNA or DNA that has been transcribed to cDNA by any method known to a person skilled in the art.
In addition the applicant has demonstrated for the first time a new type of dominance in mammals in which heterozygotes have 15 a much higher penetrance rate for a disease gene mutation than their homozygotic counterparts.
Further it is provided for the first time in an autosomal dominant disease that a homozygote mutant is phenotypically normal.
Even though such an individual may give rise to an affected heterozygote 20 offspring.
The invention provides applications and uses for such a discovery. These include but are not limited to:
a) treatment of heterozygote mutant affected individuals with overexpressed mutant protein to induce protein complementation 25 such that normal protein function can be restored, this application will apply to any autosomal dominant disease exhibiting the same mode of action as described herein.
b) similarly an individual being a heterozygote for an autosomal dominant disorder exhibiting the same mode of action as described herein can be treated by gene therapy, such that a mutant allele is inserted into a vector and delivered to an individual thereby 5 negating the effect of the heterozygote mutation by either allelic or protein comple",entation.
c) with this new knowledge a transgenic animal designed to carry a deleterious autosomal dominant mutation can be used to assess the requirement to produce a phenotypically normal 10 animal, by either allelic complementation or protein complementation.
d) a diagnostic means to identify phenotypically normal genotypically mutant individuals that can transmit the mutant allele to their offsprings.
e) this knowledge can be used for showing dimerisation 15 of TIGR peptides.
In accordance with the present invention there is therefore provided the means to easily identify novel mutations in the TIGR gene, wherein these mutations give rise to glaucoma. These mutations can also be identified by any other means known to a person 20 skilled in the art. As well these means disclosed in this application can easily be part of a kit comprising probes, primers, oligonucleotides and any reagents required in the methodologies for detecting mutations that may cause glaucoma. These mutation analyses are useful for screening individuals at risk for glaucoma. Such individuals may have a family 25 history of glaucoma, and, identifying individuals carrying a mutation in glaucoma gene would permit early treatment that may obviate or minimise the progression of the disease.
The invention and the al-plic~lions thereof will be made obvious with the foregoing disclosure.
DEFINITIONS AND TECHNOLOGICAL BACKGROUND
Nucleotide sequences are presented herein by single strand, in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission.
The present description refers to a number of routinely used recombinant DNA (rDNA) technology terms. Nevertheless, definitions of selected examples of such rDNA terms are provided for clarity and consistency.
As used herein, "isol-~ed nucleic acid molecule", refers to a polymer of nucleotides. Non-limiting examples thereof include DNA
and RNA molecules purified from their natural environment.
The term "recombinant DNA" as known in the art refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.
The term "DNA segment", is used herein, to refer to a DNA molecule comprising a linear stretch or sequence of nucleotides.
This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.
The terminology Uamplification pair" or Uprimer pair"
refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction. Other types of amplification processes include ligase chain reaction, strand ~ispl~cement amplification, or nucleic acid sequence-based amplification, 5 as explained in greater detail below. As commonly known in the art, the oligos are designed to bind to a complei"enta~y sequence under selected conditions.
The nucleic acid (i.e. DNA or RNA) for practising the present invention may be obtained according to well known methods.
Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed.
In general, the oligonucleotide probes or primers are at least 10 nucleotides in length, preferably between 15 and 24 nucleotides, and 15 they may be adapted to be especially suited to a chosen nucleic acid ampliricalion system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd 20 Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
"Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having co",ple,ne"laly base sequences, which under appropriate conditions will 25 form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989 supra) and are cor"",only known in the art. In the case of a hybridization to a nitrocellulose filter, as for example in the well known Southern blotting procedure, a nitrocellulose filter can be incubated overnight at 65~C with a labeled probe in a solution containing 50% formamide, high salt ( 5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1% SDS, and 100 ,ug/ml denatured carried DNA ( i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1% SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42~C
(moderate stringency) or 65~C (high stringency). The selected temperature is based on the melting ter",~eralure (Tm) of the DNA hybrid.
~ Of course, RNA-DNA hybrids can also be formed and detected. In such cases, the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. High stringency conditions will be preferably used (Sambrook et al.,1989, supra).
Probes of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14:5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less prepared, CA 022l6997 l997-09-30 labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include 3H, 14C, 32p, and 35S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectab'E markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods.
Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32p ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. co/i in the presence of radioactive dNTP (i.e.
uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
As used herein, "oligonucleotides" or"oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides).
The size of the oligo will be dictated by the particular situation and ultimately by the particular use thereof, and adapted accordingly by the person of ordinary skill. An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.
As used herein, a Uprimer" defines an oligonucleotide 5 which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA
synthesis under suitable conditions.
Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, (Am. Biotechnol. Lab. 8:14-25). Numerous amplification techniques have been described and can be readily adapted to suit the particular needs of a person of ordinary skill.
Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Q,~ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al.,1988, BioTechnoloyy _:1197-1202; Malek et al., 1994, Melhods Mol. Biol.,28:253-260; and Sar"brook et al.,1989, supra).
Preferably, amplification will be carried out using PCR.
Polymerase chain reaction (PCR) is carried out in accordancewithknowntechniques. See, e.g., U.S. Pat. Nos. 4,683,195;
4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S.
Patent are incorporated herein by reference). In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is compler"e"lary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The exte"sion product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analysed to assess whether the sequence or sequences to be detected are present.
Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known te~ln.~ ~es, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al., Eds, Acad. Press,1990).
Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991, Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand d;spl~cement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA
89:392-396; and ibid.,1992, NucleicAcids Res. 20:1691-1696).
As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A "structural gene" defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skilll that the nucleic acid sequences of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.
The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can 5 serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.
The term "expression" defines the process by which a structural gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or 1 0 more.
The terminology "e3~ression vector" defines a vector or vehicle, as described above, but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserled sequence) is usually placed under the control of control element 15 sequences such as promoter sequences. The placing of a cloned gene under such control sequences is often referred to as being "operably linked" to control elements or sequences.
Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a 20 prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain lrar,scri,c,lional elements such as enl ,ancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.
As used herein, the designation "functional derivative"
25 denotes, in the conlext of a functional derivative of a sequence, whether nucleic acid or amino acid sequence, a molecule that retains a biological activity (either functional or structural) that is subslanlially similar to that of the original sequence. This functional derivative or equivalent may be a natural derivative or may be prepared synthetically. Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity 5 of the protein is cGnserved. The same applies to derivatives of nuclei acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained. When relating to a protein sequence, the substituting amino acid has chemico-physical properties which are 10 similar to that of the substituted amino acid. The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term Ufunctional derivatives" is intended to include "fragmentsn, "segments", "variants", "analogs" or"chemical derivatives" of the subject matter of the present invention.
Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or nucleic acid of the present invention.
The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA
20 technology. All these methods are well known in the art.
As used herein, "chemical derivatives" is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physico-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease25 of toxicity). Such moieties are exemplified in Remington's Pharmaceutical Sciences (1980). Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.
The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.
As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter 5 cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotide. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position.
Sponlaneous mutations and experi"len~ally induced mutations exist. The result of a mutations of nucleic acid molecule is a mutant nucleic acid 10 molecule. A mutant polypeptide can be encoded from this mutant nucleic acid molecule.
As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein" has been purified to a level not found in nature. A
15 "substantially pure" molecule is a molecule that is lacking in all other cellular components.
The term "autosome" defines any chromosome other that the sex chromosomes, X and Y.
The term "dominant" refers to an allele that determines 20 the phenotype displayed in a heterozygote with another (recessive) allele.
The terminology "transgenic animal" defines an animal that has had its germ line genetically modified to give rise to a progeny animal that is different from the parental type and carrying the 25 modification in its germ line.
"Single Strand Conformational Polymorphism (SSCP)"
refers to a Ille~hod for detecting the presence of a base pair change in an amplified DNA fragment. The method involves denaturing the double stranded amplified DNA and comparing the band pdller" in a known non-mutant rray",enl to that of an unknown fragment. A shift in the band pattern is indicative of a base pair change.
The designation ~gene therapy" defines an attempt to treat disease by genetic modification of the cells of a patient.
UAllele Specific Oligonucleotide (ASO)" are designed to detect known and identified base pair change by designing oligonucleotides that are specific to the DNA fragment with and without the base change. These oligonucleotides are used as probes in hybridisation protocols under stringent conditions. Differences in the hybridization patterns is indicative of the presence or absence of the base change.
"Artificially Created Restriction Site (ACRS)" refers to a method for detection a known base change in a DNA sequence. It involves the designing of a primer that may either create or obviate a restriction site in the vicinity of known base change, such that the resl, i~;tion endonuclease used can have a different digestion pattern for the changed and unchanged base.
BRIEF DESCRIPTION OF THE DRAWINGS
Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a prefel,ed embodiment thereof, and in which:
Figure 1 shows the sequence that encodes the wild-type GLC1A/T1GR cDNA sequence.
Figure 2 shows the characteri alion of a carrier homozygous for the Lys423Glu TIGR mutation. a, Structure of the TIGR
encoded protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The Lys423Glu mutation 5 is depicted by an open circle in the olfactomedin homology domain represented by a striped boxe within the C-terminal half of the protein.
Amino acids comparison between human TIGR protein (amino acids 415437), human neuronal olfactomedin, rat and bullfrog neuronal olraclon,edin-related proteins (GeneBank accession U79299, U03417, L13595, respectively) and, C. elegans F11c3.2 protein (GeneBank accession Z81499) is represented. Identical amino acids are shaded in black, conserved amino acids are further boxed by white squares. The codon numbers correspond to those of the TIGR protein, b, Identification of an homozygous carrier of the Lys423Glu TIGR mutation. Direct 15 sequencing of genomic DNA revealed that persons Vl-3 and Vl-9 were, respectively, heterozygotic and homozygotic carriers of the Lys423Glu TIGR mutation. The arrows indicate the A to G transition. Person Vl-2 carried two wild-type TIGR alleles.
Figure 3 shows the amplification refractory mutation 20 system (ARMS) as a method to type specific alleles at a polymorphic locus. In the present invention, this method, ARMS, was used for detecting a specific pathogenic mutation. The allele-specific oligonucleotide pri",ers were designed to discriminate between two target DNA sequences (wild-type (normal) versus pathogenic) that differed by 25 a single nucleotide in the region of interest (either one of the two mutations). Designed primers that differed at the extreme 3' terminus were synthetised. This was done because the DNA synthesis step in the PCR reaction is crucially dependent on correct base pairing at the 3' end.
The primers that were designed are differing in their 3' ends and can ll ,er~rore specifically amplify the DNA fragment of interest, either normal or mutated. This figure is a pictorial representation of ARMS for the 5 adenine to guanine transition at nucleotide 1267. The amplification strategy is demonstrated for the wild-type or non-mutant allele and the mutant allele.
Figure 4 shows the phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu in family 10 GV-510. All living individuals were investigated for glaucoma, genotyped with microsatcllitc markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM
markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele 15 associated with the GLC1A disease haplotype are represented on top.
The position of the TIGR gene is indicated relative to genetic markers.
Sex-averaged reco"l~.nalio,l distances, depicted between marker loci in ce"lil\1organs, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and 20 deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their 25 respective symbols. A solid black box indicates the common GLC1A
~ise~se haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person Vl1-5 represents a microsatellite mutation at locus D1 S2790. Person Vl1-5 also inherited a patemal recombination between loci D1 S2815 and D1 S2790.
Results of the ARMS tests are depicted below each subject's genotype;
5W, ARMS test performed using the wild-type primers; M, ARMS test pe, rur" ,ed using the Lys423Glu mutant pri" ,er~. The internal control PCR
product is shown. Persons Vl-2, Vl-5, Vl~, Vl-10 and Vl-12 carried the wild-type allele on both chromosomes 1. Persons Vl-1, Vl-7, Vl-9 and Vl-11 are wild-type negative and mutant positive, therefore, homozygous 10for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, thererore, heterozygotes for the mutation.
Figure 5 shows the characterization of carriers for the HlS366Gln and Gln368Stop TIGR mutations. a, Structure of the TIGR
encoded protein. The leucine zipper domain (amino acids 117-166) is 15shown within the N-terminal half of the protein. The His366Gln mutation is depicted by a black circle in the olfactomedin homology domain represented by a striped boxe within the C-terminal half of the protein.
The Gln368Stop mutation is depicted by a stop codon in the olfactomedin homology domain. The codon numbers correspond to those of the TIGR
20protein. b, Identification of carriers for the His366Gln and Gln368Stop TIGR mutations. Direct sequencing of genomic DNA revealed that persons CT 003 and LA402 were, respectively, heterozygotic carriers of the Gln368Stop and His366Gln TIGR mutations. The arrows indicate the C to T transition or C to G tranversion.
25Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive desc; iplion of prefe~ l~d embodiments with reference to the accor"panying drawing which is exe,npla~ and should not be inter"reted as limiting the scope of the present invention.
DESCRIPTION OF THE PREFERRED EMBODIMENT
At its broadesl, the invention con ,~rises novel mutations in the TIGR gene, a quick method for an easy detection of identified mutations and the teachings for the first time of mutant homozygote being phenotypically normal in an autosomally dominant inherited disease.
The present invention is illustrated in further detail by the following non-limiting examples.
Pedi~rees and o~hthalmolo~ic assessments 1.1 Pedigree reconstitution The pedigree genealogy was reconstituted using the registers compiled from the Catholic parish records, which systematically list births, marriages, and deaths of 98% of the Quebec population. Validation of the family tree and new data on recent births were obtained through interviews with key family members. The Archives Nationales du Quebec, the Quebec Civil register, and the Institut de recherche sur l'étude des populations (IREP) data base (Bouchard et al., 1991, Histoire d'un génome. Population et génétique dans l'est du Quebec, Presses de I'Université Laval, Sillery, Quebec, pp 607) were also consulted.
1.2 OPhthalmoloqic investiqations All subjects, affected or not, gave inror"~ed consent before entering the study. Clinical ~ssessments comprised complete ophthalmologic evaluation, including best co~ c~ed visual acuity; optic disk examination;
5 slit-lamp biomicroscopy; applanation tonometry; gonioscopy; and visual-field evaluation. Three criteria were required for primary open-angle glaucoma (POAG) diagnosis: a) intraocular pressures above 22 mm Hg in both eyes, b) characteristic optic disk damage and/or visual field impairment, and c) grade lll or IV (open-angle) gonioscopy. In the 10 absence of optic disk damage or visual-field alteration, subjects with intraocular pressures above 22 mm Hg in both eyes and grade lll or IV
gonioscopy were diagnosed with ocular hypertension (OHT). Members of the families were considered normal when they presented normal optic disks and showed highest intraocular pressures ever recorded at 22 mm 15 Hg or less. Persons with other forms of glaucomas, including grade 0 (closed angle); grade I or ll (narrow-angle); congenital; and secondary glaucomas, or with other nonglaucomatous ocular disorders were considered unaffected. Blindness in deceased ancestors was confirmed by at least two independent sources.
MOLECULAR DIAGNOSTIC OF GLAUCOMAS
The present invention relates to the identification of mutations in the GLC1A gene and the detection of these mutations in individuals. The invention also relates to individuals being genotypically homozygote mutant in an autosomal dominant inherited disease yet 10 being phenotypically normal.
BACKGROUND OF THE INVENTION
Glaucoma encompasses a complex of ocular-disease entities characterized by an optic neuropathy in which degeneration of 15 retinal ganglion cells leads to a characteristic excavation of the head of the optic nerve (Shields et al., 1996, The Glaucomas, _:717-725). Such damage causes progressive narrowing of the visual fields and, when unconl~olled, blindness. Affected people often have ocular hypertension defined as intraocular pressures consistently >21 mm Hg in both eyes.
20 Although ocular hypertension is no longer an obligatory diagnostic criterion for glaucoma, it is still recognized as one of the most important risk factors (Wilson et al., 1996, The Glaucomas, _:753-763). Until now, a diagnosis of glaucoma is made after observation of the characteristic atrophy of the optic nerve, which is associated with typical visual field 25 defects.
In 1992, the World Health Organization estimated that, in the global population, 5.2 million people were blind as a result of glaucoma (Thylefors et al., 1994, World Health Organ. Bull., 72:323-326), making it the third leading cause of blindness worldwide. The most con"non form is adult-onset primary open-angle glaucoma (MIM 137760;
McKusick, 1994, Johns Hopkins University Press, p. 272), which 5 represents -50% of all cases of glaucoma. Among Caucasians, this form of the disorcler affects ~2% of the population >45 years old (Leske, 1983, Am. Epidemiol., 1 18:166-191; Thylefors et al., 1994, supra; Wilson et al., 1996, supra). In African Americans, prevalence of adult-onset open-angle glaucoma is three to four times higher than that observed in White 10 Americans. More than 15 million North Americans may have some form of glaucoma, but at least half of them may not be aware of it.
The glaucomas traditionally have been grouped into three categories: open angle, closed angle (also termed "angle closure"), and congenital. Each subtype has been further arbitrarily subdivided into 15 primar~, when the anterior chamber of the eye appears normal and no cause for glaucoma can be identified, or secondary, when glaucomas are caused by underlying ocular or systemic conditions (Shields et al., 1996, supra). Whereas the division between open and closed angles refers to the configuration of the irido-corneal angle in the anterior chamber of the 20 eye, congenital glaucoma is used to define one of the many types of developmental gl~ucoma that usually occurs within the 1 st year of life.
The majority (60%-70%) of primary glaucomas are of the open-angle type. Primary open-angle glaucomas have been further subdivided into two groups according to age at onset, severity, and mode of inheritance:
25 the more prevalent is middle- to late-age-onset chronic open-angle glaucoma (COAG), by convention diagnosed after age 35 years and characterized by its slow, insidious course (Shields et al., 1996, supra;
Wilson et al., 1996, supra). The less common form, juvenile open-angle glaucoma (JOAG), occurs between 3 years of age and early adulthood and generally manifests highly elevated intraocular pressures with no angle abno,l"alilies (Goldwyn et al., 1970, Arch. Ophtalmol., 84:579-582;
Francois, 1980, Am. J. Ophtalmol., 3:429-449; Jo~mso" et al., 1 996a, The Glaucomas, 1:39-54).
Although the precise molecular defects leading to open-angle glaucomas remain partly unknown, numerous advances in basic and clinical sciences have begun to identify the molecular basis of glaucomas by mapping the gene loci involved in the disease process.
Due to recent mapping successes, the difrerent forms of glaucoma will be further identified by the names of the loci to which they have been localized. According to the Human Genome Organization/Genome Database nomenclature, "GLC' is the general symbol for the glaucoma genes; "1", "2", and "3" are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma; and "A", "B", and "C" refer, respectively, to the first, second, or third gene mapped in each subgroup.
JOAG is a rare but aggressive form of glaucoma that usually segregates in an autosomal dominant fashion with high penetrance (Stokes, 1940, Arch. Ophthalmol., 24:885-909; Crombie et al., 1964, Br. J. Ophtalmol., 48:143-147; Lee et al., 1985, Ann.
Ophtalmol., 17:739-741; Johnson et al., 1993, Ophthalmology, 100:524-529). In a single large American pedigree affected by an autosomal dominant form of JOAG, Sheffield et al. (1993, Nat. Genet., _:47-50) located a gene responsible for this condition, at 1 q21 -q31. This locus, being the first open-angle glaucoma locus to be mapped, was named "GLC1A." The GLC1A disease gene consistently was associated with onset of the JOAG phenotype before the age of 70 years, highly elevated intraocular pressures, and typical excavation of the head of the optic nerve. Gonioscopy showed open angles with no anterior-chamber 5 abnol",alities. The GLC1A has subsequently been reported by Nguyen et al. in US Patent 5,606,043 to encode the trabecular meshwork induced glucocorticoid response (TIGR) gene. The gene sequence was first submitted (13-JAN-1997) by Nguyen et al. to the GeneBank accession # U85257. The TIGR sequence was modified on 19 April 1997 in 10 GeneBank following modifications by Nguyen submitted on 02-APR-1997. The accession number stayed the same # U85257.
Genetic maps of the human genome can be exploited to rapidly locate human monogenic disorders. The final version of the Généthon linkage map, which spans close to 100 % of the human genome, was published in March 1996 (Dib et al., 1996, Nature, 380:152-154). This map consisls of 5,264 short tandem (AC/TG)n repeat polymorphisms with a mean heterozygosity of 70%.
The nomenclature system for the markers is well known in the field. The nomenclature used is decided by the Human Genome 20 Organization (HUGO) nomenclature committee. It is as follows: for anonymous DNA sequences, the convention is to use D which is equivalent to DNA followed by 1-22, X or Y to denote the chromosomal number and location, then S stands for a unique segment and finally a serial number. For example, marker D2S2161 is a DNA marker located 25 on chromosome 2 representing a unique segment. Its serial number is 2161 .
The nomenclature for the glaucoma genes is the following:
"GLC' is the general symbol for the gl~ucoma genes; "1", "2", and "3"
are, respectively, the symbols for the open-angle, angle-closure, and 5 congenital subtypes of glaucoma; and, "A", "B" and "C" refer, respecti~ely, to the first, second, or third gene mapped in each subgroup.
For example, the GLC1A locus was the first open-angle glaucoma locus to be mapped, in this case to chromosome 1 q23-q25 in 1993. It was later identified as the trabecular meshwork inducible glucocorticoid response gene product (TIGR) (Stone et al, 1997, Science, 275: 668-670).
These markers are ~ccessible to all individuals. The central data resource for the human gene mapping effort is the Genome Data Base (GDB). It was established at Johns Hopkins University, School of Medicine. GDB is updated regularly. It collects, organizes, stores and distributes human genome mapping information. GDB is ~ccessible electronically at WWW-URL: http://gdbwww.gdb.org/.
Alternatively, all the markers disclosed herein, except D6S967, are short (CA)n repeat markers that have been developed in the Généthon laboratory near Paris, France. These markers are also accessible electronically at WWW-URL: http://www.genethon.fr/.
Therefore markers are accessible either at GDB or at Généthon.
The first mutations identified in the TIGR gene that have been shown to give rise to glaucoma were first reported by Stone et. al (Science, 1997, 275:668~70). There are three mutations reported. No other mutations relating to the TIGR gene have been reported. The methodology used to identify these mutations was by amplifying overlapping regions by polymerase chain reaction (PCR) performing single-strand conformational polymorphism (SSCP) on the amplification products and sequencing those DNA products that produced aber,a"l band pattern on the SSCP. No quick method for mutational analyses for the TIGR has been proposed.
The prior art as a whole teaches that a homozygote mutant for an autosomal dominant disease should display a higher penelrance than a heterozygote mutant. Heterozygote for an autosomal dominant disease often exhibits variable penetrance.
The present description refers to a number of documents the content of which is herein incorporated by reference.
SUMMARY OF THE INVENTION
The invention concerns the mutational analyses in the GLC1A gene locus encoding the nGR gene (GeneBank accession no. U85257).
The present invention provides means to identify at least two nucleolide changes in the DNA sequence coding for TIGR that result in an amino acid change in the TIGR gene.
The invention further demonstrates that these amino acid changes result in mutations producing a disease state in individuals the disease being glaucoma.
The early detection of individuals at risk for developing glaucoma is an i",po,lanl aspect of this invention. Early detection allows for intervention prior to the genesis of the disease process and disease progression and may obviate the sy"~pto,ns and the onset of the disease.
A method for mutation analyses called amplification rer,actory mutation system (ARMS), that is simple and quick is disclosed herein. The proposed invention relates to the inclusion of primers and probes for the amplification and detection of all mutations in the TIGR
gene. The invention teaches the use of the method of ARMS as related 5 to glaucoma but the invention is not limited to this method for mutation analyses. Other methods known in the field for mutation analyses such as allele specific oligonucleotide (ASO), denaturing gradient gel electrophoresis (DGGE) and artificially created restriction site (ACRS) can also be used.
These mutation detection and analyses can be performed on either genomic DNA or DNA that has been transcribed to cDNA by any method known to a person skilled in the art.
In addition the applicant has demonstrated for the first time a new type of dominance in mammals in which heterozygotes have 15 a much higher penetrance rate for a disease gene mutation than their homozygotic counterparts.
Further it is provided for the first time in an autosomal dominant disease that a homozygote mutant is phenotypically normal.
Even though such an individual may give rise to an affected heterozygote 20 offspring.
The invention provides applications and uses for such a discovery. These include but are not limited to:
a) treatment of heterozygote mutant affected individuals with overexpressed mutant protein to induce protein complementation 25 such that normal protein function can be restored, this application will apply to any autosomal dominant disease exhibiting the same mode of action as described herein.
b) similarly an individual being a heterozygote for an autosomal dominant disorder exhibiting the same mode of action as described herein can be treated by gene therapy, such that a mutant allele is inserted into a vector and delivered to an individual thereby 5 negating the effect of the heterozygote mutation by either allelic or protein comple",entation.
c) with this new knowledge a transgenic animal designed to carry a deleterious autosomal dominant mutation can be used to assess the requirement to produce a phenotypically normal 10 animal, by either allelic complementation or protein complementation.
d) a diagnostic means to identify phenotypically normal genotypically mutant individuals that can transmit the mutant allele to their offsprings.
e) this knowledge can be used for showing dimerisation 15 of TIGR peptides.
In accordance with the present invention there is therefore provided the means to easily identify novel mutations in the TIGR gene, wherein these mutations give rise to glaucoma. These mutations can also be identified by any other means known to a person 20 skilled in the art. As well these means disclosed in this application can easily be part of a kit comprising probes, primers, oligonucleotides and any reagents required in the methodologies for detecting mutations that may cause glaucoma. These mutation analyses are useful for screening individuals at risk for glaucoma. Such individuals may have a family 25 history of glaucoma, and, identifying individuals carrying a mutation in glaucoma gene would permit early treatment that may obviate or minimise the progression of the disease.
The invention and the al-plic~lions thereof will be made obvious with the foregoing disclosure.
DEFINITIONS AND TECHNOLOGICAL BACKGROUND
Nucleotide sequences are presented herein by single strand, in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission.
The present description refers to a number of routinely used recombinant DNA (rDNA) technology terms. Nevertheless, definitions of selected examples of such rDNA terms are provided for clarity and consistency.
As used herein, "isol-~ed nucleic acid molecule", refers to a polymer of nucleotides. Non-limiting examples thereof include DNA
and RNA molecules purified from their natural environment.
The term "recombinant DNA" as known in the art refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.
The term "DNA segment", is used herein, to refer to a DNA molecule comprising a linear stretch or sequence of nucleotides.
This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.
The terminology Uamplification pair" or Uprimer pair"
refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction. Other types of amplification processes include ligase chain reaction, strand ~ispl~cement amplification, or nucleic acid sequence-based amplification, 5 as explained in greater detail below. As commonly known in the art, the oligos are designed to bind to a complei"enta~y sequence under selected conditions.
The nucleic acid (i.e. DNA or RNA) for practising the present invention may be obtained according to well known methods.
Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed.
In general, the oligonucleotide probes or primers are at least 10 nucleotides in length, preferably between 15 and 24 nucleotides, and 15 they may be adapted to be especially suited to a chosen nucleic acid ampliricalion system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd 20 Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
"Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having co",ple,ne"laly base sequences, which under appropriate conditions will 25 form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989 supra) and are cor"",only known in the art. In the case of a hybridization to a nitrocellulose filter, as for example in the well known Southern blotting procedure, a nitrocellulose filter can be incubated overnight at 65~C with a labeled probe in a solution containing 50% formamide, high salt ( 5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1% SDS, and 100 ,ug/ml denatured carried DNA ( i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1% SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42~C
(moderate stringency) or 65~C (high stringency). The selected temperature is based on the melting ter",~eralure (Tm) of the DNA hybrid.
~ Of course, RNA-DNA hybrids can also be formed and detected. In such cases, the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. High stringency conditions will be preferably used (Sambrook et al.,1989, supra).
Probes of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14:5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less prepared, CA 022l6997 l997-09-30 labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include 3H, 14C, 32p, and 35S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectab'E markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods.
Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32p ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. co/i in the presence of radioactive dNTP (i.e.
uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
As used herein, "oligonucleotides" or"oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides).
The size of the oligo will be dictated by the particular situation and ultimately by the particular use thereof, and adapted accordingly by the person of ordinary skill. An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.
As used herein, a Uprimer" defines an oligonucleotide 5 which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA
synthesis under suitable conditions.
Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, (Am. Biotechnol. Lab. 8:14-25). Numerous amplification techniques have been described and can be readily adapted to suit the particular needs of a person of ordinary skill.
Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Q,~ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al.,1988, BioTechnoloyy _:1197-1202; Malek et al., 1994, Melhods Mol. Biol.,28:253-260; and Sar"brook et al.,1989, supra).
Preferably, amplification will be carried out using PCR.
Polymerase chain reaction (PCR) is carried out in accordancewithknowntechniques. See, e.g., U.S. Pat. Nos. 4,683,195;
4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S.
Patent are incorporated herein by reference). In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is compler"e"lary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The exte"sion product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analysed to assess whether the sequence or sequences to be detected are present.
Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known te~ln.~ ~es, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al., Eds, Acad. Press,1990).
Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991, Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand d;spl~cement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA
89:392-396; and ibid.,1992, NucleicAcids Res. 20:1691-1696).
As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A "structural gene" defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skilll that the nucleic acid sequences of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.
The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can 5 serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.
The term "expression" defines the process by which a structural gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or 1 0 more.
The terminology "e3~ression vector" defines a vector or vehicle, as described above, but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserled sequence) is usually placed under the control of control element 15 sequences such as promoter sequences. The placing of a cloned gene under such control sequences is often referred to as being "operably linked" to control elements or sequences.
Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a 20 prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain lrar,scri,c,lional elements such as enl ,ancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.
As used herein, the designation "functional derivative"
25 denotes, in the conlext of a functional derivative of a sequence, whether nucleic acid or amino acid sequence, a molecule that retains a biological activity (either functional or structural) that is subslanlially similar to that of the original sequence. This functional derivative or equivalent may be a natural derivative or may be prepared synthetically. Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity 5 of the protein is cGnserved. The same applies to derivatives of nuclei acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained. When relating to a protein sequence, the substituting amino acid has chemico-physical properties which are 10 similar to that of the substituted amino acid. The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term Ufunctional derivatives" is intended to include "fragmentsn, "segments", "variants", "analogs" or"chemical derivatives" of the subject matter of the present invention.
Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or nucleic acid of the present invention.
The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA
20 technology. All these methods are well known in the art.
As used herein, "chemical derivatives" is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physico-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease25 of toxicity). Such moieties are exemplified in Remington's Pharmaceutical Sciences (1980). Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.
The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.
As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter 5 cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotide. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position.
Sponlaneous mutations and experi"len~ally induced mutations exist. The result of a mutations of nucleic acid molecule is a mutant nucleic acid 10 molecule. A mutant polypeptide can be encoded from this mutant nucleic acid molecule.
As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein" has been purified to a level not found in nature. A
15 "substantially pure" molecule is a molecule that is lacking in all other cellular components.
The term "autosome" defines any chromosome other that the sex chromosomes, X and Y.
The term "dominant" refers to an allele that determines 20 the phenotype displayed in a heterozygote with another (recessive) allele.
The terminology "transgenic animal" defines an animal that has had its germ line genetically modified to give rise to a progeny animal that is different from the parental type and carrying the 25 modification in its germ line.
"Single Strand Conformational Polymorphism (SSCP)"
refers to a Ille~hod for detecting the presence of a base pair change in an amplified DNA fragment. The method involves denaturing the double stranded amplified DNA and comparing the band pdller" in a known non-mutant rray",enl to that of an unknown fragment. A shift in the band pattern is indicative of a base pair change.
The designation ~gene therapy" defines an attempt to treat disease by genetic modification of the cells of a patient.
UAllele Specific Oligonucleotide (ASO)" are designed to detect known and identified base pair change by designing oligonucleotides that are specific to the DNA fragment with and without the base change. These oligonucleotides are used as probes in hybridisation protocols under stringent conditions. Differences in the hybridization patterns is indicative of the presence or absence of the base change.
"Artificially Created Restriction Site (ACRS)" refers to a method for detection a known base change in a DNA sequence. It involves the designing of a primer that may either create or obviate a restriction site in the vicinity of known base change, such that the resl, i~;tion endonuclease used can have a different digestion pattern for the changed and unchanged base.
BRIEF DESCRIPTION OF THE DRAWINGS
Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a prefel,ed embodiment thereof, and in which:
Figure 1 shows the sequence that encodes the wild-type GLC1A/T1GR cDNA sequence.
Figure 2 shows the characteri alion of a carrier homozygous for the Lys423Glu TIGR mutation. a, Structure of the TIGR
encoded protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The Lys423Glu mutation 5 is depicted by an open circle in the olfactomedin homology domain represented by a striped boxe within the C-terminal half of the protein.
Amino acids comparison between human TIGR protein (amino acids 415437), human neuronal olfactomedin, rat and bullfrog neuronal olraclon,edin-related proteins (GeneBank accession U79299, U03417, L13595, respectively) and, C. elegans F11c3.2 protein (GeneBank accession Z81499) is represented. Identical amino acids are shaded in black, conserved amino acids are further boxed by white squares. The codon numbers correspond to those of the TIGR protein, b, Identification of an homozygous carrier of the Lys423Glu TIGR mutation. Direct 15 sequencing of genomic DNA revealed that persons Vl-3 and Vl-9 were, respectively, heterozygotic and homozygotic carriers of the Lys423Glu TIGR mutation. The arrows indicate the A to G transition. Person Vl-2 carried two wild-type TIGR alleles.
Figure 3 shows the amplification refractory mutation 20 system (ARMS) as a method to type specific alleles at a polymorphic locus. In the present invention, this method, ARMS, was used for detecting a specific pathogenic mutation. The allele-specific oligonucleotide pri",ers were designed to discriminate between two target DNA sequences (wild-type (normal) versus pathogenic) that differed by 25 a single nucleotide in the region of interest (either one of the two mutations). Designed primers that differed at the extreme 3' terminus were synthetised. This was done because the DNA synthesis step in the PCR reaction is crucially dependent on correct base pairing at the 3' end.
The primers that were designed are differing in their 3' ends and can ll ,er~rore specifically amplify the DNA fragment of interest, either normal or mutated. This figure is a pictorial representation of ARMS for the 5 adenine to guanine transition at nucleotide 1267. The amplification strategy is demonstrated for the wild-type or non-mutant allele and the mutant allele.
Figure 4 shows the phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu in family 10 GV-510. All living individuals were investigated for glaucoma, genotyped with microsatcllitc markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM
markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele 15 associated with the GLC1A disease haplotype are represented on top.
The position of the TIGR gene is indicated relative to genetic markers.
Sex-averaged reco"l~.nalio,l distances, depicted between marker loci in ce"lil\1organs, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and 20 deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their 25 respective symbols. A solid black box indicates the common GLC1A
~ise~se haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person Vl1-5 represents a microsatellite mutation at locus D1 S2790. Person Vl1-5 also inherited a patemal recombination between loci D1 S2815 and D1 S2790.
Results of the ARMS tests are depicted below each subject's genotype;
5W, ARMS test performed using the wild-type primers; M, ARMS test pe, rur" ,ed using the Lys423Glu mutant pri" ,er~. The internal control PCR
product is shown. Persons Vl-2, Vl-5, Vl~, Vl-10 and Vl-12 carried the wild-type allele on both chromosomes 1. Persons Vl-1, Vl-7, Vl-9 and Vl-11 are wild-type negative and mutant positive, therefore, homozygous 10for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, thererore, heterozygotes for the mutation.
Figure 5 shows the characterization of carriers for the HlS366Gln and Gln368Stop TIGR mutations. a, Structure of the TIGR
encoded protein. The leucine zipper domain (amino acids 117-166) is 15shown within the N-terminal half of the protein. The His366Gln mutation is depicted by a black circle in the olfactomedin homology domain represented by a striped boxe within the C-terminal half of the protein.
The Gln368Stop mutation is depicted by a stop codon in the olfactomedin homology domain. The codon numbers correspond to those of the TIGR
20protein. b, Identification of carriers for the His366Gln and Gln368Stop TIGR mutations. Direct sequencing of genomic DNA revealed that persons CT 003 and LA402 were, respectively, heterozygotic carriers of the Gln368Stop and His366Gln TIGR mutations. The arrows indicate the C to T transition or C to G tranversion.
25Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive desc; iplion of prefe~ l~d embodiments with reference to the accor"panying drawing which is exe,npla~ and should not be inter"reted as limiting the scope of the present invention.
DESCRIPTION OF THE PREFERRED EMBODIMENT
At its broadesl, the invention con ,~rises novel mutations in the TIGR gene, a quick method for an easy detection of identified mutations and the teachings for the first time of mutant homozygote being phenotypically normal in an autosomally dominant inherited disease.
The present invention is illustrated in further detail by the following non-limiting examples.
Pedi~rees and o~hthalmolo~ic assessments 1.1 Pedigree reconstitution The pedigree genealogy was reconstituted using the registers compiled from the Catholic parish records, which systematically list births, marriages, and deaths of 98% of the Quebec population. Validation of the family tree and new data on recent births were obtained through interviews with key family members. The Archives Nationales du Quebec, the Quebec Civil register, and the Institut de recherche sur l'étude des populations (IREP) data base (Bouchard et al., 1991, Histoire d'un génome. Population et génétique dans l'est du Quebec, Presses de I'Université Laval, Sillery, Quebec, pp 607) were also consulted.
1.2 OPhthalmoloqic investiqations All subjects, affected or not, gave inror"~ed consent before entering the study. Clinical ~ssessments comprised complete ophthalmologic evaluation, including best co~ c~ed visual acuity; optic disk examination;
5 slit-lamp biomicroscopy; applanation tonometry; gonioscopy; and visual-field evaluation. Three criteria were required for primary open-angle glaucoma (POAG) diagnosis: a) intraocular pressures above 22 mm Hg in both eyes, b) characteristic optic disk damage and/or visual field impairment, and c) grade lll or IV (open-angle) gonioscopy. In the 10 absence of optic disk damage or visual-field alteration, subjects with intraocular pressures above 22 mm Hg in both eyes and grade lll or IV
gonioscopy were diagnosed with ocular hypertension (OHT). Members of the families were considered normal when they presented normal optic disks and showed highest intraocular pressures ever recorded at 22 mm 15 Hg or less. Persons with other forms of glaucomas, including grade 0 (closed angle); grade I or ll (narrow-angle); congenital; and secondary glaucomas, or with other nonglaucomatous ocular disorders were considered unaffected. Blindness in deceased ancestors was confirmed by at least two independent sources.
2.1 Source of DNA
Blood samplcs were obtained from direct descendants of the founder as 25 well as spouses of affected patients with children; from each, 20 ml of blood was drawn by venipuncture in heparinized tubes. One additional 10 ml blood sample was drawn from each subject to establish Iymphoblastoid cell lines using the method of Anderson et al. (1984, In Vitro, 20:856-858).
2.2 Isolation of DNA
5 DNA was extracted from whole blood using the guanidine hydrochloride-proteinase K method dcveloped by Jeanpierre (1987, Nucl.
Acids. Res.15:9611-9611).
2.3 GenotvPin~ Procedures 10 To accelerate genotyping, we used a protocol similar to the procedure of Vignal et al. (1993, Methods in molecular genetics, Academic Press, 1 :211 -221) which was derived from the multiplex sequencing technique of Church and Kieffer-Higgins (1988 Science 240:185-188). Briefly, polymerase chain reactions (PCR) were performed in a total volume of 50 ~ul containing 100 ng of genomic DNA, 50 pmol of each primer, 125 mM dNTPs, 50 mM KCI, 10 mM Tris (pH 9), 1.5 mM MgCI2, 0.01%
gelatin, 0.1 % Triton X-100, and 1 U Taq polymerase (Perkin-Elmer-Cetus). Amplifications were carried out using a "hot-start"
procedure. Taq polymerase was added after a 5-min denaturation step 20 at 96~ C. Samples were then processed through 35 cycles of denaturation (94~C for 40 s) and annealing (55~ C for 30 s), followed by one last step of elongation (2 min at 72~ C). Usually, three amplification products synthesized with separate primer sets on identical DNA samples were coprecipitated and comigrated in a single lane of 6% polyacrylamide 25 denaturing gels. Separated products were then transferred onto Hybond N' nylon membranes (Amersham), hybridized with a (CA)20 oligomer 3' labeled with Digoxigenin-11-ddUTP, and detected by chemiluminescence using the DIG system (Boehringer-Mannheim) with Kodak XAR-5 films.
Genotypes were scored relative to rererence alleles of the mother of the CEPH family 1347 (individual 134702). Genotyping was repeated upon detection of i,lco",,,~alibilities or recombination events.
2.4 Selection of microsatellite markers In Figure 4, the markers used for haplotype analyses are shown. With the exception of two markers (AFMGLC21 and AFMGLC22), all AFM
(Généthon) markers reported above were described in Dib et al. (1996, 10 supra). For AFMGLC21, the sequences were primer a:
GATCTCTTATCAGTCAGGCA, and primer m:
mCTMGGCTGMTMTATTCG. For AFMGLC22, the sequences were primer a: TTMCTCACCACTCCCTGCC, and primer m:
MTTATGGCCTTCGCCC. Assignment of the genetic location of these 15 markers was established according to the method of Weissenbach et al.
(1992, Nature, 359:795-801) and has been validated by construction of a 10-cM physical map (Clépet et al., 1996, Eur. J. Hum.Genet., 4:250-259).
20 2.5 HaPlotYPe analysis Haplotypes were analysed to phase the marker genotypes with the disease gene. The haplotype inherited by an affected child constituted the "disease" haplotype and was compared with the common disease haplotype inherited from the founder. The remaining three haplotypes 25 were considered the "normal" haplotypes.
Discovery of the ~henotypic nonnal-homozYqote mutant 5 3.1 PhenotyPic normal-homozY~ote mutant (Fioure 4) Phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu TIGR mutation in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the 10 Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A
rlise~se haplotype are represenled on top. The position of the TIGR gene is indicated relative to genetic markers. Sex-averaged recombination 15 d;slances, depi 1ed between marker loci in cer,lihlorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are 20 represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype ind ~tes the haplotype inherited from the father;
25 the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person V11-5 represents a microsatellite mutation at locus D1S2790. Person V11-5 also inherited a paternal recombination between loci D1S2815 and D1S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant p, imer~. The inte, "al control PCR product is shown. Persons Vl-2, 5 Vl-5, Vl~, Vl-10 and Vl-12 carried the wild-type allele on both chromosomes 1. Persons Vl-1, Vl-7, Vl-9 and Vl-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
Blood samplcs were obtained from direct descendants of the founder as 25 well as spouses of affected patients with children; from each, 20 ml of blood was drawn by venipuncture in heparinized tubes. One additional 10 ml blood sample was drawn from each subject to establish Iymphoblastoid cell lines using the method of Anderson et al. (1984, In Vitro, 20:856-858).
2.2 Isolation of DNA
5 DNA was extracted from whole blood using the guanidine hydrochloride-proteinase K method dcveloped by Jeanpierre (1987, Nucl.
Acids. Res.15:9611-9611).
2.3 GenotvPin~ Procedures 10 To accelerate genotyping, we used a protocol similar to the procedure of Vignal et al. (1993, Methods in molecular genetics, Academic Press, 1 :211 -221) which was derived from the multiplex sequencing technique of Church and Kieffer-Higgins (1988 Science 240:185-188). Briefly, polymerase chain reactions (PCR) were performed in a total volume of 50 ~ul containing 100 ng of genomic DNA, 50 pmol of each primer, 125 mM dNTPs, 50 mM KCI, 10 mM Tris (pH 9), 1.5 mM MgCI2, 0.01%
gelatin, 0.1 % Triton X-100, and 1 U Taq polymerase (Perkin-Elmer-Cetus). Amplifications were carried out using a "hot-start"
procedure. Taq polymerase was added after a 5-min denaturation step 20 at 96~ C. Samples were then processed through 35 cycles of denaturation (94~C for 40 s) and annealing (55~ C for 30 s), followed by one last step of elongation (2 min at 72~ C). Usually, three amplification products synthesized with separate primer sets on identical DNA samples were coprecipitated and comigrated in a single lane of 6% polyacrylamide 25 denaturing gels. Separated products were then transferred onto Hybond N' nylon membranes (Amersham), hybridized with a (CA)20 oligomer 3' labeled with Digoxigenin-11-ddUTP, and detected by chemiluminescence using the DIG system (Boehringer-Mannheim) with Kodak XAR-5 films.
Genotypes were scored relative to rererence alleles of the mother of the CEPH family 1347 (individual 134702). Genotyping was repeated upon detection of i,lco",,,~alibilities or recombination events.
2.4 Selection of microsatellite markers In Figure 4, the markers used for haplotype analyses are shown. With the exception of two markers (AFMGLC21 and AFMGLC22), all AFM
(Généthon) markers reported above were described in Dib et al. (1996, 10 supra). For AFMGLC21, the sequences were primer a:
GATCTCTTATCAGTCAGGCA, and primer m:
mCTMGGCTGMTMTATTCG. For AFMGLC22, the sequences were primer a: TTMCTCACCACTCCCTGCC, and primer m:
MTTATGGCCTTCGCCC. Assignment of the genetic location of these 15 markers was established according to the method of Weissenbach et al.
(1992, Nature, 359:795-801) and has been validated by construction of a 10-cM physical map (Clépet et al., 1996, Eur. J. Hum.Genet., 4:250-259).
20 2.5 HaPlotYPe analysis Haplotypes were analysed to phase the marker genotypes with the disease gene. The haplotype inherited by an affected child constituted the "disease" haplotype and was compared with the common disease haplotype inherited from the founder. The remaining three haplotypes 25 were considered the "normal" haplotypes.
Discovery of the ~henotypic nonnal-homozYqote mutant 5 3.1 PhenotyPic normal-homozY~ote mutant (Fioure 4) Phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu TIGR mutation in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the 10 Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A
rlise~se haplotype are represenled on top. The position of the TIGR gene is indicated relative to genetic markers. Sex-averaged recombination 15 d;slances, depi 1ed between marker loci in cer,lihlorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are 20 represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype ind ~tes the haplotype inherited from the father;
25 the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person V11-5 represents a microsatellite mutation at locus D1S2790. Person V11-5 also inherited a paternal recombination between loci D1S2815 and D1S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant p, imer~. The inte, "al control PCR product is shown. Persons Vl-2, 5 Vl-5, Vl~, Vl-10 and Vl-12 carried the wild-type allele on both chromosomes 1. Persons Vl-1, Vl-7, Vl-9 and Vl-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
3.2 Initial screeninq for mutations To obtain a wild-type TIGR cDNA, RT-PCR was performed using the Superscript RT protocol (Gibco/BRL), 500 ng of oligo-dT and 10 ,ug of total RNA isolated from a pool of trabecular meshwork tissue dissected 15 from 10 pairs of human eyes. To obtain the mutated TIGR cDNA, the same protocol was followed using 10 ,ug of total RNA isolated from homozygote Vl-9 immortalized Iymphoblasts. One to 3 ,ul of first strand cDNA synthesis was amplified with primers 41 F:
AGAGCTTTCCAGAGGAAGCC, and 1 731 R:
20 GGTCTACGCCCTCAGACTAC, before a second round of PCR with internal primers 31 F: AGAGACAGCAGCACCCMCG, and 21 R:
TCTGCCATTGCCTGTACAGC. PCR products were directly cloned into the pCRII vector using the TA cloning kit (InVitrogen) according to the manufacturer's protocol. Cloned products were sequenced using the T7 25 sequencing kit (Pharmacia).
3.3 Sequencin~
To corlf" ") mutations, genomic DNA sequencing was also performed on selected individuals by direct asymmetric PCR sequencing using modificaliol-s of the protocol described by Gyllensten et al. (1988, Proc.
Natl. Acad. Sci., 85:7652-7656). The mutation was recognized by the approximately equal peak intensity of the bands on the autoradiogram.
All sequencing was performed bidirectionally.
Two mutations includinq ARMS
AGAGCTTTCCAGAGGAAGCC, and 1 731 R:
20 GGTCTACGCCCTCAGACTAC, before a second round of PCR with internal primers 31 F: AGAGACAGCAGCACCCMCG, and 21 R:
TCTGCCATTGCCTGTACAGC. PCR products were directly cloned into the pCRII vector using the TA cloning kit (InVitrogen) according to the manufacturer's protocol. Cloned products were sequenced using the T7 25 sequencing kit (Pharmacia).
3.3 Sequencin~
To corlf" ") mutations, genomic DNA sequencing was also performed on selected individuals by direct asymmetric PCR sequencing using modificaliol-s of the protocol described by Gyllensten et al. (1988, Proc.
Natl. Acad. Sci., 85:7652-7656). The mutation was recognized by the approximately equal peak intensity of the bands on the autoradiogram.
All sequencing was performed bidirectionally.
Two mutations includinq ARMS
4.1 ARMS test for the LYs423Glu mutation (Fi~ure 3) To test for the presence of the Lys423Glu mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures described by Little (1997, Current Protocols in human genetics, Eds.
Dracopoli, N.C. et al., 9.8.1. - 9.8.12). Two co,nplementary PCR reactions were conducted with the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 3, GLC1A1313M: TCGMCAAACCTGGGAGACAAACATCCGM. The second reaction contained a forward primer specific for the Lys423Glu Tl GR allele, SEQ. NO. 2, GLC1A1 31 3GG:
TCGMCAAACCTGGGAGACAAACATCCGGG. In each reaction, a common reverse primer, GLC1A1479R, was used; its sequence was:
SEQ. NO. 4 CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 225 bp amplified fragment. To serve as internal control, a second pair of primers that co amplified a 438 bp fragment within TIGR
exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGC I I I CCAGAGGMGCC, the reverse TIGR exon 1 primer was TTGGGmCCAGCTGGTC. PCR was performed using 5 standard protocols, annealing temperature was at 60~C. Amplification products were electrophoresed in 1,5% agarose gels before ethidium staining and scored by two independent observers.
4.2 ARMS test for the His366Gln mutation 10 To test for the presence of the His366Gln mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures described by Little (1997). Two complementary PCR reactions were conducted with the same substrate. The first ,ea~io,1 contained a forward primer specific for the wild-type allele, SEQ. NO. 6 GLC1A1098CT:
15 GAGMGGAAATCCCTGGAGCTGGCTACCTC. The second reaction contained a forward primer specific for the His366Gln TIGR allele, SEQ.
NO. 5, GLC1A1098GT: GAGMGGAAATCCCTGGAGCTGGCTACCTG.
In each reaction, a con1mG~I reverse primer, GLC1A1479R, was used; its sequence was:
20 SEQ. NO. 7, CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 393 bp amplified fragment. To serve as internal control, a second pair of ,c,i",er~ that co-amplified a 438 bp fragment within TIGR
exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGCmCCAGAGGMGCC, the reverse TIGR exon 1 25 primer was TTGGG I I I CCAGCTGGTC. PCR was performed using standard protocols, annealing temperature was at 60~C. Amplification products were elect,ophoresed in 1.5% agarose gels before ethidium staining and scored by two independent observers.
Although the present invention has been described hereinabove by way of prefer,ed embodiments thereof, it can be modified, without 5 departing from the spirit and nature of the subject invention as defined in the appended claims.
Dracopoli, N.C. et al., 9.8.1. - 9.8.12). Two co,nplementary PCR reactions were conducted with the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 3, GLC1A1313M: TCGMCAAACCTGGGAGACAAACATCCGM. The second reaction contained a forward primer specific for the Lys423Glu Tl GR allele, SEQ. NO. 2, GLC1A1 31 3GG:
TCGMCAAACCTGGGAGACAAACATCCGGG. In each reaction, a common reverse primer, GLC1A1479R, was used; its sequence was:
SEQ. NO. 4 CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 225 bp amplified fragment. To serve as internal control, a second pair of primers that co amplified a 438 bp fragment within TIGR
exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGC I I I CCAGAGGMGCC, the reverse TIGR exon 1 primer was TTGGGmCCAGCTGGTC. PCR was performed using 5 standard protocols, annealing temperature was at 60~C. Amplification products were electrophoresed in 1,5% agarose gels before ethidium staining and scored by two independent observers.
4.2 ARMS test for the His366Gln mutation 10 To test for the presence of the His366Gln mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures described by Little (1997). Two complementary PCR reactions were conducted with the same substrate. The first ,ea~io,1 contained a forward primer specific for the wild-type allele, SEQ. NO. 6 GLC1A1098CT:
15 GAGMGGAAATCCCTGGAGCTGGCTACCTC. The second reaction contained a forward primer specific for the His366Gln TIGR allele, SEQ.
NO. 5, GLC1A1098GT: GAGMGGAAATCCCTGGAGCTGGCTACCTG.
In each reaction, a con1mG~I reverse primer, GLC1A1479R, was used; its sequence was:
20 SEQ. NO. 7, CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 393 bp amplified fragment. To serve as internal control, a second pair of ,c,i",er~ that co-amplified a 438 bp fragment within TIGR
exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGCmCCAGAGGMGCC, the reverse TIGR exon 1 25 primer was TTGGG I I I CCAGCTGGTC. PCR was performed using standard protocols, annealing temperature was at 60~C. Amplification products were elect,ophoresed in 1.5% agarose gels before ethidium staining and scored by two independent observers.
Although the present invention has been described hereinabove by way of prefer,ed embodiments thereof, it can be modified, without 5 departing from the spirit and nature of the subject invention as defined in the appended claims.
Claims (25)
1. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1, wherein the nucleotide located at position 1267 is a guanidine residue in lieu of an adenine residue, said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.
2. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1, wherein the nucleotide located at position 1096 is a guanidine residue in lieu of a cytosine residue, said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.
3. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with said specific nucleotide, as defined in claim 1, or a complementary sequence thereof.
4. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide, as defined in claim 1, or a complementary sequence thereof.
5. An oligonucleotide as defined in claim 3, which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.
6. An oligonucleotide as defined in claim 4, which is incapable of priming a polymerase priming extension when annealed to said mutant allele.
7. An oligonucleotide as defined in claim 5, which has the nucleotide sequence of SEQ. ID. NO.: 2.
8. An oligonucleotide as defined in claim 6, which has the nucleotide sequence of SEQ. ID. NO.: 3.
9. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele, as defined in claim 1, and a complementary sequence thereof.
10. An oligonucleotide as defined in claim 9, which has the nucleotide sequence of SEQ. ID. NO.: 4.
11. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with said specific nucleotide, as defined in claim 2, or a complementary sequence thereof.
12. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide as defined in claim 2 or a complementary sequence thereof.
13. An oligonucleotide as defined in claim 11 which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.
14. An oligonucleotide as defined in claim 12 which is incapable of priming a polymerase priming extension when annealed to said mutant allele.
15. An oligonucleotide as defined in claim 13 ,which has the nucleotide sequence of SEQ. ID. NO.: 5.
16. An oligonucleotide as derived in claim 14 which has the nucleotide sequence of SEQ. ID. NO.: 6.
17. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele as defined in claim 2 and a complementary sequence thereof.
18. An oligonucleotide as defined in claim 17 which has the nucleotide sequence of SEQ. ID. NO.: 4.
19. A method for detecting a mutant allele of the TIGR
gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3,5 or 7 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3,5 or 7 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
20. A method for detecting a mutant allele of the TIGR
gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 11, 13 or 15 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 11, 13 or 15 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
21. A method for detecting a non-mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claim 4 6 or 8 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.
22. A method for detecting a non-mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claim 12, 14 or 16 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.
23. A kit for the detection of mutations in the TIGR gene comprising an oligonucleotide as defined in any one of claims 3, 5, 7, 11,13 and 15; an oligonucleotide as defined in any one of claims 4, 6, 8, 12, 14 and 16; and an oligonucleotide as defined in any one of claims 9, 10, 17 and 18; and suitable reagents required for obtaining amplified products in an amplification reaction.
24. The kit of claim 23, wherein amplification products are detectable.
25. A method for detecting in an individual the inheritance of two of said mutant alleles as defined in claim 1, said individual being homozygote for said mutant allele is phenotypically normal and said individual is capable of transmitting the said mutant allele to an offspring whereby said offspring is at risk for developing glaucoma, which comprises the steps of reproducing the methods of claims 19 and 21; a positive result obtained from the method of claim 19 and a negative result from the method of claim 21, being an indication that said individual is homozygote for said mutant allele.
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA 2216997 CA2216997A1 (en) | 1997-09-30 | 1997-09-30 | Molecular diagnostic of glaucomas associated with chromosomes 1 |
| PCT/CA1998/000923 WO1999016898A1 (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
| CA002345923A CA2345923A1 (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
| AU93340/98A AU9334098A (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA 2216997 CA2216997A1 (en) | 1997-09-30 | 1997-09-30 | Molecular diagnostic of glaucomas associated with chromosomes 1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2216997A1 true CA2216997A1 (en) | 1999-03-30 |
Family
ID=4161550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2216997 Abandoned CA2216997A1 (en) | 1997-09-30 | 1997-09-30 | Molecular diagnostic of glaucomas associated with chromosomes 1 |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2216997A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6150161A (en) * | 1994-11-03 | 2000-11-21 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
| US6171788B1 (en) | 1997-01-28 | 2001-01-09 | The Regents Of The University Of California | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
| US6475724B1 (en) | 1997-01-28 | 2002-11-05 | The Regents Of The University Of California | Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
| US7138511B1 (en) | 1997-01-28 | 2006-11-21 | The Regents Of The University Of California | Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
-
1997
- 1997-09-30 CA CA 2216997 patent/CA2216997A1/en not_active Abandoned
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6150161A (en) * | 1994-11-03 | 2000-11-21 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
| US6171788B1 (en) | 1997-01-28 | 2001-01-09 | The Regents Of The University Of California | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
| US6475724B1 (en) | 1997-01-28 | 2002-11-05 | The Regents Of The University Of California | Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
| US7138511B1 (en) | 1997-01-28 | 2006-11-21 | The Regents Of The University Of California | Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hart et al. | A mutation in the SOS1 gene causes hereditary gingival fibromatosis type 1 | |
| Hilbert et al. | Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats | |
| Liquori et al. | Myotonic dystrophy type 2: human founder haplotype and evolutionary conservation of the repeat tract | |
| Zhang et al. | Molecular isolation and characterization of an expressed gene from the human Y chromosome | |
| van der Luijt et al. | Molecular analysis of the APC gene in 105 Dutch kindreds with familial adenomatous polyposis: 67 germline mutations identified by DGGE, PTT, and southern analysis | |
| Schuback et al. | Mutations in the Norrie disease gene | |
| Michels-Rautenstrauss et al. | Juvenile open angle glaucoma: fine mapping of the TIGR gene to 1q24. 3–q25. 2 and mutation analysis | |
| US5879884A (en) | Diagnosis of depression by linkage of a polymorphic marker to a segment of chromosome 19P13 bordered by D19S247 and D19S394 | |
| Shastry et al. | Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy | |
| CA2600024A1 (en) | Diagnostic and therapeutic target for macular degeneration | |
| Manga et al. | In Southern Africa, brown oculocutaneous albinism (BOCA) maps to the OCA2 locus on chromosome 15q: P-gene mutations identified | |
| Cruts et al. | Genetic and physical characterization of the early-onset Alzheimer's disease AD3 locus on chromosome 14q24. 3 | |
| Purandare et al. | Genotyping of PCR-based polymorphisms and linkage-disequilibrium analysis at the NF1 locus. | |
| Joensuu et al. | Refined mapping of the Usher syndrome type III locus on chromosome 3, exclusion of candidate genes, and identification of the putative mouse homologous region | |
| US7629122B2 (en) | Methods and compositions for the diagnosis of Cornelia de Lange Syndrome | |
| CA2216997A1 (en) | Molecular diagnostic of glaucomas associated with chromosomes 1 | |
| WO1999016898A1 (en) | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof | |
| Thompson et al. | Unique and recurrent WAS gene mutations in Wiskott-Aldrich syndrome and X-linked thrombocytopenia | |
| US7449294B2 (en) | Diagnosis and treatment of herpes simplex virus diseases | |
| WO1999016899A2 (en) | Molecular diagnostic of glaucomas associated with chromosomes 2 and 6 | |
| WO2002008468A1 (en) | Diagnostic polymorphisms for the tgf-beta1 promoter | |
| WO2006032021A2 (en) | Identification of gene associated with reading disability and uses therefor | |
| AU2001239837B2 (en) | Methods and composition for diagnosing and treating pseudoxanthoma elasticum and related conditions | |
| US20040191774A1 (en) | Endothelin-1 promoter polymorphism | |
| EP1036195A1 (en) | Short gcg expansions in the pab ii gene for oculopharyngeal muscular dystrophy and diagnostic thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |