CA2216994A1 - Consensus configurational bias monte carlo method and system for pharmacophore structure determination - Google Patents

Abstract

In a specific embodiment, this invention comprises a method for selecting highly targeted lead compounds for design of a drug that binds to a target molecule. The method comprises screening a diversity library against the target molecule of interest to pick the selectively binding members. Next the structure of the selected members is examined and a candidate pharmacophore responsible for the binding to the target molecule is determined. Next, preferably by REDOR nuclear magnetic resonance, several highly accurate interatomic distances are determined in certain of the selected members which are related to the candidate pharmacophore. A highly accurate consensus, configurational bias, Monte Carlo method determination of the structure of the candidate pharmacophore is made using the structure of the selected members and incorporating as constraints the shared selected members and incorporating as constraints the shared candidate phamacophore and the several measured distances. This determination is adapted to efficiently examine only relatively low energy configurations while respecting any structural constraints present in the organic diversity library. If the diversity library contains short peptides, the determination respects the known degrees of freedom of peptides as well as any internal constraints, such as those imposed by disulfide bridges. Finally, the highly accurate pharmacophore so determined is used to select lead organics for drug development targeted at the initial target molecule.

Description

CON~ ~U8 CONFIGIJR~TIONAL BIA8 MONTE
CARI O ~ET}IOD AND 8Y8TE~I FOR
PFr~l~ ~rnC~KE STR'OCTIJRE DET~12~TN~ION

,~ This specification includes in Sec. 8 computer program c 5 listings that are exemplary embodiments of the c ,u~er programs of this invention.
A portion of the disclosure of this patent document contains material which is subject to copyright protection.
The copyright owner has no objection to the facsimile 10 reproduction by any one of the patent disclosure, as it appears in the Patent and Trademark Office patent files and records, but otherwise reserves all copyright rights whatsoever.
This invention was made with Government support under 15 Grant number lR43CA62752-01 awarded by the National Institutes of Health. The Government has certain rights in the invention.

1. FIELD OF THE l~v~ lON
The field of this invention is computer assisted methods of drug design. More particularly the field of this invention is computer implemented smart Monte Carlo methods which utilize NMR and binders to a target of interest as inputs to determine highly accurate molecular structures that 25 must be possessed by a drug in order to achieve an effect of interest. Illustrative U.S. Patents are 5,331,573 to Balaji et al., 5,307,287 to Cramer, III et al., 5,241,470 to Lee at al., and 5,265,030 to Skolnick et al.

2. R~R~
Protein interactions have recently emerged as a fundamental target for pharmacological intervention. For example, the top two major uncured diseases in the United States are atherosclerosis (the principal cause of heart 35 attack and stroke) and cancer. These diseases are WO 96/30849 PCT/U~, J/St1229 responsible for greater than 50~ of all U.S. mortality and cost the U.S. economy over $200 billion per year. A
consistent picture of these diseases, which has gradually emerged during the past ten years of molecular biological and 5 medical research, views both as triggered by disordering of specific molecular recognition events that take place among sets of proteins present in both the normal and disease states.
Hierarchical, organized patterns of protein-protein 10 interactions are often referred to as "pathways" or "cascades." At the molecular level, cancers have been determined to be the deregulation of pathways of interacting proteins responsible for guiding cellular growth and differentiation. During the past year, indi~idual cellular 15 events have been organized into nearly complete mechanistic explanations of how a cell's behavior is controlled by its environment and how communication pathway errors lead to uncontrolled proliferation and cancer. Disruption in similar pathways are responsible for the proliferation of blood 20 vessel walls marking the atherosclerotic disease state ~Cook et al., 1994, Nature 369:361-362; Hall, 1994, Science 264:1413-1414; Ross, 1993, Nature 362:801-809; Zhang et al., 1993, Nature 364:308-313).
Inhibition or stimulation of particular protein-25 substrate interactions have long been known drug targets.Many important anti-hypertensives, neurotransmitter analogues, antibiotics, and chemotherapeutic agents act in this fashion. Captopril, an antihypertensive drug, was designed based on its ability to antagonize a focal blood-30 pressure-regulating enzyme.
Proteins involved in biological processes, either as part of protein-protein pathways-or as enzymes, are composed of domains ~Campbell et al., 1994, Trend. BioTech.
12:168-172; Rothberg et al., 1992, J. Mol. Biol.
35 227:367-370). Domains, or regions of the protein of stable three ~;m~n~ional (secondary and tertiary) structures, play several major roles, including providing on their surface W096/30849 PCT~S96/0422~

small regions ("examples o~ targets~), where proteins anci substrates are able to bind and interact, and functioning as ~ structural units holding other domains together as part of a large protein (tertiary and quaternary structure). The 5 interaction surface of a domain or target is fundamental to determining binding specificity. Targets are often smal].
enough that the principal contribution to the binding energy is short range, highly localized to several amino acids (Wells, 1994, Curr. Op. Cell Biol. 6:163-174). The 10 functional specificity of targets and do~ains, responsible for the incredible diversity of cellular function, ultimately rests with the arrangement of amino acid side chains fornling their interaction surfaces, or targets (Marengere et al., 1994, Nature 369:502-505) It can be appreciated, there~ore, that pharmacologic:al intervention affecting the specific protein-protein and protein-substrate recognition events occurring at proteir-targets is of fundamental importance, particularly for effective drug design.
However, achieving desired pharmacological interventions in a predictable manner remains as elusive as ever. Early approaches to drug design depended on the chance observation of biological effects of a known compound or the screenirg of large numbers of exotic compounds, usually derived from 25 natural sources, for any biological effects. The nature of the actual protein target was usually unknown.

2.1. TARGET SL~lu~E-BASED
APPROACHES TO DRUG DESIGN

Rational approaches to drug design.have met with only li~ited success. Current rational approaches are based on first determining the entire structure of the proteins involved in particular interactions, eX~min;ng this structure for the possible targets, and then predicting possible drug molecules likely to bind to the possible target. Thus the location of each of the thousands of atoms in a protein ~ust be accurately determined before drug design can begin.

-PCT/U~g~ 9 Direct experimental and indirect computational methods for protein structure determination are in current use. However, none of these methods appears to be sufficiently accurate for drug design purposes according to current rational 5 approaches.
The primary direct experimental methods for determining the structure of proteins involved in particular interactions are X-ray crystallography, relying on the interaction of electron clouds with X-rays, and liquid nuclear magnetic 10 resonance (NMR), relying on correlations between polarized nuclear spins interacting via indirect dipole-dipole interactions. X-ray methods provide information on the location o~ every heavy atom in a crystal of interest accurate to 0.5-2.0 A (1 A = 10-8 cm). Drawbacks of x-ray 15 methods include difficulties in obtaining high-quality crystals, expense and time associated with the crystallization process, and difficulties in resolving whether or not the structure of the crystalline forms is representative of the in vivo conformation (Clore et al., 20 1991, J. Mol. Biol. 221:47; Sh~n~n et al., 1992, Science 227:961-964). High resolution, multidi~ensional, liquid phase NMR techniques represent an attractive alternative, to the extent that they can be applied in si tu ( i . e ., in aqueous environment) to the study of small protein domains (Yu et 25 al., 1994, Cell 76:933-945). However, the complexity of the analysis of the various mutual correlations is time consuming, and the correlations (primarily from the nuclear Overhausser effect) provide no better accuracy than X-ray methods. Isotopic enrichment of proteins with 13C and 15N
30 reduces the time associated with analysis, but at a great expense (Anglister et al., 1993, Frontiers of NMR in Biology ITI LZ011~.
Protein structures determined by any of these current methods do not predict Ruccess in subseguent drug design.
35 ~esolution obtainable either by measurement or computation, generally 0.5-2 A, has often been found to be inadequate for effective direct drug design, or for selection of a lead WO 96/30849 PCT/US96104Z2'~

compound from organic compound libraries. The resolution required to understand both drug affinity and drug specificity, although not precisely known, is probably measured in fractions of an A, down to 0.1 A (MacArthur et 5 al., 1994, Trend. BioTech. 12:149-153). This accuracy appears to be beyond the capabilities of many current methodologies.
Prior research has identified tools which, although promising, cannot be used in a coordinated manner for drug 10 design. One promising measurement approach with speed, simplicity, accuracy, and the ability to carefully control the measurement environment is rotational echo double resonance (REDOR) NMR, a type of solid state NM~ (Guillion and Schaefer, 1989, J. Magnetic Resonance 81:196; Holl et 15 al., 1990, J. Magnetic Resonance 81:620-626 and McWherter, 1993, J. Am. Chem. Soc. 115:23 8 -244 ) . REDOR accuracy can be below the 0.1 A believed to be sufficient for direct drug design. However, since REDOR measures only a few selected distances, it is not usable in drug design methods which 20 depend on the initial determination of the complete strurture of the protein containing the target of interest.
Once a target's structure is determined by the above methods, most rational drug design paradigms call for the prediction of small drug structures that will bind (or dock) =25 to the target. This prediction is generally done by computational methods, of which several are in current ut3e.
Most seek to predict the position of all the thousands oi atoms in a drug structure. Purely ab initio computational approaches to high resolution structure analysis, such as 30 quantum statistical mechanics and molecular dynamics, require prohibitive computing resources. To apply either approach, the potential energy, or Hamiltonian, of the entire system must be known. Statistical mechanics provides an expres;ion for the probability of any given protein configuration as a 35 ratio of partition functions. Proper quantum statistical mechanics required for an exact evaluation of full protein partition functions is not currently computationally PCTIU~3~1Q1229 feasible, as it would involve many thousands of atoms including the target, the protein, and the a~ueous environment. The application of even simple, approximate quantum statistical mechanics to simple systems in aqueous 5 environments is currently a non-trivial task (Chandler, 1991, in Liquids, Freezinq, and Glass Transitions, Elsevier, NY, p.
195). Molecular dynamics computes the dynamics of a molecule's motion in time. Computing the atomic dynamics of all the perhaps thousands atoms of a protein is an extreme 10 computational burden. Only picoseconds, or at most a few nanoseconds, of molecular time can be simulated, which is insufficient to determine a high resolution, equilibrium, structure (Smit et al., 1994, J. Phys. Chem. 98:84~2-8452).
In any case, most of the information determined is wasted, 15 since only the structure of the protein binding target are of interest in drug design.
Further, current approximate computational techniques for protein structure determination are in need o~ greater accuracy or efficiency. The most common techniques depend on 20 Molecular Dynamics or Monte Carlo methods (Nikiforovich, 1994, Int. J. Peptide Protein Res. 44:513-531; Brunger and Karplus, 1991, Acc. Chem. Res. 24:54-61). These methods randomly alter initial molecular structures by generating simulated thermal perturbations, and then average the 25 ensemble of results to determine a final structure. The generated perturbation must preserve all structural constraints and be energetically favorable. If both conditions are not met, the perrurbation will be discarded.
Current Monte Carlo methods applied to constrained protein 30 structure determinations productively use only approximately 1 out of 105 perturbed structures generated (Siepmann et al., 1993, Nature 365:330-332). This extreme waste of computer rescurces results in time consuming, low resolution structure determinations.
To summarize, existing rational drug design methods ~ased on identification of target structure fail to reliably yield drug molecules due to experimental structure PCT~S96/04225 determination di~ficulties and computational di~iculties associated with predictinq drug structures with ill-defined ~ Hamiltonians.

2.2. DIVERSITY-BASED APPROACHES TO DRUG DESIGN
Another method for exploring protein target interactions utilizes "recognition systems" which comprise huge libraries of related molecules (Clarkson et al., 1994, Trend. BioTech.
12:173-184). From such a library only those members binding 10 to the target of interest are selected. Such recognition systems must encompass the structural di~ersity of protein targets while being amenable to serve for the selection of lead co~pounds for drug design. Antibodies are one clas;sic example of such a system that certainly meets the recognition 15 requirement. Unfortunately, there is a need to determine the antibody structures needed for lead compound selec~ion more rapidly and accurately. While about 2000 recognition reqions have been sequenced, only about 23 in the Brookhaven Prolein Structural Database have structures determined to even w:Lthin 20 2 A (Rees et al., 1994, Trends in Biotech. 12:199-206).
Promising recognition systems at the opposite extrerne comprise huge libraries of small peptides. The small peptides must be sufficiently diverse so that they attain a level of affinity and specificity similar to that obtained by 25 protein domains. Given the role peptides play in nature, this condition can be met by surprisingly small structures, with 6 to 12 amino acids. However, linear peptides are ei.ther unstructured or weakly structured at room temperature in a~ueous solutions ~Alberg et al., 1993, Science 262:248;
30 Skalicky et al., 1993, Protein Science 10:1591-1603). From a practical viewpoint, linear peptides must be constrained to reduce their degrees of freedom (reduced conformational entropy) and to increase their chances for strongly binding.
These constraints, or scaffolds, limit the range of stable 35 conformations and make more straightforward determining bound structure (Olivera et al., 1990, Science 249:259; Tidor et al., 1993, Proteins: Structure Function and Genetics 15:71).

-WO 96t30849 ~CT/U~5~'C "~'~9 Methods are now available to create such libraries and to select library members that recognize a specific protein target. The production of constrained peptide diversity libraries requires synthesizing oligonucleotides with the 5 desired degeneracy to code for the peptides and ligating them into selection vectors (Goldman et al., 1994, Bio/Tech.
10:1557-1561). Once a constrained structured diversity library is created, it is a source from which to select specific members that bind to a target of interest. Beginning 10 with a known pathway involving specific domain-domain or protein-substrate interactions at a target, molecular biological methods can be used to identify in a matter of days small ensembles o~ highly constrained peptides ~rom these huge libraries that bind to these domains with high 15 affinity and specificity.
While this ~ield has been exploding in the last few years and showing great potential, it is severely limited by its use in isolation without the benefit of integrated structural analysis needed both to derive the high resolution 20 structures of binding peptides and also to direct the construction o additional structured libraries. Drug design is not aided by having library members recognizing the protein target of interest but without any understanding of why the recognition occurs. This is entirely similar to the 25 random screening methods of early fortuitous drug design e~forts.
Unfortunately, rational drug design according to current approaches (target structure-based) rem~; n.C an inefficient, laborious process with a disproportionately high lead-30 compound failure rate. Presently, about 90~ of lead compounds fail to emerge successfully from clinical trials ~Trends in U.S. Pharmace tical Sales and Research and Development, Pharmaceutical Manufacturing Association, Washington, D.C., 1993).
It is becoming clear that low-resolution structures of an entire protein or target (at 0.5-2 ~), or an WO 96130849 PCTIUS96/04229' uncharacterized lead, such as proauced by chemical diver.sity methods, leave much to be desired for use in drug design.
If the limitations of prior art methods were overcc7me and a sufficiently accurate structure needed by a molecule to 5 bind to a target of interest could be determined, exist ng chemical libraries could be searched for highly targeted lead compounds with similar structure (Martin, 1992, J. Medicinal Chem. 35:2145-2154). This database search can be based not only on chemical and electronic properties, but also on 10 geometric information. Such searches that have high resolution (better than 0.25 A), would provide a vast improvement over the prior art, as lower resolutions lead to an exponentially increasing number of potential leads.
Computational methods to determine high resolution dru~
15 structures from recognition system binding information or NMR
partial distance measurements are not currently available.
No current structure determination methods uses such additional information to make more efficient or more accurate determination of high resolution structures 20 (Holzman, 1994, Amer. Sci. 872:267).
Citation of a reference or discussion hereinabove shall not be construed as an admission that such is prior art to the present invention.

3. SUMMARY OF THE lNv~NllON
It is a broad object of this invention to address t:he prior art problems of drug design by providing a method of rational design of drugs that achieve their effect by bi.nding to a target molecule or molecular complex of interest.
30 Importantly, this object is achieved without requiring determination of the structure of the molecule or molecular complex ("target molecule") bearing the target or even of the target itself. The method is target structure independent.
The method of the invention uses an interdisciplinary 35 combination of computational modeling and simulation, experimental distance constraints, and molecular biology.

CA 022l6994 l997-09-30 WO 96/30849 PCT/U~6/01229 In an important aspec~, the invention provides a computer implemented modeling and simulation method to determine a highly accurate consensus structure for the pharmacophore and a structure for the remainder of the 5 molecule from diversity library members that bind to the protein target of interest. Where prior structure determination methods focused on the structure of the target molecule or of the target, the method of this invention is uniquely adapted to focus instead on the structures of 10 molecules that bind to the target. Such structural information is directly applicable to drug design since it defines the structure a drug must possess to bind to the target of interest. Also, this structural information is much easier to determine by use of the present invention, 15 since it concerns molecules with many fewer atoms than the target molecule. The method of the invention achieves accuracy by improving upon the accuracy and utility of the input structural information. In a further embodiment of the invention, the method employed for structural determination 20 is a .smart Monte Carlo technique adapted to small constrained molecules.
The structure determination method of the invention allows one to take maximum advantage of the information obtained from the molecular biological selection of the 25 diversity library members that tightly and specifically bind to the target molecule of interest. The selected library members must share some common structure to bind to the same target molecule. The smart Monte Carlo computer method of this invention specifically seeks and provides this common 30 structure.
The invention also provides a method of performing REDOR
NMR measurements of molecules on a solid phase substrate. In a preferred embodiment, the substrate is a solid phase on which the molecule (e.g., peptide) has been synthesized, with 35 a high degree of purity. In another preferred embodiment, performing REDOR measurements of such a molecule on a substrate can be done in a dry nitrogen atmosphere, under -PCT/U~ 4Z2g hydrated conditions, and when the molecule is either free or bound to a target. In a specific embodiment, the REDOR
measurements are accurate to better than 0.05 A from 0 to 4 A, and to better than 0.1 A from 4 to 8 A. In an 5 advantageous aspect of the invention, the structure determination method makes maximum use of these highly accurate internuclear distance measurements to constrain the determined common structure for the binding library me~ers.
The invention also provides methods of identifying a 10 compound that specifically binds to a target molecule, by first screening a diversity li~rary, and then using a genetic selection method for screening the compounds identified from the diversity library.
In broad aspects, the invention provides a method and 15 apparatus for rational and predictable design of new and/or improved drugs that achieve their effect by binding to a specified target molecule. More particularly, the invention is directed to a method for the rational selection of highly specific lead compounds for such drug design, including ~he 20 computer implemented step of highly accurate determination of the structure responsible for this target binding by the highly accurate, consensus, configurational bias Monte Cc~rlo method.
A lead compound serves as a starting point for drug 25 development both because it specifically binds to the protein target o~ interest, achieving the biological e~fect of interest, and because it has or can be modified to have good pharmacokinetics and medicinal applicability. A final drug may be the lead compound or may be derived therefrom by 30 modifying the lead to maximize beneficial effects and minimize harmful side-effects. Although any lead compound is u~eful, a lead that tightly and specifically binds to the tarset molecule of interest in a known ~nner~ such as can be provided by the invention, is of great use. Knowledge of the 35 high resolution structures in a lead compound responsible for -its binding and activity provides a more focused and efficient drug development process.

CA 022l6994 l997-09-30 PCTIU~ r~ 1229 Thè methods of the invention improve lead compound determination, by determining the "pharmacophore~, the precise structural chara~teristics needed ~or a lead compound to specifically bind to a target of interest. The most 5 fundamental specification of a pharmacophore is in terms of the electronic properties necessary ~or a molecule to specifically bind to the surface of a target molecule. These properties may be fl~n~mentally represented by requirements on the ground and low lying excited state wave functions of a 10 pharmacophore, such as, for example, by specifying re~uirements on the well known multiple expansion of these wave functions.
The preferred pharmacophore specification according to the invention i5 in terms of both the chemical groups making 15 up the pharmacophore and determining its electronic properties and also the yeometric relationships of these groups. This chemical representation is not the only possible representation of the pharmacophore. Several chemical arrangements may have similar electronic properties.
20 Fo- example, if a pharmacophore specification included an -OH
group at a particu'ar position, a substantially equi~alent specification might include an -SH group at the same position. Equi~alent chemical groups that may be substituted in a pharmacophore specification without substantially 25 changing its nature are called "homologous".
In particular embodiments, therefore, this invention provides a method and apparatus for the highly accurate determination of the pharmacophore needed to speci~ically bind to the target molecule of interest, by a specification 30 of the geometric relationships of the important chemical groups. The pharmacophore is pre~erably determined by a s~.art Monte Carlo method from molecular biological input specifying molecules (preferably selected from among diversity libraries) that specifically bind to the target 35 molecule and also preferably from REDOR NMR data speci~ying a few highly accurate distances in these selected molecules.

PCT~S96/04229 An important advantage provided by the invention is the ability to make a pharmacophore structure determination without relying on any knowledge of the structure of the target molecule or target. Where the target molecule is a 5 protein, conventional prior art methods have sought to sequence and determine the structure of the protein containing the ~arget, hoping thereby to determine acti~e sites by ex~min~tion of the structure. A further important advantage of the invention is that this structure 10 determination can be made by use of a relatively small number of actual physical position measurements. In contrast, conventional methods using X-ray crystallography and liquid NMR req~ire determination of positions of all atoms in the molecule ("binder") that specifically binds to the target, 15 and the target. An additional advantage provided by the invention is that, in a preferred embodiment wherein REDOR
structural measurements provide input information, the accuracy of the pharmacophore structure determination can be at least approximately 0.25-0.50 A or better. This accu:racy 20 is provided by the combination of an efficient, Monte ~a:rlo techniq~le for struc~ure determination with a few highly accurate distance determinations.

4. BRIEF DESCRIPTION OF THE DRAWINGS
These and other features, aspects, and advantages of the present invention will become better understood by reference to the accompanying drawings, following description, and appended claims, where:
Fig. 1 is the overall method of this invention in it:s 30 broadest aspect;
Fig. 2A and 2B are more detail for the step of Fis. l for selecting candidate pharmacophore structures;
Fig. 3 is more detail for the step of Fig. 1 for preforming distance measurements;
Fig. 4 is more detail for the step of Fig. 3 for performing NMR measurements;

PCTnUS96104229 Fig. 5 is REDOR NMR signal response details for step of Fig. 3 of data analysis;
Fig. 6 is sample REDOR NMR spectra according tO the method of Fig. 3; h Fig. 7 is sample data analysis according to the method of Fig. 3;
Fig. 8 is more detail for the Step of Fig. 1 for configurational bias Monte Carlo structure determination;
Fig. 9 is a sample of simulation completion data;
Fig. 10 is further detail of peptide memory representation used in the method of Fig. 8;
Fig. 11 is additional detail of peptide memory representation used in the method of Fig. 8;
Fig. 12 is more detail for the step of Eig. 8 of 15 processor generation of proposed modified structures by Type I moves;
Fig. 13 is more detail for the step of Fig. 8 of processor generation of proposed modified structures by Type II moves;
Fig. 14 is additional detail for the step of Fig. 8 of processor generation of proposed modified structures by Type II moves;
Fig. 15 is a structure for implementing the method of Fig. 8;
Fig. 16 is the main program structure of Fig. 15;
Fig. 17 is the structure modification program structure of Fig. 15;
Fig. 18A and 18B are the Type I move generator prosram structure of Fig. 17;
Fig. l9A and 19B are the Type II move generator program structure of Fig. 17.

5. DET~TT-~n DESCRIPTION
For clarity of disclosure, and not by way of limitation, 35 the detailed description of the invention is described as a series of steps. A ~road view of the exemplary steps of which the invention is c~".~ised is presented in Fig. 1, a WO 96/30849 PCT/US96/0422S' brief overview of which is presented in the text that follows.
The invention method preferably begins with a tarcget molecule (or molecular complex) 1 having a binding target of biological or pharmacological interest. Specific binding of a molecule to the target is predicted to affect its biological activity and may provide biological effects of interest. For example, these effects might include amelioration of a disease process or alteration of a lO physiological response. Lead compounds 8 output from t.he invention are able to specifically bind to target molec:ule 1 and can serve as starting points for the design of a drug able to specifically bind to the target.
Diversity library screening, step 2, allows the 15 selection from among library members of a plurality of molecules [hereinafter called "binders"] that specifically bind to target molecule (or molecular complex) 1; the chemical building block structure (e.g., sequence, str~lctural formula) is then determined. If predetermined binders and 20 their structure are already available, the invention can use this information directly without the need for library screening. If library screening is done, one or more libraries may be screened. The selected binders all share a common pharmacophore structure, allowing their specific 25 binding to the target in a chemically and physically similar manner. This common structure is preferably iterative:Ly determined by a select and test method. Candidate pharmacophore selection, step 3, is based upon chemica:L
structure homologies. Geometric and conformational 30 information is not needed to be used at this step and .is preferably not considered. A candidate pharmacophore shared - by all the N binders is selected, step 3, for structure determination by subsequent steps. The binders will typically present several candidate chemical pharmacoplnores, 35 ignoring conformation considerations. These candidates are small groups of library building blocks, often contiguous, each candidate group in one binder being homologous to the W O 96/30849 PC~rrUS96/04229 candidate groups in all the other binders. Building block homologies are determined by applying rules appropriate to the diversity library. In the preferred embodiment, homologous building blocks have similar surface chemical 5 groups, since pharmacophores are defined by a similar geometric arrangement of chemical structures. In~the case of the preferred library, CX6C, candidate pharmacophores are amino acid sequences whose side chain surface groups have similar chemical properties. Amino acid homologies are 10 determined by mechanical rules described below. These candidate sequences are typically 3 amino acids long, but may range from 2 all the way to 6. Where pharmacophores are defined by their charge distributions, homologous library building blocks must have similar charge distributions.
Having selected N binders by screening one or more libraries and determined a candidate pharmacophore in each binder, the subsequent steps of distance measurement, step 4, and Monte Carlo structure determination, step 5, determine a highly accurate structure for the candidate pharmacophore, if 20 possible. This determination will be possible if the candidate is the actual pharmacophore. A subsequent test, step 6, checks for success of this structure determination.
In particular cases, di~tance measurements may not be necessary in order to determine an adeq~ately precise 25 pharmacophore structure.
Measurements are made, step 4, of a few strategic distances in the binders, that will be most useful for the subsequent structure determination step. A minimum number of strategic interatomic distances in the binders are measured 30 in step 4. These few distances constrain possible binder structures and make the subsequent complete structure determination more efficient and more accurate. In preferred but not limiting embodiments, measurement methods yielding distances accurate to at least approximately 0.25 A or less 35 are used. The preferred methods use nuclear magnetic resonance ["NMR"~ techniques. Particularly preferred is the rotational-echo double resonance t"REDOR"] NMR method for W096/30849 PCT~S96/04229 directly measuring l3C-lsN internuclear distances in peptides, the most accurate current method for simply and inexpensive~y obtaining such distances. It is generally capable of accuracy to 0.1 A and a span of 8 A. In a specific 5 embodiment, peptide binders are synthesized from amino acidc labeled with 13C and lsN. Labeling is chosen to obtain t:he most useful distance data about the selected candidate pharmacophore structures. Either backbone nuclei, side chai..
nuclei, or both can be labeled. The step is detailed below.
10 Liquid NMR techniques can also be used to indirectly determine internuclear distances in peptides, but are less preferred since they require considerable data interpretation to obtain distances of less accuracy than those obtained by use of REDOR.
Structure determination, step 5, determines a precise geometric conformation for both the candidate shared chemical structures, if possible, and the remainder of the binders.
The preferred but not limiting method, consensus, configurational bias, Monte Carlo ["CCBMC"] determinati.on, 20 step 5, is an efficient smart Monte Carlo method uni~uely able to incorporate knowledge from prior steps to obtain highly accurate physical binder structures. From library screening, step 2, it is deduced that the binders have a shared, actual pharmacophore, structure because they all bind 25 specifically to the same target molecule (hence, a "consensus" method). It is not significant to the method if the binders come from more than one library as long as they all have a structure adaptable to representation in the consensus structure determination step (see infra). From 30 distance measurements, step 4, a few strategically chosen distances are accurately known. This information is heuristically utilized along with an accurate model of the physical atomic interactions and the allowed molecular conformations.
Further, these means are particularly adapted for determining structures of molecules having limited conformational degrees of freedom at the temperature of PCTrUS96/01~-9 interest and conformationally constrained by, e.g., internal bonds. Potential conformations are generated and selected by smart configuration bias techniques which avoid generation of unnecessarily improbable new conformations. (Hence, a 5 "configuration bias" method.) The technique is preferably applied herein to conformationally constrained peptides. A
concerted rotation technique is combined with configurational bias conformation generation so that new conformations automatically preserve the internally linked backbone 10 structure constraints. This technique is preferably applied to the preferred constrained peptide library, of a sequence comprising CX6C (wherein X is any amino acid). The technique is also applicable to other constrained peptide libraries, to peptoid libraries, and to any more general organic diversity 15 libraries that meet certain geometric limitations (i.e., that have structures adaptable to representation in the consensus structure determination step (see i~fra)).
The methods of the invention are not limited to the use of CCBMC for determining a consensus pharmacophore structure.
20 Alternative embodiments of this invention may use alternative structure determination methods to determine a consensus pharmacophore structure For example, a simple yet expensive method is to make exhaustive REDOR NMR measurements characterizing the candidate pharmacophore in each binder and 2~ then average these measurements. A somewhat less expensive method is to use a conventional Monte Carlo molecular structure determination method to limit somewhat the number of REDOR NMR measurements required to characterize the candidate pharmacophore. Conventional Monte Carlo methods, 30 being unable to directly make use of partial distance measurements or consensus binding information, are less efficient than the CCBMC method and require more distance measurements. ~urther, other known techniques of molecular structure determination, for example folding rules or 35 molecular dynamics, can be used in place of conventional Monte Carlo.

WO 96/30849 PCT/U~,C~ 229' The success o~ the structure determination is tested, step 6, against various convergence and success criteria.
Consistency tests, step 6, are applied to the resulting structure to determine whether the candidate pharmacophore 5 previously selected is the actual pharmacophore. One set of tests checks predicted distances against new distance measurements or against previous measurements temporarily not used as structure constraints. A second set of tests checks heuristically whether the candidate pharmacophore exhibits 10 the expected low energy consensus structure. The test are described further below. If a shared structure is found, the candidate pharmacophore must be the actual pharmacophore. If not, another candidate pharmacophore and another shared structure is determined, if possible. An actual 15 pharmacophore exists and will eventually be found and accurately structured.
Upon passing these tests, the methods of the invention have provided a consensus structure for the selected candidate pharmacophore, preferably accurate to at least 20 approximately 0.25-0.50 A, as well as structures for the remainder of the binder molecules. Lead compound selection, step 7, uses these structures to determine or select highly targeted lead compounds 8. One method of lead selection is to design new organic molecules of pharmacologic utility with 25 the determined pharmacophore structure. Another method selects leads from databases of molecular descriptions.
Conventionally known to medicinal chemists are databases of potential drug compounds ;~xed by their significant chemical and geometric structure (e.g., the Standard Drugs 30 File ~Derwent Publications Ltd., London, E~gland), the Bielstein database (Bielstein Information, Frankfurt, Germany or Chicago), and the Chemical Registry database (CAS, Columbus, Ohio)). The determined pharmacophore, being a chemical and geometric structure in the preferred embodiment, 35 is used to query such a database. Search results will be those compounds with homologous chemical groups arrayed in a very closely similar geometric arrangement. These are lead W096/30849 PCT~S96/04229 compounds 8 output from this invention and input to the process of drug testing and development.
Although the preferred identity and ordering of the method steps is presented in Fig. 1, the invention is not 5 limited to this identity and ordering. Other orderings, especially of steps 3, 4, and 5, are possible to ~chieve certain efficiencies. Steps can be inserted and deleted, for optimal effect. For example, an additional partial structure determination step can be inserted between existing steps 3 10 and 4 to provide information on how best to make the step strategic measurements. As another example, in an alternative aspect, in lieu of screening one or more libraries to select binders, predetermined binders can be obtained and used (e.g., binders determined by any means to 15 be specific to the same target molecule); thus, step 2 can be omitted. In another embodiment, step 4, the measurement step, can be omitted. While all method steps in the preferred embodiment assume an aqueous environment at body temperature (37 ~C), to the extent these parameters are 20 relevant to the particular step, the invention is not limited to human environmental parameters.
Screening against a diversity library consists of selecting by assay those library members which bind specifically to the target molecule of interest. Binding 25 specificity is preferably a binding constant of less than 1 ~m (micromolar), and more preferably less than 100 nm (nanomolar). Preferably, an assay is done that detects an effect of binding of the binder to the target molecule on the target molecule's biological activity, to ensure that the 30 binding is actually to the biological target of interest.
Also, preferably, the selected binders are tested to further select those binders that bind to-the target molecule competitively, to ensure that each binds to the same target in the target molecule.
The output of the screening step is a number, N, of hinders selected from one or more libraries for use by the subsequent steps of the method. The binders with highest PCTIU~,5J0~229 affinity are preferably selected for use by the subse~uent steps. The chemical structure of each of the N blnders selected for use is determined as part of the member synthesis and library screening. The primary chemical 5 structure of the preferred constrained peptide library :is specified by the amino acid sequence of the -X6- portion of the CX6C molecule. For more general organic diversity libraries, the selection and arrangement of library bui:Lding blocks in the binders must be determined.
It is a preferred aspect of this invention that the set of determined lead compounds is selective and small. Example 1 illustrates that as pharmacophore distance tolerances are relaxed, the number of compounàs retrieved by drug database searches increases geometrically. As this invention 1~ determines high resolution pharmacophore geometries, it can be expected that database searches, or other methods of determining leads ~rom pharmacophore structure, will ret:urn only a few, selective, targeted leads. Methods limiting the number of leads decrease the cost of drug development and are 20 consequently of considerable utility to the pharmaceutical industry and medical community. The expense of developing and evaluating lead compounds for biological effect and medicir.Lal usefulness is well known. Each lead compound must be screened for pharmacological usefulness, efficacy, and 25 safety. Often chemical modifications are required and the process must be repeated. Finally, the required in vi~,o pharmacologic toxicity and clinical trials alone can consume years of time and millions of dollars.
Therefore, starting with a target molecule 1 having a 30 biologically or pharmacologically interesting target, thie method and apparatus of this invention determines a consensus - pharmacophore structure. This consensus pharmacophore str~cture can then be used to determine a selective set of - highly specific lead compounds 8 (Fig. 1) for rational d.esign 35 of drugs, e.g., capable of acting as ligand-mimics (agonists or antagonists) for the particular target molecule.

.

PCTIU~10~229 W096)30849 In the following discussion and examples, each c these steps will be more fully described.

5.1. SELECTION OF A TARGET MOLECULE
The target molecule is any one or more molecules containing a target or putative target of interest. The target is a binding interaction region. The target can be in a single molecule or can be a product of a molecular complex.
The target can be a continuous or discontinuous binding 10 region. The target molecule selected for use (Fig. 1, step 1) is preferably any molecule that is found in vivo (preferably in mammals, most preferably in humans) and that has biological activity, preferably involved or putatively involved in the onset, progression, or manifestation of a 15 disease or disorder. The target molecule can also be a fragment or derivative of such an in vivo molecule, or a chemical entity that contains the same target as the ln vivo molecule. Examples of such molecules are well known in the art. Such molecules can be of mammalian, human, viral, 20 bacterial, or fungal origin, or from a pathogen, to give just some examples. The target molecule is preferably a protein or protein complex. The target molecules that can be used include but are not limited to receptors, ligands for receptors, antibodies or portions thereof ( e . g., Fab, Fab', 25 F(ab')2, constant region), proteins or fragments thereo:E, nucleic acids, glycoproteins, polysaccharides, antigens, epitopes, cells and cellular components~ subcellular particles, carbohydrates, enzymes, enzyme substrates, oncogenes (e. g., cellular, viral; oncogenes such as ras, raf, 30 etc.), growth factors (e.g., epidermal growth factor, platelet-derived growth factor, fibroblast growth factor), lectins, protein A, protein G, organic compounds, organometallic compounds, viruses, prions, viroids, lipids, fatty acids, lipopolysaccharides, peptides, cellular 35 metabolites, steroids, vitamins, amino acids, sugars, lipoproteins, cytokines, lymphokines, hormones, T cell 8urface antigens (e.g., CD4, CD8, T cell antigen receptor), CA 022l6994 l997-09-30 PCTlU~ 1229 ions, organic chemical groups, viral antigens (hepatitis B
virus surface or core antigens, HIv antigens (e.g., gpl20, gp46)), hepatitis C virus antigens, toxins (e.g., bacterial toxins), cell wall components, platelet antigens (e.g., 5 gpiibiiia), cell surface proteins, cell adhesion molecules, neurotrophic factors, and neurotrophic factor receptors.
In specific em~odiments, vEGF (vascular endothelial growth factor) or KDR (the receptor for vEGF) (Terman et al., 1992, Biochem. Biophys. Res. Comm. 187:1579-1586) is the 10 target molecule. vEGF and its receptor are the major regulators of vasculogenesis and angiogenesis (Millauer et al., 1993, Cell 72:835). Inhi~ition of the vEGF and the concomitant inhibition of its mitogenic activity and angiogenic capacity has been shown to suppress tumor grcwth 15 in vivo (Kendall et al., 1993, Proc. Natl. Acad. Sci. USA
90:10705-10709; Kim et al., 1993, Nature 362:841-844). Use of vEGF or KDR or portions thereof, as a target molecule is a preferred embodiment for use of the present invention to develop lead molecules as drugs in the area of cardiovaccular 20 disease or cancer.
The proteins ras and raf, or portions thereof (e.g., modules -- functional portions), are also preferred target molecules, particularly in an embodiment wherein the methods of the present invention are employed to develop lead 25 molecules for drugs that are cancer therapeutics. ras is a member of an intracellular signaling cascade that contrc,ls cell growth and differentiation (Cook and McCormick, l9S4, Nature 369:361-362). ras functions in signal transduction by specifically recognizing the protein raf and bringing it to 30 the cell membrane (Hall, 1994, Science 264:1413-1414; Vojtek et al., 1993, Cell 74:205-2143. The recognition module~ in both ras and raf have been determined (Zhang et al., 195~3, Nature 364:308-313; Warne et al., 1993, Nature 364:352-',55;
- and Vojtek et al., 1993, Cell 74:205-214); in a specific 35 embodiment, such a recognition module is used as a target molecule according to the invention.

PCT/U~'0~229 In another specific embodiment, an integrin is used as a target molecule. Such molecules are known to function in clot formation, and can be used according to the present invention to develop lead molecules ~or drugs in the area of r 5 cardiovascular disorders.
Target molecules for use can be obtained commercially (where the target is commercially available), or can be synthesized or purified from natural or recombinant sources.
In a specific embodiment, a target molecule is prepared that 10 has been modified to incorporate an ~affinity tag,'~ i. e., a structure that specifically binds to a known binding partner, to facilitate recovery/isolation/immobilization of the target molecule. In a preferred aspect, recombinant expression methods well known in the art can be used to produce a 15 protein target molecule as a fusion protein, incorporating a peptide affinity tag. Such affinity tags include but are not limited to epitopes of known antibodies (e.g., c-myc epitope (Evan et al., 1985, Mol. Cell. Biol. 5:3610-3616)), a series (e.g., 5-7) of his residues (which bind to zinc), maltose 20 binding sequences such as pmal, etc. Tags are incorpora~ted into protein targets at either the amino or carboxy-terminus.
In another embodiment, the target is chemically attacheci to a tag (e.g, biotin (which binds to avidini streptavidin), streptavidin), e.g., by biotinylation.
The target molecule is purified by standard methods.
For example, a protein target can be purified by standard methods including chromatography (e.g., ion exchange, affinity, and sizing column chromatography), centrifugat:ion, differential solubility, or by any other standard technique 30 for the purification of proteins; in a preferred embodiment, reverse phase HPLC (high performance liquid chromatography) is employed.
Once the target molecule has been purified, it is preferably tested to ensure that it retains its biological 35 activity (and thus retains its native conformation). ~ly suitable in vitro or in vivo assay can be used. In ins1:ances where the desired target molecule is a fragment or derivative PCT/U~6101229 of a molecule found in vivo, or is a chemical entity putatively containing the same target as a molecule found in vivo, it is highly preferred that testing be done of such desired target molecules prior to their use, so that among 5 such desired target molecules, only those that have the same biological activity as the in vivo molecule or compete with a known ligand to the in vivo molecule, are selected for actual use as target molecules according to the invention. In the event that biological activity has been reduced or lost in a 10 recombinant protein relative to the native form of the protein, the protein can be recombinantly expressed in a different host (e.g., yeast, mammalian, or insect) and/or with a variety of tags and location of tags (on either the amino- or carboxy-terminal side), in order to attempt to 15 achieve, or to optimize, recovery of biological activity 5 . 2 . DIVERSITY LIBR~RIES
According to a preferred embodiment of the invention, diversity libraries are screened to select binders, which 20 specifically bind to the target molecule. Diversity libraries are those containing a plurality of different members. Generally, the greater the number of library members and the greater the probability that all possible members are represented, the more preferred the library. In 25 preferred embodiments, the diversity libraries have at least 104 members, and more preferably at least 106, 10~, 10l~, or 1 0 1C, members .
Many libraries suitable for use are known in the art and can be used. Alternatively, libraries can be constructed 30 using standard methods. Chemical (synthetic) libraries, recombinant expression libraries, or polysome-based libraries are exemplary types of libraries that can be used.
In a preferred embodiment, the library screened is a constrained, or semirigid library (having some degree oi - 35 structural rigidity). Examples of constrained libraries are described below. A linear, or nonconstrained library, 'LS

PCT/U:~gf '0~229 less preferred although it may be used. Additionally, one or more different libraries can be screened to select binders.
In a preferred embodiment, the library contains pept:ide or peptide analogs having a length in the range of 5-18 amino 5 acids or analogs thereof in each library member.
In specific embodiments, hinders are identified from a random peptide expression library or a chemically synthe~;ized random peptide library. The term "random" peptide libraries is meant to include within its scope libraries of both 10 partially and totally random (~ariant) peptides.
In one embodiment, the peptide libraries used in the present invention may be libraries that are chemically synthesized in vitro. Examples of such libraries are given in Fodor et al., 1991, Science 251:767-773, which describes 15 the synthesis of a known array of short peptides on an indlvidual microscopic slide; Houghten et al., 1991, Nature 3~4:84-~6, which describes mixtures of free hexapeptides in which t~e first and second residues in each peptide were individually and specifically defined; Lam et al., 1991, 20 Nature 354:82-84, which describes a "one bead, one peptide"
approach in which a solid phase split synthesis scheme produced a library cf peptides in which each bead in the collection had immobilized thereon a single, random sequence of amino acid residues; Medynski, 1994, Bio/Technology 25 12:709-710, which describes split synthesis and T-bag synthesis methods; and Gallop et al., 1994, J. Medicinal Chemistry 37(9):1233-1251. Simply by way of other examples, a combinatorial library may be prepared for use, according to the methods of Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci.
30 USA 90:10922-10926; Erb et al., 1994, Proc. Natl. Acad. Sci.
USA 91:11422-11426; Houghten et al., 1992, Biotechniclue~;
13:412; Jayawickreme et al., 1994, Proc. Natl. Acad. Sci. USA
91:1~14-1618; or Salmon et al., 1993, Proc. Natl. Acad. Sci.
USA 90:11708-11712. PCT Publication No. WO 93/20242 ancl 35 Brenner and Lerner, 1992, Proc. Natl. Acad. Sci. USA
89:5381-5383 descri~e "encoded combinatorial chemical PCTIU",6101229 libraries," that contain oligonucleotide identifiers for each chemical polymer library member.
In another embodiment, biological random peptide libraries are used to identify a binder which binds to a 5 target molecule of choice. Many suitable biological rand.om peptide libraries are known in the art and can be used or can be constructed and used to screen for a binder that binds to a target molecule, according to standard methods commonly known in the art.
According to this approach, involving recom~inant D~A
techniques, peptides are expressed in biological systems as either soluble fusion proteins or viral capsid fusion proteins.
In a speci~ic embodiment, a phage display library, in 15 which the protein of interest is expressed as a fusion protein on the surface of a bacteriophage, is used (see, e.g., Smith, 1985, Science 228:1315-1317). A number of peptide libraries according to this approach have used the M13 phaye. Although the N-terminus of the viral capsid 20 protein, protein III (PIII), has been shown to be necessary for viral infectior., the extreme N-terminus of the mature protein does tolerate alterations such as insertions. Ihe protein PVIII is a major M13 viral capsid protein, which can also serve as a site for expressing peptides on the surface 25 of M13 viral particles, in the construction of phage display libraries. Other phage such as lambda ha~e been shown also to be able to display peptides or proteins on their suriace and allow selection; these vectors may also be suitable for use in production of libraries (Sternberg and Hoess, 1995, 30 Proc. Natl. Acad. Sci. USA 92:1609-1613).
Various random peptide libraries, in which the diverse peptides are expressed as phage fusion proteins, are known in the art and can be used. Examples of such libraries ar,e described below.
Scott and Smith, 1990, Science 249:386-390 describe construction and expression of a library of hexapeptides on the surface of M13. The library was made by inserting a 33 PCI~/U~5~'~ S229 base pair Bgl I digested oligonucleotide sequence into an S~i I digested phage fd-tet, i.e., fUSE5 RF. The 33 base pair fragment contains a random or "degenerate~ coding sequence (NNK) 6 where N represents G, A, T or C and K represents G or 5 T. Cwirla et al., 1990, Proc. Natl. Acad. Sci. USA 87: 6378-6382 also described a library of hexapeptides expressed as pIII gene fusions of M13 fd phage. PCT publication Wo 91/1981~ dated December 26, 1991 by Dower and Cwirla describes a library of pentameric to octameric random amino 10 acid sequences.
Devlin et al., 1990, Science, 249:404-406, describes a peptide library of about 15 residues generated using an (NNS) coding scheme ~or oligonucleotide synthesis in which S is G
or C.
Christian and colleagues have described a phage display library, expressing decapeptides (Christian, R.B., et al., 1992, J. Mol. Biol. 227:711-718). The DNA of the library was constructed by use of an oligonucleotide comprising the degenerate codons [NN(G/T)~1o (SEQ ID NO:8) with a self-20 complementary 3' terminus. This sequence forms a hairpin which creates a self-priming replication site that was used by T4 D~A polymerase to generate the complementary strand.
The double-stranded DNA was cleaved at the SfiI sites at the 5' terminus and hairpin for cloning into the fUSE5 vector 25 described by Scott and Smith, supra.
Lenstra, 1992, J. Immunol. Meth. 152:149-157 describes a library that was constructed by annealing oligonucleotides of about 17 or 23 degenerate bases with an 8 nucleotide long palindromic sequence at their 3' ends. This resulted in the 30 expression of random hexa- or octa-peptides as fusion proteins with the ~-galactosidase protein in a bacterial expression vector. The DNA was then converted into a double-stranded form with Klenow DNA polymerase, blunt-end ligated into a vector, and then released as ~ind III fragments.
35 These fragments were then cloned into an expression vector at the sequence encoding the C-terminus of a truncated ~-galactosidase to generate 10' recombinants.

WO 96/30849 PCT/u~5''~1229 Kay et al., 1993, Gene 128:59-65 describes a random 38 - amino acid peptide phage display library.
PCT Publlcation No. WO 94/18318 dated August 18, 19'34 describes random peptide phage display "TSAR librariesl- t:hat 5 can be used.
Other biological peptide libraries which can ~e used include those descri~ed in U.S. Patent No. 5,270,170 dated December 14, 1993 and PCT Publication No. WO 91/19818 da~ed December 26, 1991.
In a specific embodiment, a "peptide-on-plasmid~
library, containing random peptides fused to a DNA binding protein that links the peptides to the plasmids encoding them, can be used (Cull et al., 1992, Proc. Natl. Acad. Sci.
USA 89:1865-1869~.
Another alternative to phage display or chemically synthesized li~raries is a polysome-based library, which is based on the direct in vi tro expression of the peptides of interest by an in vitro translation system (in some instances, coupled to an in vi tro transcription system).
20 These methods rely on polysomes to translate the genomic information ~in this case encoded by an mRNA molecule, :in some instances made in vitro by transcription from syntnetic DNA) (see, e.g., Korman et al., 1982, Proc. Natl. Acad. Sci.
USA ~9:184~-1848). Such in vitro translation-based libraries 25 include but are not limited to those described in PCT
Publication No. WO 91/05058 dated April 18, 1991; and Mattheakis et al., 1994, Proc. Natl. Acad. Sci. USA
91:9022-9026.
Diversity library screening, step 2 of ~ig. 1, 30 determines a few, N, members (compounds~ from one or more libra~-ies and their primary secluences all of which - specifically bind to target molecule 1 in a similar ma~mer.
A structured organic diversity library is a prescription for - the creation of a huge number of related molecules all built 35 from combinations of a small number of chemical building blocks. Preferred diversity libraries for use according to the invention have members whose binding to a target molecule CA 022l6994 l997-09-30 PCIIU~56/01229 is characterized by configurational entropy change that are relatively small to the binding energy. This means that library members have definite structures in the bound and, especially, the unbound states. A preferred example of a 5 chemica] diversity library for use in the invention cont~ins short peptides with a constrained conformation. Short peptides without constrained conformations are often freely flexible in an aqueous environment and adopt no fixed unbound structure. The binding of such library members is 10 complicated by significant configurational entropy changes.
To eliminate this complication, it is preferred that all library members have a constrained structure and bind to the target molecule in a specific and identifiable manner. One method of achieving constrained conformation is to requlre 15 internal linking, such as by disulfide bonds.
In one embodiment, disulfide bond formation is achieved by use of libraries that contain peptides having a pair of invariant cysteine residues, preferably positioned in the range of 2-16 residues apart, most preferably 6-8 residues 20 apart, that cross-link in an oxidizing environment to form cystines (disulfide bonds between cysteines). An example of such li.braries are those containing or expressing peptides of the form RlCX~CR2 wherein Rl is a se~uence of 0-10 amino acids, C is cysteine, Xn is a sequence of n Yariant amino acids 2~ (e.g., if all 20 classical amino acids are represented, X
means any one of the 20 classical amino acids); n is an integer ranging from 2 to 16; and R2 is a sequence of 0--10 amino acids. Rl and R2 can contain invariant or ~ariant amino acids. Another example is such libraries are those 30 containing or expressing peptides of the form R1CXnR2, where R1, X, n, and R2 are as described aboYe; n is preferably 8 or 9. A preferred constrained peptide library, of at least lo6 members, consists of peptides comprising the sequence C'X6C
(SEQ ID NO:1), wherein C is cysteine, X is any naturally 35 occurring amino acid, and a disulfide bond is formed between the two cysteines. Additional in~ariant amino acids (e.g., preferably no more than 5-10 amino acids) on either the WO 96/30849 PCT/U~!i;G,'~, ~229 amino- or carboxy-terminus of CX6C can be incorporatecl as part of the peptide in this preferred embodiment. Fig. 10 schematically illustrates such a molecule. The disulfide bridge between the two cysteines acts as a sufficient 5 conformational constraint for the preferred practice of thi, invention. By way of example, the library is constructed by generating oligonucleotides with the desired degeneracy to code for the peptides and ligating them into vectors of choice. These inserted oligonucleotides are suitable for 10 both use in in vivo genetic expression systems exemplified by phage display, or in vitro-translation methods based on coupled transcription and translation from DNA of interest (see below). The creation and use of an exemplary library is described in Section 6.3 hereinbelow. The invention is 15 easily and readily adaptable to other alternative peptide libraries which include short peptides with alternative disulfide scaffolding, for example, comprising the sequence CX~CXmCC with two disulfide bridges, wherein n and m a.re each .
independently an integer in the range of 2-10, and X is any 20 amino acid. More generally, any peptide library containing members of definite conformation which bind to a target molecule in a specific and identifiable manner may be used.
Further, more general, structurally constrained, organic diversity (e.g., nonpeptide) libraries, can also be used. By 25 way of example, a benzodiazepine library ( see e . g., Bunin et al., 1994, Proc. Natl. Acad. Sci. USA 9}:4708-4712) may be adapted for use.
Constrained libraries that can be used are also known in the art. For example, PCT Publication No. WO 94/18318 dated 30 August 18, 1994 describes semirigid phage display libraries, in which the plurality~of expressed peptides can adopt only a single or a small number of conformations. Examples of such libraries have a pair of invariant cysteine residues positioned in or flanking random residues which, when 35 expressed in an oxidizing environment, are most likely cross-linked by disulfide binds to form cystines. Also disclosed are libraries having a cloverleaf structure by appropriate arrangement of cysteine residues. Also disclosed are libraries with peptides having invariant cysteine and histidine residues positioned within the random residues, or invariant histidines alone within the rando~ residues.
S TSAR-13 and TSAR-14 are exemplary semirigid libraries disclosed therein.
Other conformationally constrained libraries that can be used include but are not limited to those containing modii.ied peptides (e.g., incorporating fluorine, metals, isotopic 10 labels, are phosphorylated, etc.), peptides containing one or more non-naturally occurring amino acids, non-peptide structures, and peptides containing a significant fraction of ~-carboxyglutamic acid.
As stated above, libraries of non-peptides, e.g., lS peptide derivatives (for example, that contain one or more non-naturally occurring amino acids) can also be used. One example of these are peptoid libraries (Simon et al., 1992, Proc. Natl. Acad. Sci. USA 89:9367-9371). Peptoids are polymers o~ non-natural amino acids that have naturally 20 occurring side chains attached not to the alpha carbon but to the backbone amino nitrogen. Since peptoids are not easi.ly degraded by human digestive enzymes, they are advantageously more easily adaptable to drug use. Another example of a library that can be used, in which the amide functionalit:ies 25 in peptides have been permethylated to generate a chemically transformed combinatorial library, is described by Ostresh et al., 1994, Proc. Natl. Acad. Sci. USA 91:11138-11142).
The peptide or peptide portions of members of the libraries that can be screened according to the invention are 30 not limited to cont~; n; n~ the 20 naturally occurring amino acids. In particular, chemically synthesized libraries and polysome based libraries allow the use o~ amino acids in addition to the 20 naturally occurring amino acids (by their inclusion in the precursor pool of amino acids used in 35 library production). In specific embodiments, the libra.ry members contain one or more non-natural or non-classical amino acids or cyclic peptides. Non-classical amino aci.ds WO 96/30849 PCIIUS96/0422g include but are not limited to the D-isomers of the common ~ amino acids, ~-amino isobutyric ac~d, 4-aminobutyric acid, Abu, 2-amino butyric acid; ~-Abu, ~-Ahx, 6-amino hexanoic - acid; Aib, 2-amino isobutyric acid; 3-amino propionic ac:id;
5 ornithine; norleucine; nor~aline, hydroxyproline, sarcosine, citrullir.e, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ~-alanine, designer amino acids such as ~-methyl amino acids, C~-methyl amino aci~s, N~-methyl amino acids, fluoro-amino acids and amino aci~
10 analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
By way of example, the incorporation of non-standard or modiried amino acids into libraries can be done by taking advantage of concurrent development in reassigning the 15 genetic code (Noren et al., 1989, Science 244:182-188;
Benner, 1994, Trend. BioTech. 12:158-163) and the charging o specific tRNAs with the desired amino-acid (Cornish et al., 1994, Proc. Natl. Acad. Sci. USA 91:2910-2914). See also Ibba and Hennecke, 1994, Bio/Technology 12:678-682 20 (particularly Table I), and references cited therein. These pre-charged tRNAs are then utilized in the in vitro translation system to incorporate the non-standard amino acid into the library of choice. The position of incorporation can be either random (~ariant) or defined (in~ariant). The 25 defined case can be chosen to maximize the utility of t:he resulting placement of the non-natural functional group to maximize either binding properties or the ability to perform structural measurements. Similar techni~ues may be used to incorporate non-standard amino acids into the peptides.
In a specific embodiment, an iterative approach to library con~truction can be taken, as structural information o~ the mode of binding to a gi~en target is obtained. For example, information from structural analysis can be used to ~ make libraries with library members cont~; n; ng chemical 35 backbones that match known chemical scaffolds, enhance solubility or membrane permeability, reduce effect of water on structure, and incorporate other physical parameters PCT~S96/04229 suggested ~y structural analysis. use o~ algorithmically optimized library inserts can be used to increase the chances o~ finding binders of interest ( see e . g ., Arkin and Youvan, 1992, ~io/Technology 10:297-300).
In other embodiments, the following can be used to improve library use in both phage and bacterial systems:
production of libraries in bacteria which overproduce the chaperonins GroES and GroEL (Soderlind et al., 1993, Bio/Technology 11:503-507), and production in E. coli strains 10 which prevent degradation in the periplasmic space (Strauch and Beckwith, 1988, Proc. Natl. Acad. Sci. USA 85:1576-1580;
hipinska et al., 1989, J. Bacteriology 171:1574-1584).
Purified cofactors such as GroES and GroEL could also be directly added to an in vitro expression and selection 15 system.

5.3. SCREENING OF DIVERSITY LIBRARIES
Once a suitable diversity library has been construc:ted (or otherwise obtained), the library is screened to identify 20 binders having binding affinity for the target. Screening is done by contacting the diversity library members with the target molecule under conditions conducive to binding and then identifying the member(s) which bind to the target molecule. Screening the libraries can be accomplished by any 25 of a variety of commonly known methods. See, e.g., the following references, which disclose screening of peptide libraries: Parmley and Smith, 1989, Adv. Exp. Med. BioL.
251:215-218; Scott and Smith, 1990, Science 249:386-390;
Fowlkes et al., 1992; BioTechniques 13:422-427; Oldenburg et 30 al., 1992, Proc. Natl. Acad. Sci. USA 89:5393-5397; Yu ~et al., 1994, Cell 76:933-945; Staudt et al., 1988, Science 241:577-580; Bock et al., 1992, Nature 355:564-566; Tuerk et al., 1992, Proc. Natl. Acad. Sci. USA 89:6988-6992; Ellington et al., 1992, Nature 355:850-852; U.S. Patent No. 5,096,815, 35 U.S. Patent No. 5,223,409, and U.S. Patent No. 5,198,346, all to ~adner et al.; Rebar and Pabo, 1993, Science 263:671-673;
and PCT Publication No. WO 94/18318. See also the references PCTIU~ 229 cited in Section 5.2 hereinabove (disclosing libraries) regarding methods for screening.
Screening can be carried out by contacting the library members with an immobilized target molecule and harvesting 5 those library members that bind to the target. Examples cf such screening methods, termed "panning" techniques are described by way of example in Parmley and Smith, 1988, Gene 73:305-318; Fowlkes et al., 1992, BioTechni~ues 13:422-42,~;
PCT Publication No. WO 94/18318; and in references cited 10 hereinabove. In panning methods that can be used to screen the libraries, the target molecule can be immobilized on plates, beads, such as magnetic beads, sepharose, etc., or. on beads used in columns. In particular embodiments, the immobilized target molecule has incorporated an "af~inity 15 tag,~ as described above, which can be used to ef~ect immobilization by attaching the tag's binding partner to the desired solid phase.
In one embodiment, the primary method of selecting from libraries is the use of solid phase plastic affinity capture 20 to immobilize the target molecule prior to its use in the selection (screening) process. This method can be improved upon to increase throughput, selectivity and specificity.
Solid phase plastic supports can be replaced with magnetic particles. In phage-based systems, large beads can be use~, 25 but these are not believed to be suitable, due to steric hindrance, for use in bacterial systems. This steric hindrance can be avoided by using high gradient magnetic cell separation with small particles (~0.5~m) (Miltenyi et a].., 1990, Cytometry 11:231-238).
In a specific embodiment involving the use of a pept:ide phage display library, selection of a binder protein expressed on the surface of a bacteriophage thus selects both the binder protein and the DNA that encodes it (the DNA being within the phage particle). Following binding between t3ne 35 target molecule and library members, phage are released from a solid support on which the binder-target molecule complex is immobilized, and are amplified, e.g., by infecting E. coli and propagating each isolated binding phage. Repeating this process of affinity capture and amplification allows those peptides which bind with the highest a~finity to the target molecule to be selectively enriched from the original, 5 library.
In one particular embodiment, presented by way of example but not limitation, a phage display library can be screened as follows using magnetic beads (see PCT Publication No. wo 9~/18318):
Target molecules are conjugated to magnetic beads, according to the instructions of the manufacturers. The beads are incubated with excess bovine serum albumin (BSA), to block non-specific binding. The beads are then washed with numerous cycles of suspension in phosphate buffered saline (PBS) with 0.05~ Tween~ 20 and recovered by drawing a strong magnet along the sides of a plastic tube.
The beads are then stored under refrigeration, until use.
An aliquot of a library is mixed with a sample of resuspended beads, at 4~C for a time period in the range of 2-2~ hrs. The magnetic beads are then recovered with a strong magnet and the liquid is removed by aspiration. The beads are then washed by resuspension in PBS with 0.05~ Tween~ 20, and then drawing the beads to the tube wall with the magnet. The contents of the tube are ~e...oved and washing is repeated 5-10 additional times. 50 mM
glycine-HCl (pH 2.0), 100 ~g/ml BSA solution is added to the washed beads to denature proteins and release bound phage. After a short incubation, the beads are drawn to the side of the tubes with a strong magnet, and the liquid contents are then transferred to clean tubes. 1 M Tris-HCl (pH 7.5) or 1 M NaH2PO4 (pH 7) is added to the tubes to neutralize the pH of the phage sample. The phage are then diluted, e.g., 10-3 to 10-6, and aliquots PCT~US96/04229 W 096l30849 plated with E. coli DH5~F' cells to determine the number o~ plaque forming units of the sample. In ~ certain cases, the platings are done in the presence of XGal and IPTG for color discrimination - 5 of plaques (i.e., lacZ+ plaques are blue, lacZ-plaques are white). The titer of the input samples is also determined for comparison.
Alternatively, as yet another non-limiting example, screening a diversity library of phage expressing peptides 10 can be achieved by panning using microtiter plates (see PCT
Pu~lication No. WO 94/18318) as follows:
The target molecule is diluted and a small aliquot of target molecule solution is adsorbed onto wells of microtiter plates (e.g. by incubation overnight at 4OC). An aliquot o~ BSA solution (1 mg/ml, in 100 mM NaHCO3, pH 8.5) is added and the plate incubated at room temperature for 1 hr. The contents of the microtiter plate are flicked out and the wells washed carefully with PRS-0.05~
Tween~ 20. The plates are repeatedly washed free of un~ound target molecules. A small aliquot of phage solution is introduced into each well and the wells are incubated at room temperature for 2-24 hrs. The contents of microtiter plates are flicked out and washed repeatedly. The plates are incubated with wash solution in each well for 20 minutes at room temperature to allow bound phage with rapid dissociation constants to be released.
The wells are then washed five more times to remove all unbound phage.
To recover the phage bound to the wells, a pH
change is used. An aliquot of 50 mM glycine-HCl (pH 2.0), 100 ~g/ml BSA solution is added to the washed wells to denature proteins and release bound ~ 35 phage. After 10 minutes at 65~C, the contents are then transferred into clean tubes, and a small aliquot of 1 M Tris-HC~ (pH 7.5) or lM NaH2PO~ (pH

PCT/US~510~9 W~ 96~30849 7) is added to neutralize the pH of the phage sample. The phage are then diluted, e.g., 10-3 to lo-6 and ali~uots plated with E. coli DH5~F~ cells to determine the number of the plaque forming units of the sample. In certain cases, the platings are done in the presence of XGal and IPTG ~or color discrimination of plaques (i. e., lacZ+ plaques are blue, lacZ- plaques are white). The titer of the input samples is also determined for comparison (dilutions are generally 10-6 to 10-9).
By way of another example, diversity libraries expressing peptides as a surface protein of either a part:icle or a host cell, e. g., phage or bacterial cell, can be screened by passing a solution of the library over a colurnn 15 of the target molecule immobilized to a solid matrix, such as sepharose, silica, etc., and recovering those particles or host cells that bind to the column after washing and elution.
In yet another embodiment, screening a library can be performed by using a method comprising a first "enrichment:"
20 step and a second filter lift step as described in PCT
Publication No. WO 94/18318.
Several rounds of serial screening are preferably conducted. In a particularly preferred aspect, each rouncl is varied slightly, e . g., by changing the solid phase on whic:h 25 immobilization occurs, or by changing the method of immobilization on (e.g., by changing the linker to) the solid phase. When using a phage display library, the recovered cells are then preferably plated at a low density to yielcl isolated colonies for individual analysis. By way of 30 example, the following is done: The individual colonies c:re selected, grown and used to inoculate LB culture medium containing ampicillin. After overnight culture at 37~C, the cultures are then spun down by centrifugation. Individual cell aliquots are then retested for binding to the target 35 molecule attached to the beads. Binding to other beads, having attached thereto a non-rele~ant molecule, can be us;ed as a negative control.

CA 022l6994 1997-09-30 PCT/u~6/C1229 In a specific embodiment, different rounds of screen:ing can respectively involve selection against targets in primarily their purified form, and then in their natural state ~e.g., on the surface of a mammalian cell) (see, e.!~.
5 Marks et al., 1993, BiotTechnology 11:1145-1149, describing selection against cell surface blood group antigens).
In other examples, subsequent rounds of screening can involve immobilization of the target molecule by attachment at different ends (e.g. ~ amino or carboxy-terminus) of the 10 target molecule to a solid support, or presentation of library members by attachment to or fusion at different ends of the library members.
By way of other examples of screening methods that can be used, genetic selection methods can be adapted for 1~ screening of libraries, or can be used in a recursive scheme Thus, in a specific aspect, the invention provides screening methods in which methods allowing high throughput and diversity screening ( e . g. ~ screening phage display or polysome libraries against a ligand) are utilized in initial 20 rounds, with subsequent rounds employing a genetic selection technique, in which the presence of a binder of appropriate specificity increases the activity of or activation of a transcriptional promoter or origin of replication. Genetic selection techniques that can be adapted for use (e. g. ~ by 25 inserting random oligonucleotides in the test plasmid) include the two-hybrid system for selecting interacting proteins in yeast, replicative based systems in m~mmA1iar cells, and others (see, e.g., Fields & Song, 1989, Nature 340:246-246; Chien et al., 1991, Proc. Natl. Acad. Sci. IJSA
30 88:9578-9582; Vasavada et al., 1991, Proc. Natl. Acad. Sc:i.
USA 88:10686-10690). Thus, in a specific embodiment, compounds are produced as fusion proteins, and contacted with a different fusion protein comprising a target fused to another molecule, in which specific binding of the fusion 35 proteins to each other results in an increase in acti~it~ or activation of a transcriptional promoter or an origin of replication. In a specific embodiment, a genetic selection PCT/U~ 229 method is used in a later round of screening to either se:Lect directly for a library member that binds to a target molecule, or to select a library member that competitively inhibits binding of a ligand to the target molecule.
Several exemplary methods for screening a phage/phagemid library are presented by way of example in Section 6.4 hereinbelow. An exemplary method for screening a polysome-based library is presented in Section 6.3.3 hereinbelow.
Once binders are selected from a diversity library which 10 bind to a target molecule of interest, additional assays are preferably, although optionally, performed, including but not limited to those described below. Thus, in vivo or i~ viiro assays can be performed to test whether binding of a binder to the target molecuie affects t~e target molecule's 15 biological activity; binders that exert such an effect are preferred for use in subsequent steps of the invention.
Alternatively, or in addition, competitive binding assays can be carried out to test whethel- the binde~ compe~es with ot.her binders or with a natural ligand of the target molecule, for 20 binding to the target molecule; binders that compete with each other, and that compete with the natural ligand, are preferably selected for use in subsequent steps of the invention. Alternatively, or in addition to the above assays, the binding affinity o~ binders for the target 25 molecule is determined, by standard methods, or by way of example, as described in Section 6.5 infra. Binders of tb~e highest affinity are preferred for use in subsequent steps of the invention.
5.4. DETERhlNl~G THE ~UuN~ OR
CHE~ICAL FOR~IULA OF BI~DERS
Many of the references cited in Section 5.2 and 5.3 hereinabove, which disclose library construction and/or screening, also disclose methods that can be used to 35 determine the sequence or chemical formula of binders isolated from such libraries. By way of example, a nucleic acid which expresses a binder can be identified and recovered - 4û -PCrlU~ /0~1229 from a peptide expression library or from a polysome-based library, and then sequenced to determine its nucleotide ; sequence and hence the deduced amino acid sequence that mediates binding. (In an instance wherein the sequence o~ an 5 RNA is desired, cDNA is preferably made and sequenced.) Alternatively, the amino acid sequence of a binder can be determined by direct determination of the amino acid sequence of a peptide selected from a peptide library containing chemically synthesized peptides. In a less preferred aspect, 10 direct amino acid sequencing of a binder selected from a peptide expression library can also be performed.
Nucleotide sequence analysis can be carried out by 2my method known in the art, including but not limited to the method of Maxam and Gilbert (1980, Meth Enzymol. 65:499--15 560), the Sanger dideoxy method (Sanger et al., 1977, Proc.Natl, Acad. Sci. U.S.A. 74:5463), the use of T7 DNA
polymerase (Tabor and Richardson, U.S Patent No. 4,795,699;
SequenaseT~, U.S. Biochemical Corp.), or Taq polymerase, or use of an automated DNA sequenator (e.g., Applied Biosys~ems, 20 Foster City, CA).
Direct determination of the chemical formulas of non-peptide or peptide binders can be carried out by methods well known in the art, including but not limited to mass spectrometry, NMR, infrared analysis, etc.
In preferred aspects involving certain types of libraries well known in the art, sequencing or the use of known analytic techniques for chemical formula determination will not be necessary. In some such libraries, the identity and composition of each member of the library is uniquely 30 specified by a label or "tag" which is physically a~sociated with it and hence the compositions of those members that: bind to a given target are specified directly ( see, e . g., Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926;
Brenner et al., 1992, Proc. Natl. Acad. Sci. USA
- 35 89:5381-5383; Lerner et al., PCT Publication No.
WO 93/20242). In other examples of such libraries, the library members are created by step wise synthesis protocols W O 96~30849 PC~rAUS96/04229 l3C and several lsN nuclei, or vice versa, in one labeled molecule. Multiple la~eling is limited, however, as is obvious to one skilled in the NMR arts, by chemical shi~t.s of the various nuclear resonances. REDOR measurement of 5 multiple lsN-l3C distances requires that each spectroscopically o~served l5N or 13C resonance have a distinguishable chemical shift. If these conditions are not met, several separately labeled versions of the binder are prepared and measured, one for each internuclear distance sought.
Step 42 synthesizes the la~eled binder after a labeling has been determined by applying these pre~erences and rules.
In an em~odiment wherein the binder is a peptide, variously labeled 13C or l5N labeled amino acid reagents for the synthesis of the labeled binder are widely available from 1~ commercial sources. A preferred supplier is Isotec Inc.
(Miamisburg, OH). Other commercial sources include MSD
Isotopes (Montreal, Canada) and Sig~,a Chemical Co. (St.
Louis, MO). Step 42 has three substeps: linear peptide synthesis 43, cyclization 44 (~y forming the disulfide ~ond), 20 and deprotection of the side groups 45. Synthesis and side chain deprotection are performed by solid phase peptide synthesis using standard Boc (tert-butoxycarbonyl) and Fmoc~
(9-fluorenylmethyloxycarbonyl) chemistry. Exemplary referenc~s for this method are Merrifield, J. Amer. Chem.
25 Soc., vol 85, pp 2149 et seq. (1963); Caprino et al., .J.
Amer. Chem. Soc. (1970); and Stewart et al., Solid Phase Pe~tide SYnthesis, Berlin, Springer-Verlag (1984), which are herein incorporated ~y reference. Cyclization is by conventional mild oxidation, well known in the chemical arts.
30 The method of these steps is detailed in Example 2 su~,ra.
To obtain accurate REDOR NMR measurements, the bi.nder s~mple is preferably hi~hly purified. Accordingly, it: is preferable that the sample be at least 90~ pure (but ~lOt necessary if spurious NMR signals can be discriminated), anci 35 e~en more preferable that the sample be at least 95~ pure.
Such pure samples can be obt~;ne~ as follows. In a first synthesis method, the binder peptide is synthesized directly WO 96/31)849 PCT/US96/04229 accompanied by complex record keeping, complex mixtures are screened, and deconvolution methods are used to elucidate which individual members were in the sets that had binding activity, and hence which synthesis steps produced the 5 members and the composition of individual members ( see, e . g., Erb et al., 1994, Proc. Natl. Acad. Sci. USA 91:1I422-114~6).
Step 2 of the invention provides as output N binding library members (binders) and their sequences or chemical formulas.
5.5. CANDIDATE PHARMACOPHORE SELECTION
The prior diversity library screening, step 2, determines a set of size N of speci~ically binding members from one or more diversity libraries. While the binders ~re 15 preferably but not necessarily isolated from one or more diversity libraries (e.g., binders need not be isola~ed from diversity libraries; known binders can be simply provided), the following description shall refer to the preferred embodiment wherein diversity library members are the binders.
20 It will be apparent that the description is also readily applica~le to binders that are not isolated from diversity libraries.
The pharmacophore responsible for the library member binding is preferably determined by an overall select anc 25 test method in this and subsequent steps. In general, a pharmacophore is specified by the precise electronic properties on the surface of the binder that causes bindi.ng to the surface of the target molecule. In the preferred embodiment, these properties are specified by the underl~ring, 30 causative, chemical structures. Chemical ~tructures are specified generally by groups such as -C~2-, -COOH, and -CONH2. The preferred pharmacophore representation consists of a specification of the underlying chemical groups and their geometric relations. The more precisely the geometric 35 relations are specified, the more preferred. In preferred but not limiting aspects, the geometric relations are precise to at least 0.50 A, and most preferably, at least 0.25 A. A

pharmacophore will usually comprise 2 to 4 of such groupc"
with 3 being typical. Howe~er, ~or complex protein recognition targets, a pharmacophore may comprise a grealer number of groups. For example, it is possible that the 5 entire 6 amino acid se~uence, -x6-, may be needed for a member of the preferred CX6C library to bind to complex targets, in which case the pharmacophore includes the entire binder.
Considering by way o~ example, the case of binders isolated from the preferred li~rary, of sequence CX6C, the lo chemical groups defining a peptide pharmacophore are terminal groups on amino acid side chains. Typically, therefore, a sequence of two to four contiguous amino acids will contain the pharmacophore of interest. For example, Fig. 11 illustrates an Arginine-Glycine-Aspartate sequence forming a 15 well known platelet aggregation inhibiting pharmacophore, which is defined by the positions and orientations of the adjacent -CN3~4, -C~H2-, and - COOH groups. Pharmacophores formed by discontiguous amino acids are not likely to occur in the preferred library due to the conformational constraint 20 on the short peptide imposed by the disulfide bridge.
The selection step determines candidate amino acid sequences in each binder that define a candidate pharmacophore by the positions of their terminal groups Candidate selection depends substantially only on the 25 chemical structures of the amino acid side chains and terminal groups (only ~ery rarely on backbone groups).
Geometric structure is not yet available and cannot be used for candidate selection. In the preferred embodiment, amino acids are grouped into homologous groups defined by group 30 members having similar side chain structure and activity (see infra). Candidate pharmacophores are found by searching the sequences of the N binders for short sequences of homologous amin~ ~cids. This search will produce at least one candidate, because all the binders share the actual 35 pharmacophore. Several candidates will usually be found since ~eometric information is ignored, and the search is thereby underdetermined.

WO 96/30849 PCTIU' ,.~ 229 Fig. 2A illustrates an exemplary method of performinc the search ~or homologous sequences. Although this methocl is illustrated as searching for homologous contiguous sequenc:es of length 3, it is easily adaptable to search for homologi.es 5 of other lengths and also for discontiguous homologous sequences. If no candidate pharmacophores of length 3 ha~e a consistent consensus structure, then pharmacophores of length 2, 4, or longer or discontiguous sequences must be searched and selected for test. For some complex targets, the 10 pharmacophore may include the entire variable part of the library member. The exemplary method is a simple depth-first search for matching amino acid strings. More sophisticated string search methods are known and are equally applicable to this invention.
The method begins with the administrative steps 201 and 202 of labeling the binders with integers from 1 to N and assigning the string ~Jariable 'ABC' to the next left most sequence of three amino acids to test in binder 1. If this is the first candidate selection, 'ABC' will be at the left 20 most position in binder 1. If prior candidates have been selected, 'ABC' will be assigned one amino acid to the right of its prior assignment. The ~OR loop, formed by steps 203, 206, and 207, then selects each binder from 2 to N for scanning for a sequence homologous to 'ABC'. Step 203 does 25 loop administration. Step 206 does the sc~nni ng. If homologous sequences are found, test 207 loops back to scan the next binder. If homologous sequences have been found in all binders from 2 to N, the loop exits at step 204. In this case 'ABC' is a string in binder 1 which is homologous to 30 other strings in all r~ ining binders and is thus a candidate pharmacophore. The method exits at 205 for this candidate to be structured and tested for whether it is the actual pharmacophore. If a binder does not have a Requence homologous to 'ABC', then this string is not a candidate. In 35 this case, test 208 determines if 'ABC' is at the right e!nd cf binder 1. If so, there are no more homologies to test for and the method exits at 20~. If not, then 'ABC' is advanced one amino acid to the right 210 and the scan of all ~inders is repeated beginning at 203.
Fig. 2B illustrates how string varia~le 'ABC' is scanned across binder 1, represented schematically by 220. First, S 'ABC' is assigned to X~X2X3 at 221, then to X2X3X4 at 222, to X3X4Xs at Z23, and finally to XgXsX6 at 224.
Given an assignment to 'ABC', step 206 scans each other binder, for example binder K with K~1, for homologous sequences. This is simply done by comparing all contiguous 10 substrings of binder K with 'ABC' to determine if they are homologous. They are homologous if corresponding amino acids in the substring and ~ABC~ are homologous. In turn, two amino acids are homologous if they satisfy established ho~ology rules. Each homologous sequence found in binder K
15 defines a separate candidate pharmacophore, if sequences homologous to 'ABC' are found in all other binders.
In a case where discontiguous homologous sequences are sought, 'ABC' is assigned to amino acids in discontiguous positions in binder l and then compared for homologies to 20 amino acids in the same relative positions throughout the other binders.
Various rules o~ amino acid homology may be used in this invention. In the pre~erred em~odiment, amino acids are homologous if they are found in the same class of aminc~
25 acids, based on side chain activity (see Lehninger, Principles of ~iochemistrv, (1982), chap. 5). Preferrecl homologous groups of amino acids are as follows. The no~polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan .~nd 30 methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged ~basic) amino acids inclii~e arginine, lysine and histidine. The negatively - charged (acidic) amino acids include aspartic acid and 35 glutamic acid. The foregoing classes may be modified by those skilled in chemical arts to create finer classifications. ~or example, phenylalanine and tryptophan WO 96/30849 PCT~US96/04~29 could be placed in a separate aromatic nonpolar group.
Further, homology rules could depend on amino acid sequence, such as by dividing contiguous doublets or triplets of amino acids into homology groups.
The invention is not limited to the above-described exemplary method of selecting candidate pharmacophores. ~ny automatic method of selecting candidates that depends only on chemical structure of binder library members, preferably expressed in terms of building block composition and 10 sequence, can be used. For example, in the case of the preferred CX6C library, candidates could be selected by a clustering analysis performed on the entire amino acid string in a multi-dimensional space.
This above method of selecting candidate pharmacophores lS is not limited to the preferred CX~C diversity library. ]?or example, this method is immed1ately applicable to any diversity library having members comprising building blocks linked by a linear backbone by simply specifying rules of homology appropriate for the building blocks. These homology 20 rules would group building blocks presenting similar structure and reactivity to targets. This method then selects candidates comprising sequences of homologous building blocks present on all the binding library members.
If the library members do not have a linear backbone, a 25 related candidate selection method can be used. In this case, the search for homologous building blocks would need to be confined to adjacent building blocks. Adjacent building blocks in this case are those building bloc~s brought physically close by whatever chemical structures form the 30 library members (instead of simply being l nearly adjacent on a backbone). An adjacency determination would be speci~.ic to the particular chemical structure and would be algorithTnicly spec~fied. In addition appropriate rules of homology would be specified. The method would then select candidates 35 comprising groups of adjacent, homologous building blocks, a group being present on each binding library member.

The above-described step is the selection step of the ~ overall select and test method. Distance measure~ents and Monte Carlo structurin~, steps 4 and 5, determine a consensus pharmacophore structure for the candidate, if possible. If a 5 consensus is found, the candidate is the actual pharmacophore. If a consensus is not found, this selection step must be revisited, and a new candidate selected for test.

5 . 6 . INTRAMOhECULAR DISTANCE MEASUREMENTS
Having obtained N binders, their chemical building block structures (chemical formula or pri~ary sequence), and 1he identification of a candidate pharmacophore in each bin/~er, steps 4 and 5 of the method of this invention cooperatively 15 determine a precise spatial structure for the candidate pharmacophore (if it exists; if not, a new candidate pharmacophore is selected.) In the preferred (but not limiting) embodimen~ of this invention, N members of the CX6c library that specifically bind to the protein target of 20 interest have ~een screened; their sequences determinecl; and a candidate pharmacophore consisting of homologous triplets ~more generally from 2 to 6 mers) of amino acids has been determined in each binder.
Step 4 measures one or more strategic distances, 25 preferably no more than 10-20, e.g., l-10 or, more preferably, 1-5 interatomic distances are measured. The remainder of the structure is determined in su~sequent steps, other than by direct measurement. The interatomic distances measured in step 4 are preferably with an accuracy of at 30 least 2 A, more preferably at least 1 A or 0.5 A or 0.25 A, and most preferably at least 0.05 A. Thus, in a preferred btlt not limiting em~odiment, distances in the pharmacophore are specified to at least approximately 0.25 A. Step 5, ~ using the CCMBC computational method, then completes 3S determination of the pharmacophore structure at a high resolution and the structures of the rest of the binder molecules with a secondary resolution. Ha~ing a high =~

W ~9613~849 PCT/U~ 1229 resolution structure for the pharmacophore of interest is orders of magnitude more useful than having a low resolution s~ructure for an entire binder. Consequently, steps 4 and 5 focus resources on the former pro~lem.
A distance measurement method is preferred for use if it meets eertain conditions, as follows. First, accuracy c,f distance measurements is preferably better than at least 0.25 A for distances on the order of those between amino acicis in a peptide. Second, measurement conditions preferably lO approximate target binding conditions, i.e., are approximately physiologic. ~or example, crystallization, which may induce conformational changes, is preferably avoided. Also, the employed measurement methods preferably allow one binder sample to be ~easured when dry, when lS hydrated and when bound to the target molecule of interest, there~y o~serving the effects of water and conformational changes on binding. Third, the measurement method is preferably quick and inexpensive.
Important advantages are conveyed by these certain 20 conditions. First, as the method of the invention determines high resolution pharmacophore structures, use o~ distances less accurate than the intended results would almost certainly result in decreased resolution. Second, as 1:he CCMBC structure determination method approximates the 25 structural effects of hydration and target bindins, use of accurate distances including the physical effects of hydration or binding helps increase the resolution of the computational results. These distances as used in the CCMBC
method pull the binder structures towards a more accurate 30 representation both of the ~ound, hydrated pharmacophore and also of the rem~n~er of the binder molecule without a computationally burdensome inclusion o~ water molecule!s and without knowledge of the target molecule's structure.
REDOR NMR is the preferred method of distance 35 determination. REDOR is a solid phase NMR technique which c'irectly measures the inter-nuclear dipole-dipole interaction strength between two spin ~ nuclear species, denoted D~ where WO 9~/30~ PCT/U~ 1229 A and B are the two nuclear species measured. The inter-nuclear distance between A and B is simply determined from D~
by the following equation:

D~ = Y ~ (1) where RA~ is the inter-nuclear distance, h is Planck's constant, and ~A~ and ~B are the respective gyromagnetic 10 ratios of nuclei A and B. REDOR is typically accurate to less than 0. 05 A and can generally ~easure distances up to a~out 8 A.
Any two nuclear species obser~able and resolvable ~y NMR
methods and, prefera~ly, adaptable to chemical inclusion in 15 the diversity library members of interest, may be the basis of REDOR measurements. Although the subsequent description is often directed to distance determinations between 13C and ~ N nuclei in members of a preferred library comprising the sequence CX6C, this invention is not so limited. One skilled 20 in the art can readily adapt the method for use in making measurements of other types of molecules (e.g., peptides and nonpeptides); additionally, other nuclear species may be!
used. Other common spin ~ species that can be used include but are not limited to 31p and the halogen 19F.
General references on NMR techniques are Slichter, Princi~les of Maanetic Resonance, Berlin, Springer-Verlag, (1989) and Mehring, Hiah Resolution NMR in Solids, Berlin, Springer-Verlag (1983). REDOR references include Gullion et al., Rotational-echo double-resonance NMR, J. Magn. Res.
30 81:196-200 (1989); Pan et al., Determination of C-N
internuclear distance bv rotational-echo double-resonance NMR
of solids, J. Magn. Res. 90:330-40 (1990); Garbow et a:L., Determination of the molecular conformation of melanostatin usinq 13C, 15N-REDOR NMR spectrosco~y, J. Am. Chem. Soc.
35 115:238-44 (1993), all of which are incorporated herein by reference.

WO 96130849 PCT/Ub...'i.'~ 1229 Other solid phase NMR techniques are applicable but less preferred. These include but are not limited to those disclosed in Kolbert et al., Measurement of internuclear distances by switched anqle s~innina, J. Physical Chemist:ry 5 98:7936 et seq. (1994), and in Raleigh et al., Rotational Resonance NMR, Chemical Physics Letters 146:?1 ( 988). These techniques measure ho~onuclear distances only to 0.5 A
accuracy and are less accurate than REDOR. Liquid phase NMR
techniques of NOE (nuclear overhausser) and COESY
10 (correlation enhanced spectroscopy) can also be used but are less preferred. They require complex interpretation to obtain comparable distance accuracy greater than 0.5 A iIl small molecules with complete rotational freedom.
X-ray crystallography can also be used, although it is 15 much less pre~erred, since crystallization may induce con~ormational changes in the ~inder, and since ~inding to the target molecule may be necessary for crystallization.
In the case of REDOR measurements of the heteronuclear distances between 13c and 1SN, 13C and lsN are introduced 20 ("labeled") at the.positions between which a distance measurement is needed. The preferred embodiment of the invention measures the 1SN NMR resonance. Since nearly all the '5N signal will originate with nuclear labels, very little background signal due to natural abundance nuclei need be 25 accounted for. Alternatively, the 13C resonance may be measured, in which case the natural a~undance backgroun~ is subtracted from the measurements.
Since ~EDOR depends on observing the internuclear dipole-dipole interaction, the binder being measured should 30 be substantially stationary on the time scale of the N~IR
signal. The measurement system preferably ensures thi;
condition. The substrate holding the binder to be measured can ~e~chosen so as to restrain binder motion, or the measured sample may be cooled to restrain motion, or, 35 alternatively, the binder may be bound to its target molecule in order to restrain its motion.

WO 96/30849 PCT/U' ,~ 229 Further details of the REDOR distance measurements will make reference to Fig . 3 . This illustrates the measurement method for one labeling of one binder, which is repeated if the binder requires multiple labelings and also is repeated 5 for each binder. Subsequent description will focus on only one binder.
Step ~1 chooses a binder labeling. Labeling is preferably done to obtain the most information about the pharmacophore consistent with chemical labeling opportunities 10 and available labeled amino acids. Backbone labeling, for example, labels the amide N of one amino acid and one of the backbone C~s of a next adjacent or more distant amino acid.
Backbone labeling is typically done in the backbone in the ~icinity of the candidate pharmacophore. It might also be 15 done away from a candidate pharmacophore to confirm a previously determined structure as described for step 6.
Side chain labeling strategies vary with the chemical opportunities offered by the candidate pharmacophore. If a terminal N is available, an adjacent side chain or backbc,ne C
20 can be labeled. If not, the side chain C and backbone amino N can be labeled. Side chain labeling is preferably on ide chains in the candidate pharmacophore. Preferred labeling in the candidate pharmacophore is either a backbone amino N and a nearby backbone C or a side chain C or, if available, a 25 side chain amino N and an adjacent or nearby side chain C.
In an alternative embodiment, to get the most structural information on the binders, these labelings are designed to select the actual major conformation from known possible conformations. For example, if it is known from preliminary 30 determinations that a binder may exist in one of a few, e!.g.
two, major backbone or side chain folding patterns, the labelings are chosen to distinguish these conformations.
NuclGar pairs labeled for measurement are preferably those - that have significantly different distances in the possible 35 conformations.
Multiple labeling of one ~inder to determine multip].e distances at once is possible, for example, by including one WO 96/30849 PCT/US96/0422g on the substrate to be used in the subsequent NMR
., measurements. In this case particular care is preferably taken with the standard solid phase synthesis steps of Example 2. By way of example, synthesis reagents should be 5 pure, adequate time should be allowed for difrusion of reagents and solvents throughout the interstices of the substrate resin, and between steps, prior reagents should be thoroughly washed from the resin before new reagents applied.
That the purity, reaction time, and washings are adequate is 10 gauged by subsequent analysis. An aliquot of the resulting peptide-resin is taken, the peptide is cleaved (Example 2) and its purity analyzed by mass spectroscopy or high performance li~uid chromatography tHPLC).
In a second synthesis method, the peptide can be 15 synthesized on any convenient solid phase substrate in a standard manner and then clea~ed from the substrate. The peptide is purified by standard methods ( e . g ., HPLC) and then attached to the NMR measurement substrate. The attachment can be done by any methods known in the art, preferably at 20 either the amino- or carboxy-terminus, e.g., by condensation of the free carboxy terminal group on the peptide with an amino labeled resin, with the attachment step preceding deprotection of any side chain carboxy groups on the peptide;
by use of heterofunctional linker groups, etc.
Great care is preferably exercised in forming the binder-substrate used for the REDOR NMR measurements. This invention is also directed to binder-substrates suitable to precise REDOR NMR measurements in the following environmental condition~: dry unbound, hydrated unbound, and bound to its 30 molecular target molecule (e.g., in lyophilized or hydrated forms).
For any binder and any NMR measurement substrate utilized, the substrate should restrain the attached binder sufficiently so that binder motion will not average out the 35 dipole-dipole interactions necessary for the REDOR
measurement. Generally, this requires that the frequency of motion of the binder be less than the frequency of the - ~3 -dipole-dipole interaction being observed, which varies with the nuclear species being observed and the measurement distance. For l3C-l5N observations to 2.5 A the binder motion frequency should be less than approximately 200 Hz; for 5 observations to 5 A, less than approximately 30-5~ Hz; and for observations beyond 5 A, less than approximately down to 10 Hz. The more polar the substrate, such as glass beads or p-MethylBenzhydrilamine ["mBHA"] resin, the more are polar attached binders (such as are many peptides) restrained.
10 Less polar substrates, such as polystyrene resin, provide less restraints for polar binders. In an embodiment wherein a peptide comprising the sequence CX6C is bound to an mB~
resin with an glycine residue serving as a linker to a binding site on the resin, probably no additional steps need 15 be taken for 2.5 A measurements. Additional steps that can be used, if needed, to slow binder motions include cooling the measurement sample to, for exampl~, liquid N2 temperatures (approximately 77 ~K) or binding to a large, relatively immobile target molecule.
Second, the net hinder density is important and typically is adjusted. The substrate preferably has an adjustable number of binder synthesis sites or binding si.tes per unit of substrate surface area. Too high a binder density on the su~strate surface will cause inter-molecular 25 nuclear dipole-dipole interactions to distort the REDOR
distance measurements. To obtain accurate intra-molecular distances, the peptides should be kept sufficiently far ~part so that only intra-molecular nuclear dipole-dipole interactions are significant. Inter-molecular nuclear 30 dipole-dipole interactions are preferably kept less than about 10~ of the intra-molecular interaction. In the case of ~C-5N measurements, this criterium can be monitored by observing l3C-l3C dipolar couplings. As the dipole intera,ction falls off as R-3, keeping adjacent binders apart by more than 35 approximately 2-3 times the distance to be measured is sufficient. For measurements to 5 A, this criterion can be satisfied by keeping binders approximately 10 A or more CA 022l6994 l997-09-30 apart. At a 10 A spacing interfering 13C or l5N signals w:ill not exceed 2.8 hz, which is sufficient attenuation for 30 hz or greater measurements.
In an embodiment wherein the binder is a peptide 5 comprising the sequence CX6C, that is synthesized on an mBHA
resin that is also to serve as the NMR substrate, there i.s an additional upper bound on the peptide density. To preverlt disulfide dimer formation in more than approximately 5~ of peptides, the peptides are preferably kept apart by at least 10 their average size. Dimer formation and incorrect disulfide scaffolds result in unconstrained, flexible peptides of altered structure distorting the REDOR distance determination of the properly conformationally constrained, cyclized bi.nder peptides. A 10 A or more separation will meet this 15 requirement. In this case, more than 95% of the disulfide bonds will result in intended intra-molecular constraints.
This separation may be adjusted based on a determination of actual dimer formation by chromatographic (e.g., HPLC) Ol-mass spectroscopic analysis of the peptide after cleavage 20 from the substrate (see Section 6.6, infra).
NMR instrumental sensitivity places a lower bound OIl binder density. By way of example, for an adequate observed signal to noise ratio using a preferred NMR spectrometer, no less than approximately l018 observed nuclear spins should be 25 present in a 0.1 g sample. This translates to having a binder density of no less than approximately 0.017 mmole,/g (1 mmole = 10-3 mole). For alternative NMR spectrometers with higher field magnets (1H Larmor frequency of 500 mHz), the binder density may be as low as 0.0017 mmole/g.
A third substrate condition to be considered is pore size, which is relevant when measurement of binder bound to a target molecule is desired. In a preferred method of cond~cting such bound measurements, the substrate must h'3ve ~ sufficient pore size so that the target molecules can di:Efuse 35 to all binders on the surface of the substrate and bind to them. For example, folded, moderate sized protein targets of 50 kd are typically roughly spherical with diameters of -approximately 50 A. Preferable substrate pore sizes for use with such moderate sized protein targets are no less than 100-200 A. Excessive pore sizes can result in a too dilute binder that decreases NMR signal intensity. The preferable 5 pore sizes also facilitate high purity peptide synthesis directly onto substrate resins by similarly facilitati~.~g diffusion of reagents and solvents to synthesis sites. Also, binder substrate binding is preferably of such a nature that it will not be disrupted under either dry conditions, c~queous 10 conditions, and conditions suitable to binder-target b:Lnding.
Generally, adequate pore sizes are in the range of lO0--500 A, although this will vary with the size of the target mo].ecule.
Solid phase substrates that can be used include b~lt are not limited to mBHA resins, divinylbenzyl polystyrene resins, 15 and glass beads. All of these substances can be manufactured to have binding sites in the range from 0 to 1.0 mmol/c. In addition, these substrates can be made so as to have th.e following surface areas: for mBHA about lOo m2/g, for polystyrene from 50-lOo m2/g, and for glass from 0.1-lO0 m2/g.
20 These substrates also can be manufactured so as to have a surface binding site density in the range of from o to 1.0 mmol/m2. More generally any microporous material with Ct surface density of binding sites adjustable from 0 to at least l.0 mmol/m2, and preferably with pore sizes in the 25 preferred ranges, can be used. Suppliers of such adjustable resins include Chiron Mimotope Peptide Systems tSan Diego, CA) and Nova Biochem (San Diego, CA).
Peptide binders can be synthesized directly on the surface of the substrates, by way of example as set forlh in 30 Section 6.6 infra, to achieve a purity of preferably at least 90~, more preferably at least 95~. In the case of a peptide comprising the sequence CX6C, the preferred peptide spacing on the substrate is no closer than approximately 10 A, or a peptide density of no greater than one peptide every 100 A2.
35 Peptide synthesis on the preferred resin p-MethylBenzhydrilamine ["mBHA"] with 0.16 mmole/g of peptide binding sites, a surface of 100 m2/g, and a preferable pore PCT/U~ G/0122g size of 100-200 A results in a binder-substrate having stlch a preferable peptide surface density and suitable for accu~.ate REDOR NMR measurements in dry, hydrated, and bound conditions. The total binder density is more than tenfo:Ld 5 above instrumental sensitivity. The glycine linker provides a sufficient spacer from the substrate surface.
Steps 43, 44, and 45 in the preferred embodiment of the invention are carried out by one of a number of commercii~l peptide synthesis sources, such as Chiron Mimotope Peptil~e 10 Systems (San Diego, CA) and Nova BioChem (San Diego, CA).
Methods that can be used in these steps are known in the art.
However, the preferred practice of these steps is detailed in the example in Section 6.6.
The invention thus provides a method of performing solid 15 state NMR, preferably REDOR NMR, measurements of molecules on a solid phase substrate. In one embodiment, the molecule is a compound having conformational degrees of freedom at the temperature of interest that are limited to torsional rotations about bonds between otherwise rigid subunits, the 20 torsional rotations respecting any conformational constraints. The molecule is preferably a peptide, more preferably a peptide of constrained conformation, and is most preferably a peptide having one or more cystines (e.g., comprising the sequence CX6C). In other embodiments, the 25 molecule is a peptide analog or derivative. In a preferred embodiment, the substrate is a solid phase on which the molecule (e.g., peptide) has been synthesized, with a hi.gh degree of purity. In specific embodiments, the REDOR
measurements of the molecule on the substrate can be done in 30 a dry nitrogen atmosphere, under hydrated conditions, and when the molecule is either free or bound to a target. The invention is also directed to a solid phase substrate having a surface to which is attached a population of molecules Ipreferably peptides, peptide derivatives, or peptide 35 analogs), suitable for obtaining REDOR NMR measurements of the molecules. In specific emho~;ments, at least 90~ o:E the population consists of a single molecule (i.e., 90~ pur.ity).

PCT/US96/042'29 WO 961308~9 In a more preferred aspect, 95~ purity is present. Methods of producing such solid phase substrates, as described above, are also provided.
Step 46 REDOR spectroscopy is performed on the 5 strategically labeled, binder peptide-resin sample. Step 46 details include final sample preparation, spectrometer parameters and tuning, and excitation pulse sequence. ',ample preparation can be carried out by standard methods. The binder peptide-substrate sample is dried in N2, and an 10 approximately o.1 g amount is sealed in the NMR measurement rotor. The rotor can be cooled, if necessary, to limit binder motion.
An alternative final sample preparation step is to bind the target molecule to the binder peptide-resin sample and 15 then dry the complex in N2. Optionally, the binder peptide can be split from the resin before binding to the target. In this alternative, the highly accurate REDOR NMR distances are of the bound binder and thus refle~t any conformational changes that occur upon binding with the target.
A triple resonance, ma~ic angle spinning ["MASn] NMR
machine is adaptable to REDOR measurements. Such machines are commercially available ~rom Bruker (Billerica, MA), Chemmagnetics (Fort Collins, CO), and Varian (Palo Alto, CA).
An exemplary machine suitable for use is in the laboratory of 25 Prof. Zax, Cornell Uni~ersity (Ithaca, NY). This machine includes a 7.05 Telsa magnet from Oxford Instruments (Oxford, United Kingdom) and RF pulse excitation and receiving hardware conventional in the NMR art. An exemplary measurement rotor is a triple resonance, MAS probe from 30 Chemmagnetics.
The exemplary magnetic field is adjusted for a lH Larmor frequency of 300 Mhz with, corresponding Larmor frequencies for 13C and 15N of 75.4 and 30.4 Mhz, respectively. An exemplary probe spin frequency (~r) iS 4 . 8 kHz ~ with 35 corresponding rotor period (Tr) of 0. 208 msec. 15N resonances are measured. The low natural abtln~nce of ~5N eliminates the need for natural background corrections. Alternatively, 13C

W 096/30849 PCTrUS96/04229 measurements can be done with conventional background corrections.
REDOR is a pulse NMR technique requiring careful excitation o appropriate iH, l3C, and ~5N resonances 5 synchronous with the MAS rotor and followed by observation of the lsN free induction decay. Many alternati~e REDOR
excitation sequences have been described in the literature, some of which are found in the references cited hereinabo~e.
These sequences can involve multiple 13C excitations per rotor 10 period. The simple pulse sequence preferred for use in this invention requires only one 13C excitation per period.
The exemplary sequence for 8 rotor periods is illustrated in Fig. 4, and is detailed herein in a manner such that those skilled in the NMR arts can program an NMR
15 spectrometer for similar measurement. Three channels excited are the 'H channel 50, the 13C channel 51, and l5N channel 52.
The 13C and l5N RF power supplies are tuned to the resonances of the nuclei whose distance is to be measured. The lH
channel RF power is initially tuned to the resonance of a 20 proton coupled to tAe 15N of interest. The time sequence, (increasing to the right) of the exciting signals tincreasing vertically) in each of these channels is illustrated.
In the l~N channel, an initial excitation is applied to the l5N spins in either of two manners: either an initial ~/2 25 pulse may ~e applied or, as illustrated and preferred, a cross polarization transfer from the protons is made.
Sufficient RF intensity is applied at time 54 in both the lH
and 15N channels, 50 and 51 respectively, to achieve a Hartman-~ahn precession match at a ~ spin flip time of 13.2 30 ~sec. Subsequent to the initial ~5N excitation, synchronous ~
pulses 56 are applied in phase with the MAS probe rotor for Nc rotor cycles, denoted by line 59, with sufficient RF
intensity to achieve a ~ spin flip time of 13.2 ~sec. I'he phase of these ~ pulses is varied systematically to redu!ce 35 artifacts in a manner well known in the NMR arts. The preferred sequencing is detailed in Table 1.

CA 022l6994 l997-09-30 WO 96130849 PCTIUS96/04,!29 Table l l5N ~ Pulse Phase Sequencing Number of rotor cycles Phase sequence between excitation and (in processing frame) 5observation The phase sequence is expressed as the axis, in the frame processing with the l5N spins, about which the ~ spin f].ip is made. This axis is systematically varied depending on the number of rotor periods intervening between the lsN excitation 15 and signal observation. The illustrated phase sequences may be varied into equivalent sequences in a conventional manner.
For example, "XYXY" is equivalent to "-YX-YX". Finally, at 501 the free induction decay of the l~N spins is observed and generates the time domain output signal.
In the ~H channel, the preferred sequence is an initial exciting ~/2 pulse 53 followed with the previously described cross polarization transfer 5~ to the l~N spins. The less preferred sequence omits these initial pulses in favor of a ~/2 lsN excitation. During the subsequent spin evolution time 25 for Nc rotor cycles and the free induction decay time 50l, a decoupling field 55 is applied to the protons. The preferred decoupling field has a 66 kHz RF intensity to achieve a lH
spin flip in 7.6 ~sec.
In the l3C channel, two distinct options must be 30 measured. The first option (not illustrated) has no 13C' exciting pulses. The second option ~illustrated) has synchronous ~ pulses 57 applied for Nc rotor cycles at 1he rotor frequency but with a fixed phase delay 58, denoted by tl, and at sufficient signal intensity sufficient to achieve a 35 ~ spin flip time of lO.6 ~sec. Any value of tl may be 1~sed;
the preferred value is l/2 the rotor period, Tr/2.

CA 02216994 1997-09-~0 W 096/30849 PCT/U~G~'~1229 Alternative REDOR pulse sequences include 2 or more l3C pulses per rotor cycle.
Summarizing still with reference to Fig. 4, a REDOR
measurement scan is characterized by the nurnber of rotor 5 cycles, Nc, of spin evolution. A complete scan comprises, first, an e~uili~ration period, preceding the illustrated pulse sequences. Second, there is a l5N excitation period co~prising pulses 53 and 54. Third, there is a spin evolution period for Nc rotor cycles which has two options, 10 ~oth measured. Roth options co~prise the application of decoupling lH field ~5 and synchronous in phase 15N ~ pulses 56. The first option has no l3C excitation; the second has synchronous phase displaced 13C ~ pulses 57. Fourth, and finally, there is observation o~ free induction decay 50:L o' 15 the l5N spins. Fig. 4 illustrates an Nc of 8. Each scan option is repeated, and the induction decay signal accumulated, for a suf~icient nu~ber of times to obtain acceptable signal to noise ratio. With the preferred practice, this has required less than approximately 5,000 20 scans, and typically 3000 have been sufficient.
An alternative implementation of the RED~R measurement interchanges the roles of 13C and 15N and measures the free induction decay of 13C. ~urther, the invention is not limited to this described pulse sequen~e and is adaptable to 25 equivalent pulse sequences yielding direct inter-nuclea:r dipole-dipole interaction strengths.
Following REDOR measurement step 46, is data analysis step 47. This comprises several substeps. As is conventional, the free induction decay signal is Fourier 30 transformed from the time domain to the.frequency domain.
The scan option without the 13C excitation produces a - trans~ormed signal with an observed 15N resonance peak of magritude S; the scan option with 13C excitation produces an observed 15N resonance peak o~ magnitude Sf. The REDOR output 35 signal, denoted ~S/S, is conventionally formed accordi~g to the equation:

WO 96/30849 PCTJUS96/042'29 ~S = (5 - Sf) (2) S S

The output signal is observed for different Nc. Preferably 0, 5 2, ~, and 8 rotor cycles are observed. Other preferred Nc will be apparent during the following description.
Further analysis of the REDOR output signal, ~S/S, is made clearer by a very brief explanation of how this OlltpUt signal represents the spin 1/2 dipole-dipole interaction 10 between the 13C and 15N. In the spin evolution period, the decoupling excitation eliminates all proton effects from the 13C and l5N NMR spectra. Magic angle spinning, in the scan option without any 13C excitation, eliminates all nuclear dipole-dipole and chemical shift anisotropy from the NMR
15 line. Thus signal S represents an NMR resonance withollt any dipole interaction. However, in the second scan optio:n, the 13C ~ spin flip pulses reintroduce in a controlled manner the dipole-dipole interaction. This interaction causes additional dephasing, or loss of signal strength, in the 20 observed l5N signal. Thus signal Sf represents an NMR
resonance with dipole interaction and the output signal ~S/S
represents the percentage strength of pure dipole-dipole interaction between the 13C and l5N nuclei. The exact l.oss of signal strength depends on the timing of the 13~ pulses and 25 the number of rotor cycles for which they are applied.
In the alternative where a general phase delay, t1, is used, the expression for the REDOR signal is derived by numerically integrating the following equations from the Pan et al. reference (1990, J. Magnetic Resonance 90:330-340):

22~
Sf = 1- 21 JJcos [Tr~/ (a, ~, tl) ] sin~d~d~ (3) o o 35 where CA 022l6994 l997-09-30 W096l30849 PCT/Ub,.'~229 (a,~,t) = +2DcN[sin2(~)cos2(a+~t) - ~sin2~cos(~+~rt]
t, ~ (4) ~D(~ tl) = T [J~D(a,~,t)dt - ~D(a,~,t~)dt/]
_ . .

This integration can be done by standard numer_cal integration techniques such as are found in Pres~ et al., 10 Numerical recipes: the art of scientific comPuting, Cambridge, U.K., Cambridge University Press, (1986), chapter 4, which is herein incorp~rated by reference. Alternatively the expression can be directly evaluated from the symbolic representations by numerical tools such as Mathematica from 15 Wolfram Research Inc. (Champaign, IL) or Mathcad from Mathsoft Inc. (Cambridge, MA). In a preferred embodiment, however, a much simpler approach is used.
In the preferred embodiment, the 13C pulse phase delay is l/2 the rotor period, Tr~ and the preceding equations can be 20 simply expressed (Mueller et al., 1995, J. Magnetic Resonance, in press):

S 1 - [Jo(~)A] + 2k~ 16k2-l~k~A~] (S) A = NcTrDcN

where Jk iS a Bessel function of the first kind. Adequate accuracy is obtained by limiting the summation of equat:ion 5 30 to its first five terms. ~ig. S is a graph of this e~lation.
~ertical axis 61 represents AS/S; horizontal axis 62 represents A; and graph 63 represents equation S.
In detail, step 47 of Fig. 3 uses equation 5 and t:he ~ REDOR output signal, ~S/S, for various values of Nc to obtain 35 a best value for D~, the dipole interaction strength. The internuclear distance is simply and directly determine~ from D~ by equation 1. An exemplary method for finding the best WO 96130849 PCT/US96/042'29 value of D~ is to use a least squares method. First, form the sum of the squares of the differences of the observecl ~S/S and ~S/S computed from equation 5, which will be a function of D~, Tr~ and Nc through ~. Second, find the value 5 D~ minimizing this function by searching exhaustively in sufficiently small increments over the relevant range. ~or example, D~ can be varied by varying R in 0.01 A increments from 0.5 to 8 A. More efficient minimization methods as presented in Press et al. chapter 10 can also be used.
10 Values of the Bessel functions can be simply calculated by the methods in Press et al, supra, 6.4. Alternatively, this minimization and best value determination is easily performed directly from the symbolic representations with the previously cited mathematical packages.
The example in Section 6.6 provides typical results of this measurement and analysis method.
This completes the method of Fig. 3 and determines t;he internuclear distance between the 13C and 1sN nuclei to which the excitation channels were tuned for the REDOR NMR
20 measurements. If other C-N pair distances are to be determined in the labeled binder, step 46 as detailed above is repeated for the other distinct resonances. If the alternative 1sN resonances cannot be distinguished, separ,~tely labeled binders are prepared and measured.
5.7. CONS~uS, CONFIGURATIONAL BIAS MONTE CARLO
Broad overview With reference to Fig. 1, having found N specifical:Ly binding members of one or more libraries, step 2, selected a 30 candidate pharmacophore shared by all these binders, step 3, and determined a few strategic distances in the vicinity of the candidate pharmacophore, step 4, precise pharmacopho:re and binder peptide structures are now determined by the preferred method, the consensus, configurational bias Monte 35 Carlo method. Other orderings and identities of these s~eps are possible. For example, the binders may be predetermined thereby rendering step 2 unnecessary. Further, no strat(_gic PCTlU:,~5/0~t229 distance measurements may need to be made, and step 4 may be omitted. Alternatively, a partial structure determination step may be inserted before step 4 to guide selection of distances for measurement.
Pharmacophore structure determination of this invention is not limited to the CCBMC method to be described. CCME~C
makes the most efficient use of heuristic consensus bindi.ng and partial distance measurement information. However, the consensus pharmacophore can be determined by methods 10 including but not limited to use of exhaustive REDOR NMR
measurements or by extensive but fewer REDOR measurements in conjunction with a conventional molecular structure determination method, such as molecular dynamics, conventional Monte Carlo, or even peptide folding rules.
In the following description, the CCBMC method is broadly overviewed; subsequently, details of important steps are described; and finally a description of the preferre~
computer method and apparatus for practicing the invention is given. From the description of the methods, equations, data 20 structures, and programs provided herein, one will be ab:Le readily to translate them into implementations.
Although the following descriptions are directed to binders isolated from the preferred library of peptides comprising the sequence CX6C (constrained by disulfide bonds), 25 the method is applicable to more general organic diversity library members. It is immediately applicable to compounds from constrained peptide libraries with other scaffolds and also to compounds from similar peptoid libraries. It will be readily apparent that the method is applicable to any 30 compounds whose structural region of interest exhibits conformational degrees of freedom at a temperature of interest (e.g., body temperature -- 37~C) that are limited to torsional rotations of rigid molecular subunits about bonds between the subunits, in which any loops present in the 35 structural region of interest are independently rotatable by concerted rotation (see Section 7. Appendix: Concerted Rotation). Examples of such compounds include but are not PCT/US96/04;22g W096l30849 limited to peptides, peptoids, peptide deriv~tives, peptide analogs, etc., including members of libraries discussed in Section 5.2, supra.
General features of Monte Carlo simulation methods are 5 known. A reference is Rowley, Statistical mechanics for thermoPhysical ~roDertY calculations, Englewood Cliffs, N.J., PTR Prentice Hall (1994), especially chapters 5 and 7, which is herein incorporated by reference. The application of simple Monte Carlo to constrained peptides has conventionally 10 been hindered by difficulty generating geometrically proper and energetically useful conformational alterations, and by the consequent wasteful and inefficient exploration of conformational space. This method overcomes these pro.blems for constrained peptides with a novel combination of 15 techniques. In addition, this method is uniquely able to incorporate partial information about binding affinities and dista~ce measurements to improve determination of the pharmacophore structure, one goal of the invention.
Fig. 8 is a overview of the method. Step 91 represents 20 the initial geometric and chemical structure of each b nding peptide in computer memory. Peptide geometric structure is represented as a set of records, each record representi.ng one rigid subunit or one atom of the peptide. The subunit records are linked together as the subunits are linked in the 25 peptide molecule. Each rigid unit record includes fields for the composition, structure, and connectivity of the rigid unit represented. Since the rigid units only undergo torsional rotations about mutual bonds, their internal geometric structure is fixed.
If a previous run with these peptides has been done, peptide initial structure may be chosen as one of the structures generated late in that run. Such an initial structure is desirable since the effects of arbitrary initial conditions have been eliminated. Alternatively, an initial 35 structure is generated from a prototypical backbone without side chains by adding siderhA- n~ with random torsional orientations. For members of each type of diversity library, WO g~'3~_ t9 a prototypical backbone meeting structural constraints ancl representing an allowed configuration for a member possessinc no side chains can be defined. The prototypical backbone for the Cx6c library is generated from the CCBMC model itself as 5 run for the linear peptide C(gly) 6C (SEQ ID NO:7) using a Hamiltonian consisting only on the H~ term. The H~ term contains only terms which, in the disulfide bond backbone region -Cl-S~-S2-C2-, limit the Sl-S2 distance to 2.038 A and both the C,-S2 and the S1-C2 distances to 2.883 A. When run 10 for a linear peptide, no Type II backbone moves are made.
Only Type I backbone moves which remove and regrow randomly selected portions of the backbone are used to generate backbone alterations. The model is run with temperatures gradually decreasing from room temperature to a small 15 temperature, approximately l ~K. The final low temperature structure is used for the prototyptical backbone. Backbones for similar constrained peptide libraries can be construct:ed in similar manners.
In memory, for each peptide, a current structure is 20 represented; the initial current structures being the just:
assigned initial structures. Also in memory is represented a proposed modified structure for one peptide. At step 92 t:he processor generates "moves" that transform the current structure of a randomly chosen peptide into a proposed 25 modified structure. The moves mimic body temperature (37 ~C) thermal agitation experienced by the binders so that their equilibrium structure may be determined.
Generation of these moves for conformationally constrained peptides is an important aspect of this method.
30 There are two move types. Type I mo~es alter the conformation of the side chain of a randomly chosen amino acid of the randomly chosen peptide. The alteration is bllilt by side chain ~e---o~l followed by side chain regrowth into a new torsional conformation. During regrowth, unfavorable 35 o~erlap with neighboring side c~; n.C iS a~oided. Type II
mo~es alter the conformation of a limited random region o:E
the peptide backbone of a randomly chosen binder by CA 022l6994 l997-09-30 WO 96/30849 PCT/U:~GI'~ "79 performing linked, or '~concerted", rotations, the linking being such that only four backbone rigid units are spatially displaced. Thereby the internally bonded ring of 8 amino acids will not ~e disrupted. A reference describing a 5 similar move in linear alkane molecules is Dodd et al., A
concerted rotation alqorithm for atomistic Monte Carlo simulation of polvmer melts and ~lasses, Molecular Phys., vo:L
78, pp 961 et seq. tl991), which is herein incorporated by reference. The ratio between the Types I and II moves is an 10 adjustable parameter with a preferred value of 4.
Another important aspect of this method is that both moves are selected in a "configurationally biased" mamler.
Normal Monte Carlo methods use standard Metropolis procedures, in which each proposed structure is generat:ed 15 randomly and independently of the current structure wit:h an equal a priori probability. However, for complex molecules, it is known that this typically results in the generation of many highly improbable or energetically unlikely struct:ures.
In some situations up to 105 wasted moves are generated for 20 each useful move, a very considerable waste of processor resources. In contrast, the method of this invention generates proposed structures according to an a priori probability depending on the current structure and the energetic cost of the new structure. This bias toward more 25 acceptable structures of lower energy avoids generatinq highly improbable structures, making a very much more efficient use of processor resources. Because detailecl balance must be satisfied, the acceptance probability of the configurationally biased method must include factors in 30 addition to the usual Boltzman factor. A reference applying a similar method for simple linear A~ k~nes is Smit et al., Com~uter simulations of the enerqetics and sitinq of n-alkanes in zeolites, J. Phys. Chem. vol 98, pp 8442 et seq.
(1994), which is herein incorporated by reference.
At Step 93 the processor evaluates the energy, or ~amiltonian, of the proposed configuration. The Hamiltonian contains two groups of terms: conventional physical energy PCrIU~35~ 229 terms, and heuristic constraint terms. Conventional terms include the energies of rigid unit torsional rotations and of Lenard-Jones, electrostatic interactions, and H-bonding between atoms in different rigid units. Bond lengths and 5 angles are assumed fixed at the temperature of interest and their energies constant. These conventional interactions are exclusively intramolecular; no physical intermolecular interaction effects are considered in this inve~tion.
References for the conventional energies are Weiner et al., 10 An all atom force field for simulations of ~roteins and nucleic acids, J. of Computational Chem., 7:230-52 (1986);
and Weiner et al., A new force field for molecular simulation of nucleic acids and ~roteins, J. Amer. Chem. Soc. 106:765 (1984) (herein referred to as the "AMBER references"), which 15 are herein incorporated by reference.
Another important aspect of the Monte Carlo method of this invention is the heuristic terms: the consensus term and the measurement constraint term. They uniquely make use of partial information on the binder peptides to guide the Monte 20 Carlo simulation. The consensus term, ~ c, is added to the Hamiltonian to represent that all the binders do in fact bind to the same protein target in the same physical and chemical manner. Since binding occurs at the shared candidate pharmacophore in each binder, this term makes 25 energetically unfavorable moves that cause the geometric structure in the shared pharmacophore to depart from an average, common structure. Pseudo chemical "bonds" to this average structure are added which mimic the actual physical bonding to the surface groups of the protein target. If the 30 candidate pharmacophore is in fact the actual pharmacophore, this energy will become m;n;m; zed and small in the eguilibrium configuration, since there will be an actual, shared, geometric configuration. If the candidate ~ pharmacophore is not the actual one, this term will not 35 become m;n;m;zed or small, as there is no physical reason for this region of the peptide molecules to share a ro~
structure. This is the only Hamiltonian term which couples W0 96130849 PCT/US96~04,'29 the N binders togetheri no physical intermolecular effects are considered. The binders are otherwise treated independently by the method.
The measurement constraint term, H~, is added to 5 represent the distance measurements made, which are in fact actual distances in the molecules and constrain any simulate~l structure. This term makes energetically unfavorable, by adding pseudo chemical bonds of the measured lensths, rnoves that cause the constrained internuclear distance to depart 10 from their measured values. Of course if no partial d:istance measurements have been made or are otherwise available, this term may simply be omitted from the Hamiltonian without:
adversely affecting the practice of this step. Which measurements to make, if any, is guided by the results of the 1~ consensus structure determined. If an adequate structure car be obtained without assistance of distance measurements, none need be incorporated. If inade~uate results are obtained, additional iterations of the method will need distance measurement inputs.
Step 94 tests the Froposed structure against an acceptance probability, accept(curr-~prop). This acceptance probability is determined by the energy of the proposed structure previously computed in step 93. If the proposed structure fails this test and is not accepted, the method 25 progresses immediately to step 96. If the proposed structure meets the test and is accepted, the accepted proposed structure replaces and becomes the current structure. The proposed structure of this peptide is also saved (given certain other conditions detailed later) in a separate memory 30 store of structures for later analysis. This structure! store is preferably on disk.
Repeated application of the concerted rotation may lead to a slightly imperfect structure, due to numerical pre!cision errors. In an alternative embodiment, peptide geometry would 35 be restored to an ideal state ~y application of the R~rl~o~
Tweek algorithm after several thousand moves (Shenkin et al., 1987, Biopolymers 26:2053-85).

WO 96/30849 PCT/U~ 4;!29 Step 96 tests whether enough structures of equilibrated total energy have been generated in this simulation run. The run terminates if a sufficient number have been generaied.
Sufficiency is determined on the basis of whether the 5 statistical sampling errors of the average pharmacopho~e structure determined at step 97 is adequate (typically,, less than 0.25 A). Preferably, 25,000 equilibrated structu~es would be accumulated for each run. Also, preferably, t:hree runs would be performed for a total of 75,000 saved 10 structures.
Fig. 9 illustrates energy equilibration of an actual run. Axis lO1 is the total energy of a set of peptide binders; axis 102 is the number of moves accepted. Trac:es 103 represent total energies of all binders from each of the 15 three runs. Typically, run energy rapidly e~uilibratec;
within less than approximately 2000 moves in most cases.
Subsequent saved structures are counted toward terminat:ion.
Traces 103 display typical energy variations superimposed on a secular stability. The illustrated energy variations 20 typically comprise several comp~nents having different variabilities. First, there is a very high frequency oscillation with a period of a few tens of moves (known as "hair~'). Second, there is a low frequency oscillation with a period of several hundred to a few thousand moves and with 25 low amplitude.
Step 97 analyzes the structure stored in memory. In the simplest preferred embodiment, the stored geometric structures for each binder are simply averaged, ~ielding a final structure for each binder and for the candidate 30 pharmacophore. In another alternative, clustering software seeks clusters of similar structures for each ~inder. The clusters are then averaged to give a final structure for eacA
~ari~nt structure for each binder. The variants represent alternative foldings for the binder. Exemplary clustering ~ 35 methods are found in Gordon-et al. Fuzz~ cluster analysis of molecular dynamics traiectories, Proteins: Structure, Function and Genetics 14:249-264 (1992).

-PCTIUS96/042:29 WO 9~'3C8,~5 Alternative post-processing can be done on the clustered structures to account for small bond angle vibrations. Such vibrations are expected to make small perturbations to the clustered structures determlned by the Monte Carlo method and 5 can be accounted for by a brief molecular dynamics simulation. Such a simulation is fully defined by the Hamiltonian, comprising the physical and heuristic energies to be described infra in Eqn. 8, and by the temperature of interest. The structures observed during the simulation are 10 averaged to determine a final more accurate equilibrium structure. A code capable of performing such a simulation is Discover~ from BIOSYM (San Diego, CA). Preferably, the molecular dynamics simulation would be run for approximately 105 bond angle vibration periods. Since the typical bond 15 angle ~ibration period is 10-2 ps (1 ps = lo-12 sec.), such a run will encompass approximately 1 ns of molecular time.

Confiaurational bias move qeneration details One Type I or I I move will, in general, alter the 20 position of several.rigid units on a side chain or along the backbone. Each altered rigid unit is sequentially cons:idered during move generation. The Hamiltonian describing the energy of the rigid unit currently being considered in a move is divided into an internal, uint, and an external, u~Xt~ part, 25 where u'X' is all energy not included in uint. In the preferred embodiment, uint is set to 0; an alternative choice woulcL be to include only the torsional interaction energy between this rigid unit and units to which it is currently bound. uint generates a probability distribution, pint, according to which 30 is generated a set, ~k ~ k = l...K, of candidate torsional angles for the bond between the rigid unit being eY~m;ned and rigid units already e~mi n~ . UeXt generates another probability distribution, pext, according to which is selected one torsional angle from the prior set as the proposed ~lew 35 angle for the rigid unit being ~mi ned. These probabilities are defined by the ec~uations:

WO 96/30849 PCr/U~3~/l)q~'29 p int (~ ) ~exp[-~u, (~i,k) ]

P ( ~ i k ) = p [ ~3 U _ ( <~) - k ) ] ( 6 ) K
~Tiex t = ~ Pi ( ~P i k ) k=l In this equation, "," signifies the rigid unit being considered, K is the total number Gf candidate torsional angles generated by pint~ and ~ = 1/kT (k is Boltzman's constant; T the temperature, preferably 37 ~C). The overall probability of generating a transition from th_ current: to the proposed structures and accepting the proposed structure are given by the equations:

P ( cUrI--Pr~P) ~rI pilnt (~i k) PieX ('~

h7 neb =II W ext a ccep t ( CUI I - pI Op) =min(1; h l d ) In this equation, M is the total number.of rigid units added in the move. W~ld is a weight for the reverse move and will be described subsequently.
Because energy is included in the generation probabilities, proposed structures are preferentially of lower energy. Since the acceptance of proposed structures depends on their energies, the acceptance of proposed structures is thereby more probable.

WO 9r '3 ~ E ~5 PCT/US96/04229 Pe~tide memorv rePresentation details It is well known that at body temperature peptides consist of linked rigid units capable only of torsiona.l rotational about mutual bonds whose lengths and angles are 5 fixed. The torsional rotations respect any molecular conformational constraints. See Cantor et al., Bio~h~sical chemistrv ~art I the conformation of bioloqical ma~romolecules, New York, W.H. Freeman and Co. (1980), which is herein incorporated by reference. Table 2 lists th.e rigid 10 units encountered in the preferred embodiment of this invention utilizing libraries of conformationally constrained peptides. Table 2, where applicable, also lists dihed.ral bond angles between incoming and outgoing bonds to a rigid unit and the assigned unit type.
Table 2 Type Chemical Bond angle Structure (if applicable) Backbone and side chain rigid units B 1 70.5~
-C~H-C -CONH- 70.5~
D -COOH

Side chain only rigid units E -CH2- 70.5~
F 1 70.5~
-CH-G -S- 70.5~
H -C6H4- 0~

J -OH
K -SH

WO 96/30849 PCT/US96/04:!29 Type Chemical Bond angle Structure (if applicable) M -C6Hs o -CN3H4 p - C3N2H3 Q - CeNH6 Table 3 illustrates the decomposition of all amino acid side chains into rigid units. Glycine is a special case, w:ithout a side chain. Proline is a special case with a side cnain cyclically bonded to the backbone amino N.

CA 022l6994 1997-09-30 wos6l3o8~s PCT~S96Jo4:~29 Table 3 ,.
Amino Acid Rigid Units Glycine -C~H2- (SPECIAL CASE) Alanine -CH3 Arginine -CH2-CH2-CH2-CN3Hs Aspartate -CH2-COOH
Asparagine -CH2-cONH2 Cysteine -CH2-SH
Glutamate -CH2-CH2-COOH
Histidine -CH2-C3N2H3 Isoleucine -CH(-CH3)-CH,-CH3 Leucine -CH2-CH(-CH3) 2 -CH2-CH2-CH2-cH2-NH2 Lysine -c~2-cH2-s-cH3 Methionine Phenylalanine -CH2-C~Hs Serine -CH2-OH
Threonine -CH(-CH3)-OH
Tryptophan -CH2-C8NH6 Valine -CH(-CH3)-CH3 Tyrosine -CH2-C6H4-OH
Fig. 10 illustrates a structurally correct but geometrically inaccurate decomposition of the peptide backbone CX6C into rigid units (inessential hydrogens hi~ve 30 been omitted). Rigid units are set off in boxes 121 and their types 122 are indicated. Fig 11 illustrates a structurally correct but geometrically inaccurate decomposition of the peptide backbone and side ch~; nc Of -arginine-glycine-aspartate- ("RGD") into rigid units. Rigid 35 units are set off in bôxes 131 and their types 132 are indicated.

WO 96/30849 PCI-/US96/042.29 Rigid units are represented as records in memory. The data structure for a peptide comprises records for its constituent rigid units linked together by data pointers exactly as the actual rigid units in the peptide are 5 chemically linked. The record representing a rigid unit comprises fields for: type of the unit, pointers to chemically bonded units, all atoms of the unit and their spatial positions, atoms of the unit that are the target of the incoming and outgoing ~onds, amino acid to which the unit 10 belongs, and atomic composition of the unit.
A known, conventional representation of atoms and atomic intera~tions is tau~ht by the AMBER references. Each (~tom i, divided into a series of subtypes of specific properties.
For example, for carbon there are subtypes C, C2, CA, t_T, 15 etc.; for nitrogen, there are N, N2, etc.; for oxygen, there are o, 02, etc.; and for hydrogen, there are H, H2, etc.
Bonds between each pair of subtypes are separately characterized by equilibrium lengths, angles, and tors:ional energies. Interactions between each pair of subtype al:oms 20 are separately characterized by Lenard-Jones force parameters, hydrogen bonding force parameters, and electrostatic charges. Amino acid charge distributions are in Weiner et al., J. of Computational Chem., 7:230-52 (1986).
Thus each atom in each rigid unit is represented by an in-memory record comprising fields for: its AMBER reference subtype and any electrostatic charge. The atom's spatLal position relative to its containing rigid unit, stored in that unit's record, is geometrically determined from the 30 unit's internal chemical structure and bonds by the A~3ER
bond lengths and angles defined for each of these bonds. The - relative spatial positions of atoms within a rigid unit: are, of course, fixed, and there is no interaction energy tc~
consider between atoms within a rigid unit.
Fig. 11 is a complete memory representation of a tripeptide sequence -RGD- (a known pharmacophore). Ric~id units are set off in boxes 131 and their types 132 are WO 96130849 PCT/u~CJ(, 1229 indicated. The torsional degrees of freedom between the rigid units are indicated by angle arrows 133. AMBER atoms types are indicated as at 134. Net atomic charges are indicated only for arginine as at 135. Rigid unit records 5 are linked into a data structure modeling the rigid unit~s physical linkages. Not shown are relative atomic spatial positions represented by the atoms rectangular coordinates.
All parameters defining the AMBER atomic representations and interatomic forces can be found in Weiner et al., J. of 10 Computational Chem., 7:230-52 (1986), and Weiner et al., J.
Amer. Chem. Soc., 106:765 (1984). Conventionally, these parameters are obtained from computer readable files from commercial sources. The preferred computer readable source of these parameters is from Insight II~ 2.3.5 software from 15 BIOSYM (San Diego, CA). Other sources are Tripos (St. Louis, MO) and CHARMm (Molecular Simulations, Inc , Burlington, MA).

Interaction ener~ evaluation details The form of the intramolecular energy, or Hamiltonian, 20 evaluated at step 93, is an important element of this invention. The Hamiltonian consists of the componentr:

Htotal = ~ ~1, tot:al l~oinders ( ~ ) Hl. total =Hl, molecular+Hl, M?~?+Hl, c~.nc.~ n~..,C

The H~"~ 1a, component is determined from the Weiner et al.
references, J. of Computational Chem., 7:230-52 (1986), and J. Amer. Chem. Soc., 106:765 (1984).

in~i~ 2 ( os (n~ yi) +1)+ ~ ~j Bi-t~rSilOnal atom pai s ( 9 ) ~_qigj l+ ~ Cl, Dlj 3 5 i ~ l J J ii~<jj6 ~l ~ i j Rl, i~
atom pairs N-~ond pairs WO 96130849 PcT/u~r~ 'C 12'29 Here, ~., is the i'th torsional angle between rigid units of the l'th binder peptide, and R~ is the interatomic distance between the i'th and j'th atoms in different rigid unils of the l'th binder. The first term in this equation is the 5 torsional energy of rigid units; the second is the interatomic Lenard-Jones energy; the third is the inte:ratomic electrostatic energy; and the fourth is the interatomic hydrogen bond energy. Rigid unit torsional rotations directly change the first term. Such rotations indirectly 10 change all other terms as interatomic distances change.
The AMBER parameters Vin, Ai" Bl~, qi, Cij and Dij a~e obtained as stated above. The effect of water is approximated in a known manner by setting ~ equal to ~EOr, where r is distance (in A) in the electrostatic term and ~c is 15 the vacuum permeability.
The distance constraint term, as described, makes energetically unfavorable moves which cause those measured interatomic separations in the simulation to depart from their measured values. If no measured values are available, 20 this term is simply omitted from the Hamiltonian. Since this is not a physical energy and in simulation equilibrium the binders should have the measured distance, it is advantageous that this term should make only a small contribution to the equilibrium energy, no more than 10~ of the total energy and 25 preferably approximately 2.5 to S~. Further, it is advantageous that the energetic disfavor be weighted by the confidence in the measurements, so that measurements having more confidence have a greater effect.
Many forms of this energy meet these criteria. The 30 preferred form is:

H ~ , i j ) 2 1,N~ ob e.~,,d 2Wl,ij ( 10) dist~nce p~irs where R(~)li3 is a measured distance in the l'th binder pepti~e between atomic pair ij. This makes the constraints appear as an elastic pseudo-bond with equilibrium length as mear,ured.
The wlij are weights designed to meet the above size criteria.
5 In the preferred embodiment, they are calculated with an overall multiplicative factor limiting the contribution of H1M~ to no more than approximately 5~ of the total equilibrated energy. Their relative value is selectel~ to reflect the lower reliability of longer measurements. Thus 10 if R~~)1,ij is between 0 and 3 A, wlij has a relative va]ue of l;
if the measurement is between 3 and 4 . ~ A, the relative vallle is 2; if between 4.5 and 7 A, the value is 3; and if the distance exceeds 7 A, the term is dropped from the sum.
Other alternative weight assignments meeting the general 15 criteria are clearly possible.
The consensus constraint term, as described, makes energetically unfavorable moves which cause the candidate pharmacophore in each of the binders to depart from an average, shared configuration. In simulation equilibrium 20 when the candidate is the actual pharmacophore, the binders share the pharmacophore structure and this term should be small. Since this is not a physical energy, in the case where the candidate pharmacophore is correct, this term should not be large compared to the total energy, in 25 equilibrium no more than 10~ of the total energy, and preferably approximately 5~. Further, the energetic disfavor should preferably be weighted by the affinity of each binder for the protein target, so that binders with greater affinity have a greater energetic effect.
Many forms of this energy meet these criteria. The preferred form is:

ders N
~ ~ (R~ Ri(7 ) ) 2 ( 1, c ~,~ e 2 W/
rh~ , e distance pairs R~C)i~, the shared consensus structure ~or the candidate pharmacophore, is an average of the interatomic distances between corresponding atomic positions, ij, in the shared pharmacophore in all binders. This makes the constraints 5 appear as a pseudo-bonds to a shared pharmacophore, which represents the binding to the protein target. The w~ are weights designed to meet the above size criteria. In the preferred embodiment, they are calculated with an overall multiplicative factor limiting the contribution of Hlr,~ cl,c t:o 10 no more than approximately 5~ of the total equilibrated energy. Their relative value is selected to re~lect that binders with lower af~inity are less reliable indicators of actual pharmacophore stru~ture. Thus the relative value of the weights is proportional to the logarithm of the a~finity 15 of the corresponding binder with an affinity of 1 ~molar having a relative weight of 1. Other weight assignmer..ts meeting the general criteria are clearly possible. The heuristic H,, . _..C is the only Hamiltonian term linking together the various binders.
All Hamiltonian components change only due to the dependence of the interatomic distances, Rlij, on the rigid unit~s torsional rotation. The Rllj are the well kno~n Euclidean distances between the atomic coordinates stored in the rigid unit records. Calculation of coordinate changes 25 due to rotation o~ angle ~ about a bond with unit direction n originating at atom A with position x is well known, but will be detailed. (Throughout, symbols representing vecto~.
quantities are indicated by underlining.) First, translate from the current coordinate origin to an origin at position x 30 by adding x to all relevant coordinate vectors. Second, apply a rotation matrix, T, to the atomic coordinate vectors.
Third, translate back to the prior coordinate origin ~rom x by subtracting x from all relevant coordinate vectors. A
rotation matrix is given by:

WO 96130849 PCT/US96/04.Z29 T=cos (~) I+nn ~[1-cos(~)~+Msin(~) 0 -nz ny ( 12 ) M= n7 ~ -nX
--I~y I1A' ~

A reference for this computation is Goldstein, Classical mechanics, Massachusetts, Addison-Wesley (1981), especially 10 chapter 4, which is herein incorporated by reference.

TyDe I move qeneration Type I moves alter side chain structure of a randomly chosen amino acid in a randomly chosen binder. These random 1~ choices are conventionally made by a random number subroutine. The chosen side chain is "removed~ from the binder peptide and ~grown" back rigid unit by rigid unit.
For the next, i'th, rigid unit to be added, K possible new torsional angles are generated according to pint, Pre:Eerabl~
20 K is from 10 to 100. One of these torsional angles is selected according to pex~, and the rigid unit is added at this new angle. Determination of pext requires obtain:ing the normalization wi'Xt. At each step the uint and u'Xt used to calc~late the respective probabilities include only 25 interaction energies with rigid units present in othe:r amino acids or already grown back. Rigid units not yet added are ignored. After all the side chain rigid units have been added back, Wn'W is computed as the product of the normalization factors.
Fig. 12 illustrates a Type I move for glutamate. At 1~1 the side chain has been removed. The first -CHz- unit is added back at 142 with new torsional angle ~1 The yeneration according to plnt and selection according to pext of this angle iynores energy interactions with the other side chain riyid 35 units not yet added. At 143, the next -CH2- riyid unit is added back at angle ~2. Finally at 144, the last -CO2 riyid WO 96/30849 PCT/US96/0'1229 unit is added at angle ~2 For this last step interaction energies with all the rigid units are considered in generating and selecting the new angle.
W~ld is the weight for the reverse move, the move from 5 the proposed new structure to the current configuratic~n. For this, the proposed side chain is removed and regrown in its current structure unit by unit. For the next, i'th, unit generate K-l possible new torsional angles according to pint ~
again ignoring interactions with units yet to be added. The 10 K'th new angle is the current angle for that unit. The current torsional angle is selected. Although pex~ is not used, normalization wi~X~ is determined. After all unit:s have been regrown at the current angles, W~lt is computed as the product of the normalizations.
The acceptance probability for the proposed side chain con~iguration is determined from equation 7 using Wn'W and W~-~

TvDe II move aeneration Type II moves alter a limited region of the amino acid 20 backbone beginning at a randomly chosen backbone rigid unit of a randomly chosen binder peptide in a manner consistent with conformational constraints due to internal disulfide bonds. These random choices are made similarly to those for Type I moves.
In Type II moves, side ch~;n.c attached to the altered rigid units move rigidly with their backbone rigid units.
For this move, important geometric constraints must be met. In a randomly chosen binder and at a r~n~omly ch,osen backbone bond between adjacent rigid units, a torsional angle 30 rotation by ~0 is made. Subsequent backbone torsional rotations are chosen so that a m; n; ~mllm number of rigic. units undergo a spatial displacement. -This constraint fixes a limi~ed number (if any) of possible subsequent torsional angles as a function of ~0 so that at most 4 rigid units are 35 spatially displaced and rotated with at most 3 additional rigid units undergoing a rotation. This move is an important aspect of this invention and is required to maintain the .
CA 022l6994 l997-09-30 W0 9613U849 PCT/U~ 29 conformational constraint due to the disulfide bridge. Since only 7 rigid units are spatially modified, the Type II move preserves the 8 amino acid cycle (20 rigid units), in-luding the cystine side chain.
Fig. 13 illustrates a Type II move of a poly-glycine 7-~er. Rigid unit positions are indicated generally by black circles as at 1509 with incoming bonds generally as at 1502.
A C~ rigid unit (B unit) is illustrated.in box lS15, and an amide bond (~ unit) in box 1516. Backbone structure :L500 in 10 transformed into structure 1501 by the Type II move generated by an initial rotation about bond 1502. Subsequent rotatiorls about bonds 1503, 1504, 150~, 1506, 1507, and 1508 are thereby determined so that the rigid unit 1510 and at most three subsequent units undergo only a rt~tation without: any 15 spatial displacement. The four rigid units between uIlits 1509 and 1510 undergo both a spatial displacement and a rotation as structure 1500 is transformed to structure 1501.
No other backbone rigid units are altered.
The deri~ation of these assertions, including 20 expressions for the allowed angles, is in Section 8.
Appendix: Concerted Rotation. Fig. 14 defines notation used in this Appendix: Concerted Rotation. Poly-glycine 7-mer backbone 1600 is the same as in Fig. 13. Rigid unit positions are indicated generally by black circles as at 1601 25 with incoming bonds generally as at 1602. The torsion.al rotations ~0 to ~6 are about bonds 1602 to 1608, respec:tively, between sequential, adjacent rigid units. The rigid u.nit position vectors rO to r6, illustrated as vectors 1610 to 1616, respectively, define the position of these sequential 30 rigid units with respect to a laboratory coordinate system with origin 1609. Summarizing this Appendix, the determination of the fixed torsional angles proceeds as follows. The allowed values for ~1 are the roots of equation 34, which depends on the ~0 driver angle and ~2 through. ~4.
35 But ~ through ~4 can be determined in terms of ~l Two solutions for ~2 are determined by equation 25 in terms of ~l~
Two solutions for ~3 are determined by e~uation 29 in t:erms of WO 96/30849 PCT/U~ 4.~29 the preceding ~s. Finally, a simple inversion of equation 32 determines one solution for ~4 in terms of the preceding ~'s. Having found the allowed values of ~1l then equat:ions 25, 29, and 32 determine corresponding allowed values for the 5 other ~'s, which in turn determine the alteration of the first four rigid units caused by the ~O initial rotatic~n.
More precisely, final torsional angles ~0 to ~6 determine position vectors rl to E4 by applying rotation matrix 18 to e~uations 17 to obtain new position vectors in the laboratory 10 coordinate system, the rotation matrices of equations 16 and 18 being determined by these final torsional angles.
Position vectors rO and r~ to E7 do not change. Then rlgid unit 0 is translated to position rO; aligned so that it;s incoming bond axis is along the direction of the outgoing 15 bond of unit -l; and finally rigidly rotated so that the end o~ its outgoing bond is at position El- Rigid unit 1 is then translated to position El; aligned SG that its incomin(~ bond axis is along the outgoing bond of unit 0; and rigidly rotated so that the end o~ its outgoing bond is at position 20 r2. Rigid units 2 to 6 are then added t.o the backbone in a similar fashion. In this fashion the Type II move geometry is determined. Any side chains attached to these rigid units are rigidly rotated when their parent unit is rotated.
The Type II rotation is chosen in the following manner.
25 Using the configurational bias prescription, the Hamiltonian is divided into uint and u~Xt. uin' is preferably 0, or alternatively is the torsional energy associated with the rigid unit of interest, while u~Xt includes all remaini:ng interaction energies. In the previous manner, uint det,ermine's 30 pint according to which are generated K' candidate ~O rotation angles. Preferably K' is 1. Then the geometric constraints are solved for each candidate ~0. Typically, but not ~lways r 6K', denoted K, possible backbone alterations are obtained.
One of these is selected by pext ~ determined by:

WO 96130849 PCT/US96/04,'29 p~xt(~ ) = exp[ ~uO (~i, k) ] (13 ) WeXt(~ exp[-~uO (~ ]
k=i u'X' includes all interactions not in ui~, that is all other backbone and side chain interactions. Because these 10 determinations occur in torsional angle space and change the ~olume element in that space, the Jacobian, determined by equation 35, of the selected Type II move is also nee~ed as a weight in the acceptance probability for detailed balance.
This acceptance probability for Type II moves is:

accept(curr-prop) = min[1, W ldj ld] (1~) The weight and Jacobian of the reverse transformi~tion 20 from the proposed to the current structure are also needed :in the acceptance probability for Monte Carlo detailed balance.
These quantities are determined as follows. Using the proposed backbone structure just selected as the basis, generate a set of K'-l new ~ torsional angles accord.Lng to 25 pin~ and also include the current ~0 in the set. Then solve the geometric constraint to determine the permitted alterations. The current configuration, since it exists, must be among the permitted structures. From this set of permitted structures determine W~ld per equation 13. 'Then 30 select the current configuration and compute the Jacobian J~ld per equation 35. This completes the determination or the acceptance probability.
Proline is approximated. Proline is not subject to Type I mo~es. Howe~er, proline is subject to normal Type II
35 moves, with its side chain bond to the amino nitrogen broken.
The side chain thus moves rigidly with its backbone rigid unit as in normal Type II mo~e. To compensate for the brok;en PCT/U~G/0~229 bond approximation, the C~-N torsional energy amplitude in the proline backbone is set at approximately 5 kcal/mole. ~By contrast the torsional energy in a typical amino acid of the C~-N bond is approximately 0.3 kcal/mole.) This invention is 5 adaptable to other suitable approximations ~or proline.
Alternatively, the proline side chain may be subject to alterations which preserve its cyclicity, such as for example, by an extension of the constraint scheme just described.
Pro~ram detailed descri~tion The following describes the construction and use of a computer method and apparatus to perform the method of step 5. The listing of this code is included in a microfiche 1~ appendix to this specification. Fig. lS is a general view of the computer system and its internal data and program structures. To the left in Fig. 15 are the principal data structures of this method. Current structures 1701 contains the current structures of the N binders represented in memory 20 as described. Proposed structure 1702 contains working memory areas used to generate a proposed new structure for one binder peptide. Structures 1701 and 1702 would typically be stored in RAM memory of the computer system, RAM memory being memory directly accessible to processor fetches.
25 Stored structures 1703 contain similar memory representations of all the peptide structures generated, accepted, and selected for storage. This is typically stored on permanent disk file(s).
Candidate pharmacophore structures 1704 are input to the 30 programs from either a disk file of the display and input unit 1712. The identified candidate structures are used to determine the w'lij in Eqn 11.
Parameters 1705 comprises several parts. First, are all the AMBER atomic interaction definitions and parameters.
~ 35 Second, are standard representations of the amino acids including component rigid units and atomic charge assignments. Third, are parameters controlling the run.

WO 96/30849 PCT/U:~1;101229 These further comprise, by example, values ~or K and K', the Type I/II move branching ratio, the number of moves made in the simulations run, the simulation total energy recorà, etc.
The parameters would typically be loaded from disk file(s) 5 into RAM memory for manipulation during a simulation run.
Unit 1712 includes display and input devices~for monitoring and control. Depicted on the display are the total number of moves made in the current run and the course of the total energy, which is similar to that illustrated in 10 Fig. 9.
Processor 1711 is loaded with necessary programs prior to a simulation run and executes the programs to perform the simulation method. The general structure consists of main program 1706, structure modification program 1707, Type I and 15 II move generators 1708 and 1709, and subroutines 1710. The subroutines consist of common utility subprograms, such as for performing torsional rotations about bonds and computing interaction energies by the previous methods, and conventional library subprograms, such as for performing 20 input and output and finding random numbers. Any scientifically adequate random number generator can be used.
A reference for random number generators is Press et al., Numerical reci~es: the art of scientific com~utinq, Cambridge, U.K., Cambridge University Press, (1986), chapter 25 7. The invention is equally adaptable to other program structures that will occur to those skilled in computer simulation arts.
The preferred embodiment of these structure is an Indigo 2 workstation from Silicon Graphics (Mountain View, CA).
30 Alternatively, any high performance workstation, such as products of Hewlett-Packard, IBM or Sun Microsystems, could be used. Preferably the data and program structures are code~ in the C computer language. Alternatively any scientifically oriented language, such as Fortran, could be 35 used. conventional subroutine and scientific subroutine libraries are used where appropriate.

CA 022l6994 l997-09-30 WO 96/30849 PCT/U~_ ~'01229 The program components will be now described in detail with reference to Figs. 16, 17, 18, and 19. Fig. 16 illustrates main program 1706. The peptide se~uences of the N binders are input at step 1801. All necessary AMBER
S parameters - bond lengths and angles, atomic types and charges, interaction parameters, amino acid definitions, etc.
- are input at step 1802. Step 1803 creates initial structures from this input data. Rigid unit records for all rigid units are created and linked to represent peptidec,.
10 The geometric structures of these peptides either are obtained from a prior run or are built by adding side c~l~; n.
to a prototypical backbone characteristic of the library of the binder. A prototypical backbone for the CX~C library is found in the microfiche appendix heading CX6C.CAR. The 18 initial binder structures are stored in the current structure data areas in preparation for the beginning the main steps of the method.
Step 1804 begins the main loop of the simulation with the generation of a proposed modified structure for one of 20 the binder peptides by structure modification program 1707.
As part of proposed structure generation, an acceptance probability, accept(curr-~prop) is determined as previously described. The proposed structure will be accepted at 1805 based on this probability. For example, a random number 25 between 0 and l is generated, and the proposed structure accepted if the random number is less than the acceptance probability. If the proposed structure is accepted, then it is tested for sufficient distinctiveness at step 1806. This test is met if at least one atomic position in the proposed 30 structure differs from the corresponding position in the current structure by at least approximately 0.2 ~. If the proposed structure is distinct, i-t is stored at 1807 in the stru~ture store for later analysis. Whether distinct or not, the accepted proposed structure for the peptide replaces the 35 corresponding current structure at step 1808.
The simulation is tested for completion at step 1809.
Completion can be controlled by the operator at station 1712 WO 96/30849 PCT/U~GJ'~ 1229 depending on display of run progress results. Alternatively, termination can be mechanically controlled. After completing a certain number of total moves after run energy equilibration, the moves being split between Types I and II
5 according to the specified branching ratio, the run is terminated. The preferred number of total moves is 25,000, and the preferred Type I/II branching ratio is 4. Thus it is preferred to have 20,000 Type I and 5,000 Type II moves after e~uilibration per simulation run.
At step 1810, the stored structures are analyzed to determine both the consensus pharmacophore structure and the structures of the remainder of the binders. In the preferred embodiment, atomic positions in the equilibrated stored structures for each peptide are averaged to obtain the 15 predicted geometric structure. The shared pharmacophore structure is obtained from the predicted structure of each peptide, again by averaging the shared position information for all peptides. Alternatively, before structure averaging, the structures generated for each binder can be clustered 20 into similar groups and the clusters for each peptide separately averaged. The clusters would represent alternative peptide folding patterns. It is anticipated that because preferred binders are short peptides constrained by disulfide bridges, any alternative foldings identified will 25 be structurally similar. The clustering can be done by the exemplary methods found in the previously referenced article Gordon et al. FUZZY cluster analYsis of molecular dvnamics traiectories. Proteins: Structure, ~unction, and Genetics 14:249-264 (1992). For all analysis methods, the choice of 30 the preferred number of stored moves is adjusted to achieve adequate estimated statistical position errors. Further, preferably, the results of three runs are combined to achieve increased statistical confidence.
Other information is also output. Particularly 35 important is the course of the total energy for each peptide and for all the peptides, and the intra-molecular, consensus, and constraint components of the energies. These energy W 096/30849 PCT/U~G~0~229 componellts are used in determining whether a consensus pharmacophore has been found. As previously described, t:his is preferably done by insuring that ~,.~= cc is small compared to the total energy and is minimized by a particular 5 candidate pharmacophore. Also H~ must be relatively small.
Finally at 1811, all results are output in a form usable for the subsequent steps 6 and 7 of Fig. 1. For example, this may be a particular file format suitable for subseq~lent lead compound search by a database query.
Turning now to Fig. 17, structure modification program 1707 will be described. This is invoked from the main program at 1804. Upon entry, this program randomly picks one of the binder peptides at 1901 for which to generate a proposed structure and also picks which type of move to use 15 at 1902. This latter random choice is made according to an adjustable Type I/II branching ratio (preferably 4). For a Type I rnove, step 1903 picks a random amino acid side chain of the selected peptide, and step 1904 invokes the Type 1 move program. (Proline has no Type I moves.) For a Type II
20 move, step 1905 picks a random backbone bond between rigid units to rotate and also a random direction from the pick:ed bond along which backbone rigid unit structure will be altered. Step 1906 invokes the Type II move program.
Figs. 18A and 18B illustrate the Type I move generator 25 1708, which is defined by equations 6 and 7. With reference first to Fig. 18A, the proposed structure of the selected peptide is created from its current structure by removing the selected side chain. All intra-molecular interactions are subse~uently determined with respect to the proposed 30 structure absent side chain rigid units not yet regrown. K
candidate new torsional angles for the next, i'th, rigid unit to add are generated by piint at 2002. Preferably K is be~ween 10 and 100. Generation of these angles uses the conventi.onal rejection method referenced in Press et al. at 7.3. The 35 weight wi~Xt and pi.xt are determined for each of these candidate angles. This requires the rigid unit to be adcled to be rotated to the candidate angle using the previous rotation method. Candidate interaction energy is determined from candidate interatomic distances resulting from the candidate rotation. One of the candidate angles is probabillsticly selected at 2003 and the rigid unit added 5 back at this torsional angle at 2004. If there are more units to add, which is tested at 2005, these steps are repeated. If not, the acceptance weight Wn'W is determined as the product o~ the wi~Xt at 2006. Lastly the old weight is determined at 2007. From the weights the move acceptance 10 probability is found for use at 1805.
Fig. 18B details the determination 2007 of W~ld, the weight for the reverse move from the proposed to the current side chain structure. Temporarily the proposed structure is used as a basis for energy determination at 2008, and then 15 the current structure is restored at 2016, when this process is finished. The proposed side chain is removed at 2009 for regrowth rigid unit by rigid unit as in Fig. 18A. For the next, i'th, rigid unit to be added back, K-1 candidate angles are generated according to piin' at 2010 with the current value 20 of that angle for the K-th candidate at 2011. As previously, the weight wl~Xt is determined for these candidate angles at 2012. The rigid unit is added back at the current, K-th, angle at 2013. If there are more units to add, tested at 2014, these steps are repeated. If not, the acceptance 25 weight W~ld is determined as the product of the wi~X~ at 2006.
Figs. l9A and l9B illustrate Type II move generator 1709, which is defined by equation 13 and 14 and the concerted rotation geometric constraints. With reference to Fig. l9A, K' candidate new torsional angles for the selected 30 backbone bond are generated by pint using the rejection method. Preferably K' is 1. Torsional rotations about adjacent backbone bonds, in the selected direction along the backbone, permitted by the concerted rotation constraints are determined from the roots of equation 34 at 2102. Equation 35 34 depends on intermediate ~ariables obtained from equations 25, 29, and 32 and determined in that order. The roots are simply found by searching the interval t~ ] in 0.04~

increments. When a root is located in a 0.04~ segment, it is refined with the bisection method referenced in Press et al.
at 9.1. It is expected on the average that six K~
solutions will be found. If no roots are found at 2103l the 5 candidate rotation is impossible and this move is skipped.
If solutions exist, next, at 2104, pext and wne~ are determined.
Using the described rotation method, the backbone rigid units are rotated (with consequent spatial displacement of ~ units) to a candidate torsional angle solution about their mutual 10 bonds. Additionally, any side ch~ins attached to backbone rigid units are rigidly rotated using the same method.
~aving made these rotations, candidate interatomic distances and candidate interaction energies can be determined and used to obtain pext for this candidate solution. One of the 1~ candidates is probabilisticly selected at 2104, and the backbo~e and any side chains are rotated according to this candidate into the proposed structure. The Jacobian of this transformation is determined at 2106 by equation 35. Lastly the old acceptance weight and Jacobian are determined at 20 2107. From the weights and Jacobians the move acceptance probability is found for use at 1805.
Fig. l9B details the determination 2107 of W~ld and J~ld for the reverse move from the proposed to the current side chain structure. Temporarily the proposed structure is used 25 as the basis for energy determination at 2008, and the current structure is restored at 2016, when this process is finished. At 2109, a set of K'-1 candidate torsional angles is generated for the selected backbone bond according to pint using the rejection method and the current torsional angle is 30 added to this set. If as preferred, K' is 1, this step results in a set with only the current angle. At 2111, similarly to 2102, the permitted torsional rotations about adjacent backbone bonds are determined from the equation,s expressing the concerted rotation constraints. Special care 35 is taken to ensure that the original conformation is found by the root finding procedure. In particular, the search interval is centered on the known original ~l and is made as small as necessary to isolate the root, which may be as small as 0.004~ or smaller. The current structure must be among these solutions, since it exists. Select it at 2112. W~ld is computed from the candidate angle solution, making the 5 candidate rotations and determining candidate interactions.
Also the Jacobian, J~ld, of the transformation is computed ~rom the proposed to the current structure.

5.8. cONsENsuS ~lK~lu~E TEST
Having selected a candidate pharmacophore and determined a best possible consensus structure and best possible structures for the remainder of the binder molecules, the consensus test, step 6, tests whether a consensus structure has actually been found. A consensus pharmacophore structure 15 consists of a spatial arrangement of chemically similar groups shared by all the N binders to high accuracy. Since an actual pharmacophore exists, the N specifically binding members of the screened libraries will share the actual structure. However, the remainder of binder molecules will 20 share no other similar structures to such a high accuracy.
Therefore, a structure consensus of the N binders is pos_ible only if the candidate pharmacophore is the actual physical pharmacophore responsible for the actual binding. If the candidate selected relates to other parts of the binder 25 molecules, no structure consensus will be found. Further, if the Monte Carlo determination attempts to impose a consensus on parts of the binder molecules that do not share structure, an inconsistent overall structure will be obt~; n~ for the re~;n~er of the binder molecules.
Therefore, two preferred consensus tests are applied:
one test asks whether a consistent candidate pharmacophore has been obtained, and a second test asks whether consistent stru-tures have been obtained for the rem~i n~er of the binder molecules. Both tests have a preferred absolute and a less 35 preferred relative version.
There are two portions for the first test. First, are all the consensus pharmacophore distances obtained in the N

binders within at least a specified distance, preferably approximately 0.25 A, of each other? Second, is the consensus energy, ~ . ~, relatively small compared to l_he total molecular energy (e.g., less than at most approximately - 5 5-10~ of the total molecular energy) as determined by the Monte Carlo method?
There are also two portions of the second test. Fi.rst, can the intramolecular distances predicted by the Monte Carlo method be confirmed by additional distance measurements?
10 Second, since .the Monte Carlo method utilizes distance constraints previously measured, one or more of these measurement constraints can be ignored and the predicted distance checked against that measured distance. Tolera.nces for these tests are distance agreements of at least speci~ied 15 distances, e.g., approximately 0.5 ~, in each binder.
The two preferred tests have been described in the absolute version as requiring checks against absolute tolerances. Alternatively, the values of the pharmacophore distance differences among the binders, ~ .. ~, and the 20 differences of the predicted and measured distances can be accumu].ated for all the possible candidate pharmacophores, the candidate selected being that one minimizing these departures. Therefore, the selected candidate will have the minimum values for the differences of the pharmacophore 25 distances in the binders, the minimum value for ~,...~ , and the minimum values of the differences of predicated from.
measured distances.
This invention is adaptable to other tests that evaluate the consistency of the consensus structure obtained for the 30 candidate pharmacophore and the-accuracy of the structure obtained for the rem~;n~er of the binder molecules.

5.9. LEAD COM~OuN~ DET~MTN~TION
Having started at step 1 with a target of interest, upon 35 completion of step 6 of Fig. 1 a high resolution pharmacophore structure has been determined as well as supporting structures of the N binder peptides. This high WO 96/30849 PCI~/U~C/0'1229 resolution structure is used ln step 7 to determlne lead compounds for use as a drug that will bind to the original target of interest.
Thus, one or more lead compounds are determined, that 5 share a pharmacophore specification with the determined consensus pharmacophore structure. This determination can be preferably done by one of several methods: by a search of a database of potential drug compounds or of chemical structures (e.g., the Standard Drugs File (Derwent 10 Publications Ltd., London, England), the Bielstein database (Bielstein Information, Frankfurt, Germany or Chicago), and the Chemical Registry (CAS, Columbus, OH)) to identify compounds that contain the pharmacophore specification; by modification of a known lead compound to include the 15 pharmacophore specification; by synthesizing a de novo structure containing the pharmacophore specification; or by modification of binders to the target molecule (e.g., isolated in step 2) outside of the pharmacophore structure to render the binder more attractive for use as a drug (e.g., to 20 increase half-life,.solubility, ability to achieve desired in vivo localization).
Database search queries are based not only on chemical property information but also on precise geometric information. Computer-based approaches rely on database 2S searching to find matching templates; Y.C. Martin, Database searchinc in druc desiqn, J. Medicinal Chemistry, vol. 35, pp 2145-54 (1992), which is herein incorporated by reference.
Existing methods for searching 2-D and 3-D databases of compounds are applicable to this step. Lederle of American 30 Cyanamid (Pearl River, New York) has pioneered molecular shape-searching, 3D searching and trend-vectors of databases.
Commercial vendors and other research groups have enhanced searching capabilities [MACSS-3D, Molecular Design Ltd. (San T-~n~ro~ CA); CAVEAT, Lauri, G. et al., University of 35 California (Berkeley, CA); CHEM-X, Chemical Design, Inc.
(Mahwah, N.J.)].

The pharmacophore structure determined i~ this invention is adapta~le to any of these methods and sources of chemical database searching and to the enumerated non-àatabase methods. output will be lead compounds suitabie for dru~3 5 design. An important aspect of this invention is that the high resolution pharmacophore structure will lead~to highly targeted leads. Lower resolution structures result in a geometric increase in the number of lead compound query matches. Example 1 illustrates this effect.

5.10. APPENDIX: CoN~ ;K-l~;L) ROTATION
Since the preferred molecules under consideration a:re conformationally constrained by disulfide bridge(s), a Monte Carlo move that preserves this constraint is required. The 15 "concerted rotation" scheme used for alkanes can be extended to allow rotation of the torsional angles in conformationally constrained peptides. This appendix describes this extension. Dodd et al. (1993) discusses the original, restricted method. (The essential extensions are expressed 20 in equations 27, 28, and 34.) This method is directly applicable to the cyclic residue of proline, and an alternative embodiment of this invention would thermally perturb proline with a move of similar geometric constraints.
Fig. 14 illustrates the geometry under consideration.
25 Illustrated ~ackbone 1600 is a poly-glycine 7-mer. Rigi(~
unit positions are indicated generally by black circles as at 1601 with incoming bonds generally as at 1602. The torsional rotations ~0 to ~6 are about bonds 1602 to 1608, respectively, between sequential, adjacent rigid units. The rigid unit 30 position vectors rO to r6, illustrated as vectors 1610 to 1616, respectively, define the position of these sequential rigid units with respect to a laboratory coordinate system with origin 1609. A C~ rigid unit (B unit) is illustrated in box 1630, and an amide bond ~C unit) in box 1631.
To formulate this method, let us consider rotating ~bout seven torsional angles, which will displace the root positions and rotate four rigid units, rotate up to three - 97 _ W096/30849 PCT~S96/04229 additional ones, and leave the rest of the peptide ~ixed.
The root position of a rigid unit is the Ca position for a B
unit, the C position for a C unit, the C position for a CH2 unit, and the s position for the S unit in cystine. If unit 5 5 is a C unit, however, r~ is defined to be the backbone amino nitrogen position of that unit. For each unit, let us define ~i to be the fixed angle between the incoming and outgoing bonds. Thus, 61 = 0 for a C unit, and ~i 70.5~ for all others.
The method leaves the positions Ei of units i c 0 or i 5 fixed. The torsion ~O is changed by an amount ~O. The values Of ~ i c 6 are then determined so that only the positions ri of units 1 < i c 4 are changed.
The method re~uires several definitions to present the 15 solution for the new torsional angles. The bond vectors are defined to be the difference in position between unit i and unit i - 1, as seen in the coordinate system of unit i:
1 = I() - r(i). (15) Bond vectors 11 to 1~ are illustrated in Fig. 14 at 1620 to 1624, respectively. The length and orientations of the li are determined by rigid unit structure and the length and angle AMBER parameters for bonds between atom types. The coordinate system of i is such that the incoming bond is along the ~ direction. Thus li = li ~ if atoms ri and ril are directly bonded to each other and has x- and y-components otherwise. Here ~ is a fixed unit vectox along the x direction. Now define a rotation matrix that transforms from the coordinate system of unit i+1 to unit i W096l30849 PCT~S96/04229 cos~ sin~i O
Ti = sin~icos~i -cos~icos~i sin~i (16) ~sin~.sin~i -cos~.sini~ -cos~., S

The positions of the units in the frame of unit 1 are, thus, glven by:
1'l' = 1 ~21~ = l1+Tli2 (17) ~ 3 11 + Tl (12 + T2l3 ) ; + Tl (12 + T2 (13 +T314)) Further define the matrix that converts from the frame of reference of unit 1 to the laboratory reference frame Tlab = [cos~I+nn~ cos~)+Msin~]A. (18) where / O -nz ny' M = nz 0 -nx (19) ~-n~, nx 0 , and ~ x L
¦~ x L¦
COS~ =
(I X 2~) 1 slnyl = I I I ~l ~ 35 _ 99 _ CA 022l6994 l997-09-30 WO 9~/3~~19 PCI/US96/04229 where r is the axis of the bond coming into unit 1. The matrix A is a rotation about ~- and is defined so tha~

/1 0 0 \
A = 0 c ~S (20) ~O S C~

where c = (ll,Arylll Arz)/(Ary+~rzZ) (21) s = (-llzAry ~ rz) / (~ry +l~rz2) .

Here A~ = A[Tllab] -1 (I l-L 0) if unit 0 is a C unit. Otherwise, ~r = ll 2 0 The method proceeds by solving for ~i, 2 <i ~ 6, analytically in terms of ~l Then a nonlinear equation is solved numerically to determine which values of ~l/ if any, are possible for the chosen value of ~0.
The derivation proceeds in the coordinate system of unit 25 1, after it has been rotated by the chosen ~0. Define t = L~5) --ll = [T 1 ] l (L5--Lo)--ll- (22) If ~3 ~ 0 and 05 ~ 0, one can see from ~ig. 14 that the 30 distance between unit 3 and unit 5 is known and equal to 2 (14xcos~4-l4ysin~4~l5x)2 ~ (23) ql ( 14Xsin~4 +14ycOs~4 1 15y) 2 But this distance can also be written as -qi2 = ¦~ _ T 1 12 (24) ~ = T~

Equating these two results, two values of ~2 are ~ossible ~2 = arcsin(c1) - arctan(xy/xz) - H (xz) (25) ~ -arcsin(c1) - arctan(xy/xz) - ~ (xz), with H(x) = {~, x>OO ( 2 6 ) 15 The constant cl is given by ql2 -x2 -132 +2xx(cos~213x ~ sin~213~ 3 0 ~ O
-2 ( SiI1~32l3x - Cos~32l3y) (X~ +XZ2 ) l/2 5 13X+14X+15XC0S~34-XXcOs~32 ~ =o ~ ¢o 20sin~2 (Xy2+xz2) l/2 5 Cl ~
(Ls l2! (L~ L5) /16 15 l4XCoS~34--XX(cos~213x+5in~3213y) ( sin~213X-cos~3213y) (Xy2 +XZ2 ) l/2 25l3xC~s~4~xx(cOs~213x+sin~32l3y) ( sin~3213x-cos~213y) (xy +xz2 ) l/2 (27 ) where x is given by Eqn. 24 if ~5 ~ 0 ~ and x = Tl-l[T,l~b]-l(E6 -E5)/l6 if ~5 = 0 . Clearly for there to be a solution ¦cl¦ c 1.
35 The last three equations for cl were determined by condit;ions similar to equating Eqns. 23 and 24. For 03 = 0 ~ 05 ~ 0 ~ the x component o~ rS ~3) - r3 ~3) is known to be equal to (14X +
15cos~4). For ~3 ~ 0, ~5 = 0, the x component of r5'5' - r3~5' is known to be equal to 15~ + 14~COSe4. For a3 = o, e = 0, the angle between E3 - r2 and r6 - rS is known to be equal to ~4.
To determine ~3 two expressions for ¦ r5 - r~ ¦ 2 are again equated to determine that: ~
152-y2-14Z+2yx(cos~314x+sin~314y) (28) 2(sin~314x-cos~314y)(yy +yz2 ) l/2 ~3~ =arcsin(c2) - arctan(yy/yz) - H (yz) (29) ~}I =~ -arcsin(c2) - arctan(yy/yz) - ~ (yz), where ~ = T2l (T~ 2) -13 . . Again, ¦c2¦ ~ 1 for there to be a solution.
If 65 .- 0, the value of ~4 can now be determined from:
I(5l) = L(4l~+T1T2T3T4l5- (30) Defining ~3 = T3lT21T1lrTl1ab~-l(L5 - I4). (31) the equations that define ~4 are given by q3y = c~S~4(Sin~4l5x ~ cos~415y) (32) g3z = sin~4 (sin~415X - cos~415y) This is a successful rotation if the position of r6 is successfully predicted. That is, the e~uation L6 Is = T1T2T3T4Tsl6 = [Tll~b] -1 (L -I ) must be satisfied. Consider the x-component, which implies WO 95~30~ ~5 PCTIU~G/0~229 (L 6 ~ ) Tl~2~3~4~-(l6xcos~5+l6ysin~s)=o, ~5$0 F5(~l) =' (L4-L3) (L6-L5)-l4l6cos~4=o~ 0,~5=0 (34) ¦L6--L9 ¦ - [ ( 16X~15X) 2 +1 2y] l/2 =o, ~33 =o, ~5 =o must be satisfied if the rotation is successful. The 10 equations for the case ~5 = 0 clearly express the geometric conditions required for a successful rotation.
Eqn. 34 is the nonlinear equation for ~1 because ~2/ ~3~
and ~4 are determined by Eqns. (25), (29), and (32) in terms of ~1. This equation has between zero and four values for 15 each value of ~lt however, due to the multiple root character of Eqns. (25) and (29). The equation is solved by searching the region -~ c ~ c ~ for zero crossings. The search is in increments of c 0.04O. These roots are then refined by a bisection method.
The transformation from ~1~ 0 c i c 6 to the new solution which is constrained to change only ri, 1 c i c 4 actually implies a change in volume element in torsional angle space.
This change in volume element is the reason for the appearance of the Jacobian in the acceptance probability.
25 The Jacobian of this transformation is calculated in Dodd et al. (1993)at pp. 991-93. It is slightly different here since root position Es is not necessarily the head position. The Jacobian is given by.

¦ de tB ¦ ( ) ~ where the 5 x 5 matrix B is given by Bij = tu; x (E5 - hj)]i for i c 3 and Bij = tuj x (E6 - E5)/¦E6 - Es¦]i3 for i = 4,5. Here _ = ri, except that _5 iS the head position even if ~5 = 0, and ui is the ; nco~; ng bond vector for unit i.

W096/30849 PCT~S96/04229 Repeated application of the concerted rotation may lead to a slightly imperfect structure, due to numerical precision errors. In an alternative embodiment, peptide geometry would be restored to an ideal state by application of the Random 5 Tweek algorithm after several thousand moves (Shenkin et al., 1987, Biopolymers 26:2053-85).
The invention is further described in the following examples which are in no way intended to limit the scope of the invention.

6. EXAMPLES
6.1. RELATION BETWEEN EFFE~Llv~:~ESS OF
POTENTIAL DRUG ID~:NLl~lCATIONS AND
PHARMACOPHORE GEOMETRIC TOLERANCE
Searches of a drug library well known to medicinal chemists, the S~andard Drugs File (Derwent Publications Ltd., 15 London, England), illustrate the geometric increase in the number of compounds found (and thus decrease in expected effectiveness of identification of potential drugs) as pharmacophore geometric tolerance is increased. Table 4 tabulates the results.
Table 4 5HT3 (5 Hydroxytryptophan) Tolerance (A) Number of drug compounds 2.0 64 1.0 35 0.5 27 0.25 12 0.10 Dopamine Tolerance (A) Number of drug compourlds 2.0 1~8 1.0 185 0 5 60 ~
0.25 48 0.10 5 10 The pharmacophores are two well known neurotransmitters, 5-hydroxytryptophan and dopamine. As the tolerance of one distance in the pharmacophore structure is decreased from 2.0 to 0.1 A, the number of compounds retrieved from the dat:abase is listed. The advantage o~ achieving pharmacophore 15 resolution better than approximately 0.25 A is clear.
If the tolerance of three distances were involved, the expected number of compound retrieved would be the cube of these numbers. For the dopaminergic pharmacophore, the number of lead compounds would decrease from over 6.5x106 to 20 about 125 as three tolerances were decreased from 2.0 A to o.l A.
This example illustrates the geometric increase in the number of leads identified as pharmacophore geometry is less well defined. It thus a very preferred aspect of this 25 invention that the computational method results in determining pharmacophore structure accurate to at leasl approximately 0.25 to 0.30 A. Thus an exponentially la:rge improvement in lead compound selection for drug design can be expected to result from this invention.
6.2. EXPRESSION AND P~RIFICATION
OF TARGET PR~L~l~S
Target molecules that are proteins, for example ras, raf, vEGF and KDR, are expressed in the Pichia pastoris ~ 35 expression system (Invitrogen, San Diego, CA) and as glutathione-S-transferase (GST)-fusion proteins in E. coli ~Guan ~nd Dixon, 1991, Anal. Biochem. 192:262-267).

CA 022l6994 l997-09-30 WO 96/30849 PCT/U:i5G~'~ 1229 The cDNAs of these target proteins are cloned in the Pichia expression vectors pHIL-S1 and pPIC9 (Invitrogen).
Polymerase chain reaction (PCR) is used to introduce six Histidines at the carboxy-terminus of these proteins, so that 5 this His-tag can be used to affinity-purify these proteins.
The recombinant plasmids are used to transform Pichia cells by the spheroplasting method or by electroporation.
Expression of these proteins is inducible in Pichia in the presence of methanol. The cDNAs cloned in the pHIL-Sl 10 plasmid are expressed as a fusion with the PH01 signal peptide and hence are secreted extracellularly. Similarly cDNAs cloned in the pPIC9 plasmid are expressed as a fusion with the ~-factor signal peptide and hence are secreted extracellularly. Thus, the purification of these proteins is 15 simpler as it merely involves affinity purification from the growth media. Purification is further facilitated by the fact that Pichia secretes very low levels of homologous proteins and hence the heterologous protein comprises the vast majority of the protein in the medium. The expressed 20 proteins are affinity purified onto an affinity matrix containing nickel. The bound proteins are then eluted with either EDTA or imidazole and are further concentrated by the use of centrifugal concentrators.
As an alternative to the Pichia expression system, the 25 target proteins are expressed as glutathione-S-transferase (GST) fusion proteins in E. col i . The target protein cDNAs are cloned into the pGEX-KG vector (Guan and Dixon, 1991, Anal. Biochem. 192:262-267) in which the protein of interest is expressed as a C-terminus fusion with the GST protein.
30 The pGEX-KG plasmid has an engineered thrombin cleavage site at the fusion junction that is used to cleave the target protein from the GST tag. Expression is inducible in the presence of IPTG, since the GST gene is under the influence of the tac promoter. Induced cells are broken up ~y 35 sonication and the GST-fusion protein is affinity purified onto a glutathione-linked affinity matrix. The bound protein is then cleaved by the addition of thrombin to the WO 96/30849 PCT/US9GJ'(~ ~'7?9 affinity matrix and recovered by washing, while the GST tag remains bound to the matrix. Milligram quantities of recombinant protein per liter of E. col i culture are expected to be obtainable in this manner, 6 . 3 . ~YN-L~:SIS AND SC~ ~ OF POLYSOM~-BASE:D

T.TR~T~,~ ENCODING ~ANDOM CONST~TN~n PEPTIDES OF VARIOUS ~ENGTHS

6.3.1. PREPARATION OF DNA TEMPLATES

DNA libraries with a high degree of complexity are made as two components: an expression unit, and a semi-random (or degenerate) unit. The expression unit has been synthesized chemically as an oligonucleotide (termed T7RBSATG), and contains the promoter region for bacteriophage T7 RNA
15 polymerase, a ribosome binding site, and the initiating ATG
codon. The random region, also synthesized as an oligonucleotide (termed MMN6) contains a region complementary to the expression unit, the antisense version of the codons specifying Cys-X6-Cys, and a restriction site (BstXI). I'he 20 library is constructed by annealing 100 pmol of oligonucleotide T7RBSATG [having the sequence 5'ACTTCGAAATTAATACr~ACTCACTATAGGGAGACCACAACGGTTTCCCTCCAG~ ~T
AATTTTGTTTAACTTTAACTTTAAGAAGGAGATATACATATGCAT3' (SEQ ID NO:2)]i and oligonucleotide MNN6 [ha~ing the se~lence 25 5' CCCAGACCCGCCCCCAGCATTGTGGGTTCCAACGCCCTCTAGACA[MNN]6ACAA.TG
TATATCTCCTTCTT3' (SEQ ID NO:3); M = A or C , N = G, A, T, or C], and extending the DNA in a reaction mixture containing 10-100 units of Seguenase (United States Biochemical Corp., Cleveland, OH), all four dNTPS (at 1 mM), and 10 mM

30 dithiothreitol for 30 min at 37~C. The extended materia] is then digested with BstXI, ethanol precipitated and resuspended in water. This fragment of DNA is then ligat:ed via the BstXI end to a 250 base pair (bp), PCR-amplified Glycine-Serine coding fragment derived from gene III of ~I13 bacteriophage DNA. The gene III fragment has been ampli.fied by use of two primers, respecti~ely termed FGSPCR [ha~inq the sequence 5'T~lLl~ACCTGCCTCAACCTCCCCACAATGCTGGCGGCGG~l~lG~13' (SEQ ID NO: 4)], and RGSPCR [having the sequence 5'ATCAAGTTTGCCTTTACCAGCATTGTGGAGCGCGTTTTCATC3' (SEQ ID NO:5)], and Taq DNA polymerase (Gibco-BRL). The amplified DNA (250 bp) was cut with BstXI to yield a 200 bp 5 fragment that has been gel purified. The 200 bp fragment is then ligated to the random peptide coding DNA fragment. This DNA specifies the synthesis of a peptide of the sequence Met-His-Cys-(X)6-Cys- (SEQ ID NO:6) fused to the Gly-Ser rich region of the M13 gene III protein. The Gly-Ser rich domain 10 is thought to behave as a flexible linker and assist in presentation of the random peptide to the target molecules.
To make constrained random peptides of different lengths, oligonucleotides are made that are similar to MNN6, except that the degenerate region is 5, 7, 8, and 9 codons 15 long. In addition, oligonucleotides are made that code for various shapes of constrained random peptides by specifying sequences comprising three cysteine residues interspersed between 6-10 randomly specified amino acids.

2 0 6 . 3 . 2 . IN VIT~O SYNTHESIS AND
ISOLATION OF POLYSOMES
An E . col i S30 extract is prepared from the B strain SL119 (Promega). Coupled transcription-translation reactions are performed by mixing the S30 extract with the S30 premix 25 (containing all 20 amino acids), the linear DNA template coding for peptides of random sequences (prepared as described in Section 6.3.1 above), and rifampicin at 20 ~g/ml. The reaction is initiated by the addition of 100 units of T7 RNA polymerase and continues at 37~C for 30 min.
30 The reaction is terminated by placing the reactions on ice and diluting them 4-fold with polysome buffer (20 mM Hepes-NaOH, pH 7.5, 10 mM MgCl2, l.S ~g/ml chloramphenicol, 100 ~g/ml acetylated bovine serum albumin, 1 mM dithiothreitol, 20 units/ml RNasin, and 0.1~ Triton X-100). Polysomes are 35 isolated from a 50 ~l reaction programmed with 0.5-1 ~g of linear DNA template specifying the synthesis of random constrained peptides. To isolate polysomes, the diluted S30 PCT/US96tO4229' reaction mixtures are centrifuged at 288,000 X g for 30-40 min at 4OC. The pellets are suspended in polysome buffer and ~ centrifuged a second time at 10,000 X g for 5 min to remove insoluble material.

6.3.3. A~l"1~1L~ SEI~EC~TION/SCR~ i OF POLYSOMES
The isolated polysomes are incubated in microtiter wells coated with the target proteins. Microtiter wells are uniformly coated with 1-5 ~g of 6-His tagged, or glutathione 10 S-transferase fused, target proteins (see Section 6.2 hereinabove). Target proteins that are used include the oncoproteins ras and raf, KDR (the vascular endothelial growth factor [vEGF] receptor protein) and vEGF. The microtiter wells are coated with 1-5 ~g of these target 15 proteins by incubation in PBS (phosphate-buffered saline; 10 mM sodium phosphate, pH 7.4, 140 mM NaCl, 2.7 mM KCl), for 1-5 hours at 37~C. The wells are then washed with PBS, an.d the unbound surfaces of the wells blocked by incubation with. PBS
containing 1~ nonfat milk for 1 hr at 37~C. Following a wash 20 with polysome buffer, each well is incubated with polyscmes isolated from a single 50 ~l reaction for 2-24 hr at 4~C.
Each well is washed five times with polysome buffer and the associated mRNA is eluted with polysome buffer containing 20 mM EDTA.
After affinity selection of the polysomes, the associated mRNAs are isolated, and treated with 5-10 units of DNase I tRNase-free; Ambion) for 15 min at 37~C after addition of MgCl2 to 40 mM. The mRNA is phenol-extracted and ethanol-precipitated and dissolved in 20 ~1 of RNase-free _ 30 water. A portion of the mRNA is used for cDNA preparati~n and subsequent amplification using 15 pmol each of primers RGSPCR t5~ATCAAGTTTG~ ACCAGCA~ ~l~AGCGC~~ ATC3' (SEQ I~ NO:5)], and SELEXFl t5'AcTTcGAAATTAATAcGAcTcAcTATAGGGAGAcc~AcAA~lllcc3' 35 (SEQ ID NO:9)] and rTth Reverse Transcriptase RNA PCR kit (Perkin Elmer Cetus). Specifically, the mRNA is reverse-, CA 022l6994 l997-09-30 WO 96/30849 PCTIU:,,5':)1229 transcribed lnto cDNA in a 20 ~l reaction containing 1 pg mRNA, 15 pmol of RGSPCR primer, 200 ~M each of dGTP, dATP, dTTP, and dCTP, 1 mM MnCl2, 10 mM Tris-HCl, pH 8.3, 90 mM KCl, and 5 units of rTth DNA polymerase at 70~C for 15 min. In 5 the next step, the cDNA is amplified by the addition of 2.5 mM MgCl2, 8~ glycerol, 80 mM Tris-HCl, pH 8.3, 125~mM KCl, 0.95 mM EGTA, 0.6~ Tween 20, and 15 pmol of the .~T.F.XFl primer. The reaction conditions that are employed are 2 min at 95~C for one cycle, 1 min at 9S~C and 1 min at 60~C for 35 10 cycles, and 7 min at 60~C for one cycle. The amplified product is then gel-purified and quantitated by spectrophotometry at 260 nm. A portion of the amplified DNA
is digested with NsiI and XbaI and the resulting 30 base pair fragment is directionally cloned into a monovalent phage 15 display vector. The DNAs inserted in the monovalent phage display vector are then sequenced to determine the identity of the peptides that were selectively retained by one cycle of affinity binding to the target protein. A second portion (0.5-l ~g) of the amplified DNA is subjected to another cycle 20 of affinity selection, mRNA isolation, cDNA amplification, and cloning.

6.4. PHAGEMID SCR~
Three different protocols for screening of a phagemid 25 library are presented in the subsections hereinbelow. These protocols, particularly the immobilization and binding steps, are readily adaptable to use for screening of different libraries, e.g., polysome libraries. Preferably, different methods are used in different rounds of.screening.

6 .4 .1. PLATE PROTOCOL
In this example, a protocol is presented for screening a phagemid library, in which in the first round of screening, a 35 biotinylated target protein is immobilized (by the specific binding between biotin and streptavidin) on a streptavidin PCT/US96/0422~' coated plate The immobilized target protein is then contacted with library members to select binders.

Reagent~3 URed:
5 Purified target protein, microfuge tubes, Falcon 2059, Binding Buffer, Wash Buffer, Elute Buffer, phage ~isplay Library of ~10ll pfu/Screened Target, fresh overnight cu:Ltures of appropriate host cells, LB Agar plates with antibioti.cs as needed, biotinylating agent NHS-LC-Biotin (Pierce Cat.
lO #21335), streptavidin, 50 mM NaHCO3 pH 8.5, 1 M Tris pH 9.1, M280 Sheep anti-mouse IgG coated Dynabeads (Dynal), pho;phate buffered saline (PBS), Falcon 1008 petri dishes.

Wa~h Buffer = lX PBS (Sigma Tablets), 1 mM MgCl2, 1 mM CaCl2, 15 0.05~ Tween 20; (For one liter: 5 PBS tablets, 1 ml 1 M MgCl2, l ml 1 M CaCl2, 0.5ml Tween 20, nanopure ~2~ to 1 liter).

Binding Buffer = Wash Buffer with 5 mg/ml bovine serum albumin (BSA).
Elute Buffer = 0.1 N HCl adjusted to pH 2.2 with glycine:
1 mg/ml BSA.

Procedure:
25 Protein Biotinylation:
l. Wash 50-lO0 ~g of target protein in 50 mM NaHCO~ pH 8.5 in a Centricon (Amicon) of the appropriate molecular weight cut-off.
2. Bring the total volume to 100 ~l with 50 mM NaHCO3 pH
30 8.5.
3. Dissolve l mg of NHS-~C-Biotin in 1 ml H2O. Do not ~3tore this solution.
4. Immediately add 37 ~l of the NHS-LC-Biotin solution to the target protein and incubate for 1 hr at room temperature 35 (RT).

WO 96/30849 PcTlus9fl~)12~9 5. Remove the unreacted biotin by washing 2X PBS in a Centricon (Amicon) of the appropriate molecular weight cutoff. Store the biotinylated protein at 4~C.

5 Coating a 1008 Plate with Streptavidin:
6. The night before the binding experiment precaat a 1008 plate with streptavidin.

7. Add 10 ~g of streptavidin (1 mg/ml H20) per 1 ml of 50 mM
NaHC03 pH 8.5.
lO 8. Add 1 ml of this solution to each plate and place in a humidified chamber overnight at 4~C.

Prebinding; Blocking Non-Specific SiteR:
9. To a streptavidin coated plate add 400 ~l of Binding 15 Buffer (BSA blocking) for one hour at room temperature.
10. Rinse wells six times with Wash Buffer by slapping dry on a clean piece of labmat.

B;~ ; Specific Target/Phage ComplexeR Round 1:
20 ll. Add 10 ~g of biotinylated target protein in 400 ~l of Binding Buffer to the well and incubate for 2 hr at 4~C.
12. Add ~ ~l of 10 mM biotin and swirl for 1 hr at 4~C.
~13. Wash as in step lO.
14. Add concentrated phage library (~10ll pfu) in 400 ~l of 25 Binding Buffer and swirl overnight at 4~C.

Washing and Elution:
15. Slap out binding mixture and wash as in step lO.
16. To elute bound phage add 400 ~1 of Elution Buffer and 30 rock at RT for 15 min.
17. Transfer the elution solution to a sterile 1.5 ml tube which contains 75 ~l of 1 M Tris pH 9.1. Vortex briefly.

Amplification of Round 1 Eluted Phage:
35 18. Plate all of the eluted round 1 phage by adding 157 ~1 Gf phage to 200 ~l of cells incubated overnight (previously checked free of contAm;nAtion) in three aliquots. Incubate 25 min in a 37~C water bath and then spread onto LB
agar/antibiotics plate containing 2~ glucose.
19. Scrape plates with 5 ml of 2XYT (growth broth)/
Antibiotics/Glucose and leave swirling for 30 min at RT.
5 20. Add the appropriate amount of 2XYT/Antibiotics/Gluc:ose to bring the O.D. 600 down to 0.4 and then grow a~ 37~C at 250 rpm until the O.D. 600 reaches 0.8.
21. Remove 5 ml and add to it 1.25 x lolO M13 helper phage.
22. Shake 30 min at 150 rpm and then 30 min at 250 rpm at 10 37~C.
23. ~entrifuge lo min at 3000 X g at RT.
2g. ~esuspend cells in 5 ml 2XYT with no glucose. (This step removes glucose).
25. Centrifuge as in step 23 and resuspend in 5 ml 2XYI' with 15 kanamycin and the appropriate antibiotics (no glucose). Spin 18 hr at 37~C and 250 rpm.
26. Pellet cells at lo,OoO X g and sterile filter the phage containing supernatant which is now ready for round 2 screening.
20 27. Titer the round 1 eluted phage stocks.

B;n~;ng; Specific Target/Phage Complexe6 Round~ 2-5:
6. Combine ~l ~g of biotinylated target protein with the eluted and titered round 1 phage (109 pfu) in 200 ~1 of 25 Binding Buffer and rock 4 hr at 4~C.
7. The night before the round 2 screening is started, prewash 200 ~l/target protein to be screened of sheep anti-mouse IgG magnetic beads (M280 IgG Dynabeads) with 2X 1 ml of Wash Buffer using the Dynal Magnet. Let the beads collect at 30 least 1 min before ~e,.,oving the buffer. ~et the beads stand 15 sec to allow residual Binding Buffer to collect and r~emove with a P200 Pipetman.

8. Resuspend the washed beads in 200 ~1 of B;n~;ng Buffer and add 100 ~1 of mouse anti-biotin IgG,(Jackson IRL). ~Rock ~ 35 o~ernight at 4~C.
10. Wash the unbound anti-biotin IgG from the Dynabeads by placing them on the Dyna magnet for at least 1 min and r e,.,o~e -PCT/U~g5'~ 1229 all liquid as in Step 7. Remove the tube from the magnet and resuspend the beads in l ml of Wash Buffer, rock at 4~C for 30 min, and return to the magnet. Again let the beads pellet for 1 min; repeat this process 3 more times and resuspend the 5 beads in 400 ~l of Binding Buffer.
lOa. The coated beads are now ready for use (100 ~l/round/target protein). The remainder can be stored for use for up to 2 weeks.
11. Add the 100 ~l of anti-biotin coated Dynabeads (Step 10) 10 to the protein/phage fraction (Step 9) bringing the total binding volume to 300 ~l and rock for 2 hr at 4~C. Ensure that the beads mix thoroughly with the phage/protein solution.

15 washing and Elution:
12. Place the binding reaction into the Dynal magnet and let sit for 1 min.
13. Remove the solution using a PlO00 Pipetman and discard.
Let the beads stand 15 sec to allow residual binding buffer 20 to collect and remove with a P200 Pipetman. Note serial dilution depends upon all residual liquid being removed (i.e., 5 ~l into 5C0 is lOOX washing; 50 ~l into 500 is only lOX).
14. Remove the tube from the magnet and resuspend the beads 25 in 750 ~l of Wash Buffer and return to the magnet. Again let the beads pellet by waiting l min.
15. ~emove the Wash solution as in Step 7 and repeat this process several more times.
16. After the removal of the final wash, resuspend the beads 30 and transfer them to a fresh, labeled tube and wash once more.
17. To elute bound phage, add 400 ~l of Elution Buffer, titr~te and rock for 14 min at RT.
18. Place the tube on the magnet for one minute and transfer 35 the eluate to a sterile 1.5 ml tube which contains 75 ~l of M Tris pH 9.1. Vortex briefly.

Amplification of ~ound 2-5 Eluted Phage;
15a. Plate 10 ~l and 100 ~l of round 2,3,4 eluates using 200 ~l of contamination free (previously tested) E. coli X~lBlue cells onto each plate containing ; 5 tetracycline/ampicillin/glucose and tetracycline/ampicillin and amplify as in Steps 17-25.

6.4.2. BIOTIN-ANTIBIOTIN I~G BEAD PROTOCOL
In this example, a protocol is presented for screen:i~g a 10 phagemid library, in which a biotinylated target protein is immobilized (by the specific binding between anti-biotin antibodies and ~iotin) on a magnetic bead containing ant:i-biotin antibodies on the bead surface. The immobilized target protein is then contacted with library members to 15 select binders.

Reagent~ Used:
M280 Sheep anti-Mouse IgG coated Dynabeads (Dynal) 20 Binding; Specific Target/Phage Complexes Round 1:
6. Combine 10 ~g of biotinylated target protein with the phage library (~10l~ pfu) in 400 ~l of Binding Buffer and rock overnight at 4~C.
7. That same night prewash 50 ~l sheep anti-mouse IgG
25 magnetic beads (M280 IgG Dynabeads) with S00 ~l of Binding Buffer twice using the Dynal Magnet. Let the beads collect at least 1 min before removing the buffer. Let the beads stand 15 sec to allow residual binding buffer to collect and remove with a P200 Pipetman.
30 8. Resuspend the washed beads in 100 ~l of Binding Bufi.er and add 33 ~l of mouse anti-biotin IgG (40 ~g, Jackson I~).
Rock overnight at 4~C.
9. Remove unbound protein from the phage/protein reacti.on in Step 6 with a Microcon 100. Spin at 800 X g until 35 exclusion volume is met and wash twice with Wash Buffer (again at 800 X g). Collect phage/protein with a Pipetman and add an additional 50 ~l of Wash Buffer to the Microcon, WO 96/30849 PCT/U~ '79 gently titrate and combine with first fraction to ensure maximal recovery.
10. Wash the unbound anti-biotin IgG from the Dynabeads by placing them on the Dyna magnet for at least 1 min and remove 5 all liquid as in Step 7. Remove the tube from the magnet and resuspend the beads in 750 ~1 of Wash Buffer, roc~ at 4~C for 30 min, and return to the maynet. Again, let the beads pellet for 1 min; repeat this process 3 more times and resuspend the beads in 100 ~1 of Binding Buffer.
10 11. Add the anti-biotin coated Dynabeads (Step 10) to the protein/phage fraction ~Step 9), bring the total binding volume to 500 ~1 with Binding Buffer, and rock for 2 hr at RT. Ensure that the beads mix thoroughly with the phage/protein solution.
Washin~ and Elution:
12. Place the binding reaction into the Dynal magnet and let sit for 1 min.
13. Remove the solution using a P1000 Pipetman and discard.
20 Let the beads stand 15 sec to allow residual binding buffer to collec~ and remove with a P200 Pipetman. Note that serial dilution depends upon all residual liquid being removed (i.e., 5 ~1 into 500 is lOOX washing; 50 ~1 into 500 is only lOX).
25 14. Remove the tube from the magnet and resuspend the beads in 750 ~1 of Wash Buffer and return to the magnet. Again let the beads pellet by waiting 1 min.
15. Remo~e the wash solution as in Step 7 and repeat this process 3 more times.
30 16. After the remo~al of the fourth wash, resuspend the beads and transfer them to a fresh, labeled tube and wash once more.
17. To elute bound phage, add 400 ~1 of Elution Buffer, titrate and rock for 14 min at RT.
35 18. Place the tube on the magnet for one minute and transfer the eluate to a sterile 1.5 ml tube which contains 75 ~1 of 1 M Tris pH 9.1. Vortex briefly.

W O9~'3 8~ PCTrUS96/04229 ~umplification of Ro ~ d 1 Eluted Phage:
17. Plate all of the eluted round 1 phage by adding 157 ~l of phage to 200 ml o~ cells incubated overnight (previously checked to be free of contamination) in three aliquots.
5 Incubate 25 min in a 37~C water bath and then spread onto LB
agar/antibiotics plate containing 2~ glucose. Place plat:es upright in 37OC incubator until dry and then invert and incubate overnight.
18. Scrape plates with 5 ml of 2XYT/Antibiotics/Glucose and 10 leave swirling for 30 min at RT.
19. Add the appropriate amount of 2XYT/Antibiotics/Glucose to bring the O.D. 600 down to 0.4 and then grow at 37~C at 250 rpm until the O.D. 600 reaches 0.8.
20. Remove 5 ml and add to it 1.25 x 10l~ M13 helper phage 15 21. Shake 30 min at 150 rpm and then 30 min at 250 rpm at 37OC.
22. Centrifuge lO min at 3000 X g at RT.
23. Resuspend cells in 5 ml 2XYT with no glucose. (This step removes glucose) 20 2~. Centrifuge as in step 23 and resuspend in 5 ml 2XYT with kanamycin and the appropriate antibiotics (no glucose). Spin 18 hr at 37~C and 250 rpm.
25. Pellet cells at 10,000 xg and sterile filter the phage-containing supernatant which is now ready for round 2 25 screening.

B; n~; ng; Specific Target/Phage Complexes Round 2, 3, ~ 4:
6a. Bind l ~g of target protein with 100 ~l of amplified phage from the previous round as before, overnight at 4~C.
30 7a. Prepare the IgG anti biotin/anti IgG beads as in Steps 7-10 using, however, only 20 ~l of sheep anti-mouse IgG and 13 ~l of anti-biotin IgG.
8a. All other binding procedures are identical with Steps 6-11 .

W096/30849 PCT~S96/04229 Washing and Elution:

9a. Place the binding reaction into the Dynal magnet and let sit for 1 min.

lOa. Remove the solution and discard using a P1000 Pipetman.

5 Let the beads stand 30 sec to allow residual Binding Buffer to collect and remove with a P200 Pipetman.
lla. ~emove the tube from the magnet and resuspend the beads in 750 ~1 of Wash Buffer and return to the magnet. Again let the beads pellet by waiting 1 min.
10 12a. Remove the wash solution as in Step lla and repeat this process 3 more times.
13a. After the removal of the fourth wash, resuspend the beads and transfer them to a fresh, labeled tube and wash 4 more times.
15 14a. Elute and neutralize as in Step 15.

Amplificatio~ of Round6 2, 3, ~ 4 Eluted Phage:

15a. Plate 10 ~1 and 100 ~1 of round 2,3,4 eluates and amplify as in Steps 17-25.

6.4.3. BIOTIN-STREPT~VIDIN, MAGNETIC

BEAD PROTOCOLS

In this example, a protocol is presented for screening a phagemid library, in which a biotinylated target protein is 25 immobilized (by the specific binding between biotin and streptavidin) on a streptavidin coated magnetic bead. The immobilized target protein is then contacted with library members to select binders.

30 Reagents Used Purified target protein, M280 streptavidin coated Dynabeads (Dynal) B;nAin~; Specific Target/Phage Complexes Round 1:
35 6. Combine 10 ~g of biotinylated target protein with the phage library (~101~ pfu) in 400 ~1 of Binding Buffer and rock overnight at 4~C.

7. Remove un~ound protein with a Microcon 100. Spin al_ 800 X g until exclusion volume is met, and wash twice with u Wash Buffer (again at 800 X g). Collect phage/protein wi~h a Pipetman and add an addition 50 ~l of Wash Buffer to the 5 Microcon, gently titrate and combine with the first fraction to ensure maximal recovery.
8. Prewash 50 ~l tper reaction) of streptavidin magnetic beads (M280 streptavidin Dynabeads) twice with 500 ~l of Washing Buffer using the Dynal magnet.
10 9. Add the prewashed Dynabeads to the protein/~hage fraction (add Binding Buffer to a total of 500 ~l) and rock for 30 min.
Ensure that the beads mix thoroughly with the phage/protein solution.

15 Washing and Elution:
10. Place the binding reaction into the Dynal magnet and let sit for 1 min.
11. Remove the solution using a P1000 Pipetman and discard.
Let the beads stand 15 sec to allow residual Binding Buffer to 20 collect and remove with a P200 Pipetman. Note that serial dilution depends upon all residual liquid being removed (i.e., 5 ~l into 500 is lOOX washing; 50 ~l into 500 is only lOX).

12. Remove the tube from the magnet and resuspend the beads in 750 ~l of Wash Buffer and return to the magnet. Again let 25 the beads pellet by waiting 1 min.

13. Remove the wash solution as in step 11 and repeat this process 3 more times.

14. After the removal of the fourth wash, resuspend the beads and transfer them to a fresh, labeled tube and wash once more.
30 15. To elute bound phage add 400 ~l of Elution Buffer, titrate and rock for 14 min at RT.
1~. Place the tube on the magnet for one minute and transfer the eluate to a sterile 1.5 ml tube which contains 75 ~l of 1 M Tris pH 9.1. Vortex briefly.

-WO 96/30849 PCI~/US!l~ 9 Amplification of Round 1 Eluted Phage:
17. Plate all of the eluted round 1 phage by addin~ 157 ~1 of phage to 200 ~1 of overnight cells (previously checked to be 'free of contamination) in three aliquots. Incubate 25 min in 5 a 37~C water bath and then spread onto LB agar/antibiotics plate containing 2~ glucose. Place plates upright~in 37~C
incubator until dry and then invert and incubate overnight.
18. Scrape plates with S ~1 of 2XYT/Antibiotics/Glucose and leave swirling for 30 min at RT.
10 19. Add the appropriate amount of 2XYT/Antibiotics/Glucose to bring the O.D. 600 down to 0.4 and then grow at 37~C at 250 rpm until the O.D. 600 reaches 0.8.
20. Remove 5 ml and add to it 1.25 x 101~ M13 helper phage.
21. Shake 30 min at 150 rpm and then 30 min at 250 rpm at 15 37~C.
22. Centrifuge lo min at 3000 X g at RT.
23. Resuspend cells in 5 ~1 2XYT with no glucose. (This step removes glucose).
24. Centrifuge as in step 22 and resuspend in 5 ml 2XYT with 201;anamycin and the appropriate antibiotics (no glucose). Shake 18 hr at 37OC and 250 rpm.
25. Pellet cells at lo,000 X g and sterile filter the phage containing supernatant which is now ready for round 2 screening.
R; n~; n~; Specific Target/Phage Complexes Round 2, 3, & 4:
6a. Combine 1 ~g of biotinylated target protein with 100 ~1 of the previous round's phage (~109 pfu) in 400 ~1 of Binding Buffer and rock overnight at 4~C.
30 7a. Remove unbound protein with a Microcon 100. Spin at 800 X g until exclusion ~olume is met and wash twice with Wash Buffer (again at 800 X g). Collect phage/protein with a Pipetman and add an addition 50 ~1 of Wash Buffer to the Microcon, gently titrate and combine with the first fraction 35 to ensure maximal recovery.

W096/30849 PCT~S96/04229 8a. Prewash 20 ~1 (per reaction) of streptavidin magnetic beads (M280 streptavidin Dynabeads) twice with 500 ~1 o~
Washing Buffer using the Dynal magnet.
9a. Add the prewashed Dynabeads to the protein/phage fraction 5 and rock for 30 min. Add Binding Buffer to a total of 500 ~1.
Ensure that the beads mix thoroughly with the phagelprotein solution.

W~ ~; ng and Elution:
10 10a. Place the binding reaction into the Dynal magnet and let sit for 1 min.
lla. Remove the solution and discard using a P1000 Pipetman.
Let the beads stand 30 sec to allow residual Binding Buffer to collect and remove with a P200 Pipetman.
15 12a. Remove the tube from the magnet and resuspend the beads in 750 ~1 of Wash Buffer and return to the magnet. Again let the beads pellet by waiting 1 min.
13a. Remove the wash solution as in Step lla and repeat this process 3 more times.
20 l~a. After the removal of the fourth wash resuspend the beads and transfer them to a fresh, labeled tube and wash 4 more times.
15a. Elute and neutralize as in Step 15.

25 Amplification o~ Round~ 2, 3, & 4 Eluted Phage:

16a. Plate 10 ~1 and 100 ~1 of round 2,3,4 eluates and amplify as in Steps 17-25.

6.5. A~ Y MEASU~FM~NTS OF

PEPTIDE-TARGET PROTEIN INTERACTIONS

Once peptides that bind to a target protein have been identified, the affinities of these peptides to their respective targets are measured by measuring the dissociation constants (~) of each of these peptides to their respective 35 targets. Oligonucleotides that encode the peptides are constructed so as to encode also an epitope tag fused to the peptide (for example, the myc epitope) that can be detected by W096/30849 PCT~S96/04229 a commercially available antibody. These oligonucleotides are incubated with polysome extracts to produce the peptide tagged with the epitope. Binding of the target protein to the peptide is done in solution, and separation of the bound 5 peptide from the unbound peptide is done by immunoaffinity purification using an anti-target protein antibod~. This immunoaffinity purification is done by a modified ELISA
(enzyme-linked immunosorbent assay) protocol, in which the target protein-peptide mixture is exposed to the anti-target 10 protein antibody immobilized on a solid support such as a nitrocellulose memhrane, and the unbound peptide is then washed off. In this protocol, the concentration of the target protein is varied and then the amount of bound peptide is estimated by detecting the epitope tag on the peptide by use 15 of anti-epitope antibody. In this manner, the affinity of each peptide for its target protein can be determined.

6.6. REDOR MEASUREMENTS ON A CX~C ~llvE RESIN
This example demonstrates successful synthesis and 20 cyclization of a CX6C peptide resin of greater than 95~ purity and with a labeled glycine followed by successful REDOR
distance measurements on the CX6C peptide resin using the preferred REDOR methods of this invention. The labeled peptide used was 25 Cys-Asn-Thr-Leu-Lys-(1sN-2-l3C)Gly-Asp-Cys-Gly-mBHA resin, where a glycine linker attached the peptide of interest to the nBHA
resin. (Cys-Asn-Thr-Leu-Lys-Gly-ASp-Cys-Gly = SEQ ID NO:10) The peptide resin was synthesized by solid phase synthesis on p-MethylBenzhydrilamin~ (mBHA) resin using a 30 combination of Boc and Fmoc chemi5try. MethylBenzhydrilamine resin (Subst. 0.36 meq/g) was purchased from Advanced Chem Tech (Louis~ille, KY). Fmoc(~5N-2-l3C)Gly was prepared from HCl, (l5N-2-l3C)Gly (Isotec Inc., ~;~m;shurg, OH) and Fmoc-OSu.
Boc-Gly, (Trt), Fmoc-Asp(OtBu), Fmoc-Lys(Boc), Fmoc-Leu, 35 Fmoc-Thr(OtBu), Fmoc-Asn and Boc-Cy~(Acm) were purchased from Bachem ~Torrance, CA). Reagent grade sol~ents were purchased from Fisher Scientific, Diiso~Lo~lcarbodiimide (DIC), Trifluoroacetic acid (TFA) and Diisopropylethylamine (DIEA) were purchased from Chem Impex (Wooddale, IL). Nitrogen, HF
were purchased from Air Products (San Diego, CA).
The first step 43 was the synthesis of 5 Boc-Cys(ACM)-Asn-ThrtOtBu)-Leu-Lys~Boc)-Gly-Asp(OtBu~-Cys(Trt)-Gly-mBHA resin. l.llg (0.40 meq) of mBHk resin were placed in a 150 ml reaction vessel (glass filter at the bottom) with Methylene Chloride (CHzCl2) ["DCM"] and stirred 15 min with a gentle bubbling of Nitrogen in order to swell the 10 resin. The solvent was drained and the resin was neutra:Lized with DIEA 5~ in DCM (3X2 min). After washes with DCM, the resin was coupled 60 min with Boc-Gly (0.280 g-1.6 meq-4 fold excess-0.lM) and DIC (0.25 ml-1.6 meq-4 fold excess-0.lM~ in DCM. Completion of the coupling was checked with the 15 Ninhydrin test. After washes, the resin was stirred 30 min in TFA S5~ in DCM in order to remove the Boc protecting group.
The resin was then neutralized with DIEA 5~ in DCM and coupled with Fmoc-Cys(Trt)(0.937g-1.6 meq-4 fold excess-0.lM) and DIC
(0.25 ml-1.6 meq-4 fold excess-0.lM) in DCM/DMF (50/50).
20 After washes the resin was stirred with Piperidine 20~ in DMF
(5 min and 20 min) in order to remove the Fmoc group. After washes, this same cycle was repeated with Fmoc-Asp(OtBu), Fmoc(1~N-2-13C)Gly (2 fold excess only), Fmoc-Lys(Boc), Fmoc-Leu, Fmoc-Thr(OtBu), Fmoc-Asn and Boc-Cys(Acm). After the 25 last coupling, the Boc group was left on the peptide. The resin was washed thoroughly with DCM and dried under a nitrogen stream. Yield was 1.49g (Expected: -1.7g).
The next step 44 was cyclization of the Boc-Cys-Asn-Thr(OtBu)-Leu-Lys(Boc)-Gly-Asp(OtBu)-Cys-Gly-mBHA
30 resin. 600 mg of protected peptide resin were sealed in a polypropylene mesh packet. The bag was shaken in a mixture of solvent (DCM/Methanol/Water-640/280J47) in order to swell the resin. The bag was then shaken 20 min in 100 ml of a solution of iodine in the same mixture of solvent (0.4 mg I2/ml solvent 35 mixture). This operation was performed 4 times. No decoloration was observed after the third time. The resin was WO 96130849 PCT/US96/0~229 then thoroughly washed with DCM, DMF, DCM, and methanol successively.
The last step 45 was side-chain deprotection of the Cys-Asn-Thr-Leu-Lys-Gly-ASp-Cys-Gly-mBHA resin. After 5 cyclization the resin in the polypropylene bag was reacted 1. 5 hour with 100 ml of a mixture TFA/p-Cresol-Water Tg5/2 . 5/2 . 5) .
After washes with DCM and Methanol, the resin was dried 48 hours under vacuum. Yield was 560 mg.
The resulting peptide resin was analyzed fcr its purity 10 and the presence of the disulfide bridge. 40 mg of resin were sealed in a propylene mesh packet and treated with HF at 0 C
for l hour in presence of anisole (HF/Anisole: 90/10). The scavenger and by-products were extracted from the resin with cold ethyl ether. The peptide was extracted with 10~ Acetic 15 Acid and lyophilized 36 hours. The dry isolated peptide was characterized by PDMS (mass spectrography) and HPLC (high performance liquid chromatography). This analysis demonstrated that greater than 95~ of the product peptide was of the correct amino acid composition, having a disulfide loop 20 and without inter-molecular disulfide dimers.
REDOR measurements were made on the peptide resin prepared by this method, and as a control, also on dried (lsN-2-l3C) labeled glycine. The preferred REDOR methods and parameters, as previously detailed, were used. Fig. 6 25 illustrates the ~sN resonance spectral signals obtained.
Signal 70 is the signal produced by dried glycine after no rotor periods. Signals 71, 72, 73 are glycine signals ~fter 2, 4, and 8 rotor periods, respectively. Signals 74, 75, 76, and 77 are the peptide resin signals after 0, 2, 4, and 8 30 rotor periods, respectively.
Fig. 7 illustrates the data analysis. As in Fig. 5, axis 81 is the ~S/S axis, and axis 82 is the A axis. The variables are 2S used in equation 5. Graph 83 is defined by equation 5, and is the initial rising part of the full curve shown in Fig.
35 5. Data points 84, 85, 86, and 87 are best fits of the data f~r 0, 2, 4, and 8 rotor periods, respectively. At these points, the circles represent the glycine values and the WO 9~/30~ 19 PCT/US96/04229 squares the peptide resin values. These values correspond to a C-N distance in glycine and the peptide of 1. s5 A (and a D~
of 800 Hz). Repeated measurements gave a C-N distance of 1.50 A (and a D~. of 875 Hz). The accepted distance in glycine 5 is 1.48 A. The above procedure was repeated for (l5N-1-13C) labeled glycine in Cys-Asn-Thr-Leu-Lys-(l5N-1-l3C)Gly-Asp-Cys-Gly-mBHA resin, and the measured C-N distance of 2. 50 A is in excellent agreement with the predicted value of 2.46 A .
Thus REDOR accuracy to better that 0.1 A is demonstrated.
Also demonstrated is the peptide resin as an appropriate substrate for NMR measurements. Inter-molecular dipole-dipole interactions between adjacent peptides did not interfere.
Also the overlap of the distances measured in free glycine and 15 in glycine incorporated in the peptide demonstrated that the peptide was held sufficiently rigidly by the resin that any remaining peptide motions did not interfere with the NMR
measurements.

7. SPECIFIC EMBODIMENTS, CITATION OF REFERENCES
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from 25 the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.

WO 96/30849 PCT/Ug3~6/0122 8 . L~ u l-~;K PROGRAM LISTINGS
These computer program listings are copyright 1995 of CuraGen, Inc. ~ 1995 CuraGen, Inc.

**********************
****************************************************************
START OF LISTING
***********************************************
*****************************************************************

*****************************************************************
*****************************************************************
C CODE RO~ll~S
*****************************************************************
*****************************************************************

*****************************************************************
MAKEFILE AND GO PROC
*****************************************************************

MAKEFILE:
OPTIONS=-mips2 -ansi -g -fullwarn -00 peptide.ex: random.o peptide.o peptidel.o peptide2.o peptide3.o peptide4.o \
peptide5.o peptide6.o peptide7.o cc $(OPTIONS) r~n~o~.o peptide*.o -lm -o peptide.ex random.o: random.c cc $(OPTIONS) -c random.c peptide.o: peptide.c *.h cc $(OPTIONS) -c peptide.c peptidel.o: peptidel.c *.h cc $(OPTIONS) -c peptidel.c peptide2.o: peptide2.c *.h cc $(OPTIONS) -c peptide2.c peptide3.o: peptide3.c *.h cc $(OPTIONS) -c peptide3.c peptide4.o: peptide4.c *.h cc $(OPTIONS) -c peptide4.c WO 96/30~49 PCT/US96/04229 peptides.o: peptide5.c t, h cc $(OPTIONS) -c peptide5.c peptide6.o: peptide6.c *.h cc $(OPTIONS) -c peptide6.c peptide7.o: peptide7.c *.h cc $(OPTIONS) -c peptide7.c GO PROC:
peptide.ex c~ EOF
O .1 CGG&GGGC
EOF

*t**********************t**************************************t MAIN PROGRAM ~ VE.C
****************************************************************

#de~ine MAIN
#include llpeptide.h"
/* The main program stub */
void main(int argc, char *argv[], char *envp[]) {

logical *cyclic;
int n_peptides, max_atoms_per_unit;
int *n_amino_acids, *n_atoms_total, *n_side, *n_main;
rigid_unit **peptide torsion_list **torsion hbond_list **hbond;
atom_list **atom, **atom2;
atom_info **atom_tmp vector *twig[KMAX]
int ***bond_table ~ string *sequence int i, j;
int list_num, max_atoms_total double seed;
regrowth **main, **side;
printf("Enter random number seed ");

CA 022l6994 1997-09-30 W096/30849 PCT~S96/04229 scanf(ll~lf'', &seed);
ran2(seed);
/* get linear sequences */
get_sequence(&sequence, &n_peptides);
printf("\n");
/* allocate memory for arrays */
if ((peptide = (riyid_unit **) malloc(n_peptides*sizeof(rigid_unit *))) == NULL) out_of_memory();
if ((torsion = (torsion_list **) malloc(n_peptides*sizeof(torsion_list *))) == NULL) out_of_memoryt);
if ((hbond = (hbond_list **) malloc(n_peptides*sizeof(hbond_list *)))==NULL) out_of_memory();
if ((atom = (atom_list *t) malloc(n_peptides*sizeof(atom_list *))) == NULL) out_of_memory();
if ((atom2 = (atom_list **) malloc(n_peptides*sizeof(atom_list *))) == NULL) out_of_memory();
if ((atom_tmp = (atom_info**) malloc(n_peptides*sizeof(atom_info =-*) ) ) == NULL) out_of_memory();
if ((main = (regrowth **) malloc(n_peptides*sizeof(regrowth *))) == NULL) out_of_memory();
if ((side = (regrowth **) malloc(n_peptides*sizeof(regrowth *))) == NULL) out_of_memory();
if ((bond_table = (int ***) malloc(n_peptides*sizeof(int **))) == NULL) out_of_memory();
if ((n_amino_acids = (int *) malloc(n_peptides*sizeof(int))) ==
NULL) out_of memory();
if ((n_atoms_total = (int *) malloc(n_peptides*sizeof(int))) ==
NULL) out_of_memory();

if ((cyclic = (logical *) malloc(n_peptides*sizeof(logical))) ==
NULL) out_of_memory();
if ((n_main = (int *) malloc(n_peptides*sizeof(int))) == NULL) out_of_memory();
if ((n_side = (int *) malloc(n_peptides*sizeof(int))) == NULL) out_of_memory();
for(i=O; icn Peptides; i++) {
n_amino_acids[i] = (int) strlen(sequence[i]) }
/* read in. parameter files */
read_torsion_data();
read_l]_data();
read_hbond_data();
max_atoms Per-unit = O;
/~ read in geometric sequence information */
max_atoms_total = O;
for (i=O; icn_peptides; i++) {
peptide[i] = read_peptide_data(sequence[i], &n_atoms_total[i], &max_atoms_per_unit);
cyclicti] = (n_amino_acids[i] > 1) && (sequence[i][O] == 'C') &&
(sequence[i][n_amino_acids[i]-1]=='C~);
if (cyclic[i]) peptide[i] = modify_cystine_ends(peptide[i], n_amino_acids[i], &n_atoms_total[i]);
if (n_atoms_total[i]~max_atoms_total) max_atoms total n_atoms_total[i];
n main[i] = (cyclicti]) ? 2*n_amino_acids[i] + 3 2*n_amino acids~i] + 1;
n_sideti] = n_amino_acidsti];
}

/* allocate sub arrays */
~ for (i=O; icKMAX; i++) i f ( ( t w i g t i ] = ( v e c t o r * ) : malloc(max atoms total*sizeof(vector))) == NULL) out_of_",el"o~y();
for(i=O; icn peptidesi i++) {
i f ( ( a t o m t i ] = ( a t o m _ l i s t * ) =:

malloc(n_atoms_totalti]*sizeof(atom_list))) == NULL) out_o~_memory();
i f ( ( a t o m 2 [ i ] = ( a t o m _ 1 i s t * ) malloc(n_atoms_total[i]*sizeof(atom_list))) == NULL) out_of_memory();
i f ( ( a t o m _ t m p [ i ] = ( a t o m _ i n f o * ) malloc(n_atoms_totalti]*sizeof(atom_info))) == NULL) out_of_memory();
if ((mainti] = (regrowth *) malloc(n_main[i]*sizeof(regrowth))) == NULL) out_of_memory();
if ((sideti] = (regrowth *) malloc(n_side~i]*sizeof(regrowth))) == NULL) out_of_memory();
i f ( ( b o n d _ t a b 1 e [ i ] = ( i n t * * ) malloc(n_atoms_total[i]*sizeof(int *))) == NULL) out_of_memory();
for (j=0; j~n_atoms_total[i]; ~++) i f ( (b o n d_ t ab l e [i] [j ] = (i n t *) malloc(MAX_BONDS*sizeof(int))) == NULL) out_of_memory();
}
/* loop over all peptides */
for (i=0; i~n_peptides; i++) {
get_main_side(peptide[i], main[i], side[i], &n_main[i~, &n_side[i]);
/* determine connections */
initialize_connection_table(bond_table[i], n_atoms_total[i]);
list num = 0;
make_connection_table(bond_tableti], &list_num, peptide[i], peptide[i]);
/*print_connection_table(bond_table[i], n_atoms_total[i]);*/
list_num = 0;
/* assign noncoordinate information in atom array */
assign_atom_pointers(&list_num, peptideti], peptideti], atom[i]);
/* get H-bonds and torsion lists ~/
get hbonds(~hhonAti]~ atomti], n_atoms_total[i]);
/*print_hbonds(hbondti], atomti]);*/

.

~ list_num = o;
torsion[i] = NULL;
get_torsions(&torsion[i], bond_table[i], &list_num, at:om[i], peptideti], peptide~i]);
~, assign lj Parameters(peptide[i], peptide[i]);
/* copy noncoordinate information in atom to atom2 */
for (j=O; jcn_atoms_total[i]; j++) atom2[i][j] = atom[i][j];
}

/* do the Monte Carlo */
do_mc(peptidetO], torsion[O], h~ond[O], atom[O], atom2[0], atom_tmp[o], twig, main[O], side[O], n_amino_acids[O], n_atoms_total[O], n_main[O], n_side[O], cyclic[O]);
/*print_torsions(torsion[O], atom[O]);*/
write_car_file(n_amino_acids[O], n_atoms_total[O], alom[O], "test.car");
}

#undef MAIN

**********************************************************.~******
INPUT/Oul~ul RO~llN~S ~ ~El.C
*********~************************************************.~******

/* input/output routines */
#include "peptide.h"
/* hardcoded AMBER rules have the keyword AMBER nearby */
#define NT CT DISTANCE 1.47SO
#define S_S DISTANCE 2.0380 #define P_CHARGE O.048 #define C_CHARGE1 -O.098 #define C_CHARGE2 0.050 #define C CHARGE3 0.050 #define C CHARGE4 0.824 #define C CHARGE5 -0.405 #define C CHARGE6 -0.405 /* This function is called when out of memory */

W O 96/30849 PC~rrUS96/04229 void out_of_memory(void) {

printf(~'Out of memory error\n");
exit(1);
}

/* This routine returns the 1-letter amino acide seguences */
void get_seguence(striny *tseguence, int *n_peptides) {
#define SEQUENCE_LENGTH 80 int i;
printf("Enter number of peptides: ");
scanf("~d", n_peptides);
if ((*seguence = (string *) malloc(*n_peptides*sizeof(string))) == NULL) out_of_memory();
for (i=0; i~*n_peptides; i++) i f ( ( ( * s e g u e n c e ) [ i ] = ( s t r i n g ) malloc(SEQUENCE_LENGTH*sizeof(char))) == NULL) out_of_memory();
for (i=0; i~*n_peptides; i++) {
printf("Enter peptide seguence ~d: ",i);
scanf(''~sll, (*sequence)[i]);
) #undef SEQu~N~_LENGTH
}

/* read in the data files associated with this seguence */
rigid_unit *read_peptide_data(string seguence, int *n_atoms_total, int *max_atoms_per_unit) {

int i, n_amino_acids;
char name[]="?.dat";
acid_label label;
Figid_unit *ul, *u2, *ret;

/* check amino acids in seguence */
n_amino_acids = strlen(sequence);
~or(i=0; i~n_amino_acids; i++) {

W096/30849 PCT~S96/04229 label = amino_acid_code(sequence[i]);
if (label == BAD) {
printf(l'Invalid amino acid code ~c\n" sequence[i]);
exit(1);
}

if (label == P) {
printf("Proline not yet supported\n");
exit(1);
}
}

*n_atoms_total = O;
/* add unit A */
label = amino_acid_code(sequence[O])i ul = read_unit("unitA.dat", label, O, n_atoms_total max_atoms per_unit);
ret = ul;
for(i=O; i~n_amino_acids; i++) {
name[O] = sequence[i];
label = amino_acid_code(sequence[i]);
/* add unit B */
u2 = read_unit("unitB.dat" label i n_atoms_total, max_atoms per_unit);
u2-~type = nonCunit;
/* follow IUPAC naming rules if glycine */
if (label == G) strcpy(u2-~atom[l].name, "HA1");
/* follow AMBER charge rules if alanine or proline */
if (label == A ¦¦ label == P) u2-~atom[l].charge = P_CHARGE;
if (i==O) u2-~head.axis = vector_scale(u2-~head.axis, NT_CT_DISTANCE);
couple_unit(ul,u2);
ul = u2;
/* add residue */
u2 = read_unit(name, label i, n_atoms_t:otal, max_atoms_per_unit);
couple_unit(ul, u2);
/* add unit C or D */
u2 = read_unit((i==n_amino_acids-1) ? "unitD.dat"
"unitC.dat", label, i, n_atoms_total, max_atoms per_unit);

if (i c n_amino_acids-1) {
/* align incoming and outgoing bonds */
u2-~bond[O]-~tail.axis = vector_scale(u2-~head.axis, 1.0);
u2-~type = Cunit;
label = amino acid code(sequence[ill]);
u2-~atom[2].residue = u2-~atom[3].residue = label;
u2-~atom[2].residue_num = u2-~atom[3].residue_num = i+1;
}
couple unit(ul, u2);
ul = u2;
}

return(ret);
}

/* This routine reads in a rigid unit data file */
rigid_unit *read_unit(string file acid_label label int residue_num, int *n_atoms_total int *max_atoms_per_unit) {

#define LINB_LEN 200 FILE ~fp;
int i, j, k! il, n_rigid_units;
char stmpl[NAME_LENGTH], stmp2[NAME_LENGTH], line[LINE_LEN];
rigid_unit **utmp;
if ((fp = fopen(file, "r")) == NULL) {
printf("Data file ~s does not exist\n", file);
exit(1);
}

/* read in number of rigid units */
getline(line, LINE_LEN, fp);
sscanf(line, "~d", &n_rigid_units);
/* printf(ll~d\n~,n_rigid_units); */
if ((utmp = ~rigid_unit **) malloc(n_rigid_units*sizeof(rigid_unit *))) == NULL) out_of_memory();
/* allocate rigid unit */
for (i=O; i~n rigid units; i++) {
if ((utmp[i] = (rigid_unit *) malloc(sizeof(rigid_unit))) == NULL) out_of_memory();

WO 96/30849 PCI~/US9610422"
utmp~i]-~type = UNKNowN;
getline(line,LINE_LEN,fp);
sscanf(line, "~d", &utmp[i]->n_atoms);
*n_atoms_total += utmp[i]-~n_atoms;
if (utmp[i]-~n_atoms ~ ~max_atoms_per_unit) *max_atoms_per_unit = utmp[i]-~n_atoms;
/* printf("~d\n" utmp[i]-~n_atoms); */
if ((utmp[i]-~atom = (atom_info ~) malloc(utmp[i]-~n_atoms*sizeof(atom_info))) == NULL) out_of_memory()i /* read in atoms */
for(j=O; jcutmp[i]-~n_atoms; j++) {
getline(line LINE_LEN fp);
sscanf(line, "~s ~lf ~lf ~lf ~s ~d ~s ~s ~lf", utmp[i]-~atom[j].name &utmp[i]-~atom[j].position.x &utmp[i]-~atom[j].position.y, &utmp[i]-~atom[j].position.z &stmpl &il, utmp[i]-~atom[j].type, &stmp2, &utmp[i]-~atom[j].charge);
/* printf("~s ~lf ~lf ~lf ~s ~lf\n"
utmp[i]-~atom[j].name, utmp[i]-~atom[j].position.x, utmp[i]-~atom[j].position.y, utmp[i]-~atom[j].position.z, utmp[i]-~atom[j].type utmp[i]-~atom[j].charge); */
utmp[i]-~atom[j].residue = label;
utmp[i]-~atom[j].residue_num = residue_num;
}
}

for (i=O; icn_rigid_units; i++) {
/* allocate incoming bond vector information */
getline~line,LINE_LEN,fp);
sscanf(line "~d ~d ~d ~d ~d" &il &utmp[i]-~head.bond[O]
&utmp[i]-~head.bond[1], &utmpti]-~head~bond[2]~ -&utmp[i]-~head.bond[3]);
/* printf("~d ~d ~d ~d ~d\n",il utmp[i]-~head.bond[O]

utmp[i]-~head.bond[1] utmp[i]->head.bond[2]
utmp[i]-~head.bond[3]); */
for (j=4; j~MAX_BONDS; j++) utmp[i]-~head.bond[j] = -1;
utmp[i]-~head.atom_num = il;
getline(line LINE_LEN fp);
sscanf(line "~lf ~lf ~lf" &utmp[i]-~head.axis.x &utmp[i]-~head.axis.y, &utmp[i]-~head.axis.z);
/* printf("~lf ~lf ~lf\n",utmp[i]-~head.axis.x, utmp[i]-~head.axis.y utmp[i]-~head.axis.z); */

utmp[i]-~head.axis.x=utmp[i]-~atom[il].position.x-utmp[i]-~head.
axis.x;
utmp[i]-~head.axis.y=utmp[i]-~atom[il].position.y-utmp[i]-~head axis .y;

utmp[i]-~head.axis.z=utmp[i]-~atom[il].position.z-utmpti]-~head.
axis.z;
/* allocate outgoing bond pointers */
getline(line,LINE_LEN,fp);
sscanf(line "~d" &utmp[i]-~n_bonds);
if ((utmp[i]-~bond = (bond_type **) malloc(utmp[i]-~n_bonds*sizeof(bond_type *))) == NULL) out_of_memory();
for (j=0; j~utmp[i]-~n_bonds; j++) {
if ((utmp[i]-~bond[j] = (bond_type *) malloc(sizeof(bond_type))) == NULL) out of memory();
getline(line,LINE_LEN,fp);
sscanf(line "~d", &il);
/* printf("~d\n",il); */
utmp[i]-~bond[j]-~next = (il==-1) ? NULL : utmp[il];
getline(line,LINE_LEN,fp);
sscanf(line, "~d ~d ~d ~d ~d", &il &utmp[i]-~bond[j]-~tail.bond[0], &utmp[i]-~bond[j]-~tail.bond[1]
&utmp[i]-~bond[j]-~tail.bond[2], WO 96/30849 PCT/U~G/0422'3 ~utmp [ i ] - ~bond [ j ] - ~tail~bo~Ld[3~)i /* printf(~d ~d ~d ~d ~d\n" il, utmp[i]-~bondtj]-~tail.bond[O], utmp[i]-~bond[j]-,tail.boncl[1], utmp[i]-~bond[j]-~tail.boncl[2], utmp[i]-~bond[j]-~tail.boncl[3]);*/
for (k=4; k~MAX_BONDS; k++) utmp[i]-,bond[j]-~tail.bond[k]
= -1;
utmp[i]-~bondtj]-~tail.atom_num= il;
getline(line,LINE_LEN,fp);
sscanf(line, "~lf ~lf ~lf", &utmp[i]-~bond[j]-~tail.axis.x, &utmp[i]-~bond[j]-~tail.axis.y &utmp[i]-~bond[j]-~tail.axis.z);
u t m p [i ] - ~ b o n d [j ] - ~ t a i l . a x i s . x - =
utmp[i]-~atom[il].position.x;
u t m p [ i] - ~ b o n d [j ] - ~ t a i l . a x i s . y - =
utmp[i]-~atom[il].position.y;
u t m p [ i] - > b o n d [j ] - ~ t a i l . a x i s . z - =
utmp[i]-~atom[il].position.z;
utmp[i]-~bond[j]-~tail.axis =
~ ector_scale(utmp[i]-~bond[j]-~tail.axis,1.0);
}
}

fclose(fp);
return(utmp[O]);
#undef LINE_LEN
}

/* This routine couples two rigid units */ ..
~oid couple_unit(rigid_unit *unitl, rigid_unit *unit2) {

bond_type **bond;
for(bond=unitl-~bond; bondtO]-~next; bond++) ;
bondtO]-~next = unit2;
}
/* This routine turns a linear CX_nC peptide into a cyclic disulfide-bonded peptide /
rigid_unit *modify_cystine_ends(rigid_unit *unit, int:

n_amino_acids, int *n_atoms_total) {

int i;
rigid_unit *unitl, *unit2 *unit3 *unit4, *unitS *unit6;
double len;
vector headl, head2;
bond_type *btmp;
/* get new first unit */
unitl = unit-~bond[O]->nexti unit2 = unitl-~bond[O]-~next;
unit3 = unit2-~bond[O]-~next;
/* save head vectors */
headl = unitl-~head.axis;
head2 = unit2-~head.axis;
/* modify A unit to be a side group */
len = vector_length(unitl-~head.axis);
unit-~head = unit-~bond[O]-~tail;
unit-~head.axis.x *= -len;
unit-~head.axis.y *= -len;
unit-~head.axis.z t = - len;
unit-~n_bonds = O;
/* modify C_alpha head */
len = vector_length~unit2-~head.axis);
unitl-~head = unitl-~bondtO]-~tail;
unitl-~head.axis.x *= -len;
unitl-~head.axis.y *= -len;
unitl-~head.axis.z *= -len;
/* modify C_beta head */
len = vector_length(unit3-~head.axis);
unit2-,head = unit2-~bond[O]-~tail;
unit2-~head.axis.x *= -len;
unit2-~head.axis.y *= -len;
unit2-~head.axis.z *= -len;
/* modify S tail */
unit3-,bond = unit-~bond;
unit3-~head.bondt2] = -1;
unit3-,bondtO]-~tail = unit3-~head;
unit3-~bondtO]-~tail.axis = vector_scale(unit3-~head.axis, WO 9~ 0 ~ ~5 PCT/US96/04229 -1. O) i unit3-~bond[O]-~next = unit2;
unit3-~n_bonds = 1;
unit3-~n_atoms--;
(*n_atoms_total)--;
modify S head */
unit3-~head.axis = unit3-~atom[O].position;
unit3-~head.axis.x -= unit3-~atom[3].position.x;
unit3-~head.axis.y -= unit3-~atom[3].position.y;
unit3-,head.axis.z -= unit3-~atom[3].position.z;
modify C_beta tail */
unit2-~bond[O]-~tail.axis = vector_scale(head2 -1.0);
unit2-,bond[O]-,next = unitl;
modify C_alpha tail ~/
unitl-~bond[O]-~tail.axis = vector_scale(headl -1.0);
unitl-~bond[O]-,next = unit;
unit4 = unitl;
find last B unit */
~or (i=1; i~n_amino_acids; i++) {
unit4 = unit4-~bond[unit4-~n_bonds-1]-~next;
unit4 = unit4-~bond[unit4-~n_bonds-1]-~next;
}
unit5 = unit4-~bond[O]-~next;
unit6 = unit5-~bond[O]->next;
/* swap bond O and bondl for unit 4*/
btmp = unit4-~bond[O];
unit4-~bondtO] = unit4-~bond[l];
unit4-~bond[1] = btmp;
/* modify S tail */
if ((unit6-~bond = (bond_type **) malloc(sizeof(bond_type *))) == NULL) out of_memory();
if ((unit6-~bondtO] = (bond_type *) malloc(sizeof(bond_type))) == NULL) out_of_memory();
- unit6-:,head.bond[2] = -1;
unit6-~bond[O]-~tail = unit6-~head;
- unit6-~bond[O]-~next = unit3;
unit6-~n_bonds = 1;

WO 96t30849 PCT/U99 -r~, ~229 unit6-,n_atoms--;
(*n_atoms_total)--;
unit6-~bond[O]-~tail.axis = unit6->atom[3].position;
unit6-~bond[O]-~tail.axis.x -= unit6-~atom[O].position.x;
unit6-~bond[O]-~tail.axis.y -= unit6-,atom[O].position.y;
unit6-~bond[O]-~tail.axis.z -= unit6-~atom[O].position.z;
u n i t 6 - ~ b o n d [ O ] - ~ t a i 1 . a x i s vector_scale(unit6-~bond[O]-~tail.axis 1.0);
/* use AMBER S-S bond length */
unit3-~head.axis = vector_scale(unit3-~head.axis, S_S_DISTANCE);
/* modify cystine S types to obey AMBER rules */
strcpy(unit3-~atom[O].type, "S");
strcpy(unit6-~atom[O].type ''S'l);
/* modify cystine charges to obey AMBER rules */
unit2-~atom[0].charge = C_CHARGEl;
unit2->atom[1].charge = C_CHARGE2;
unit2-~atom[2].charge = C_CHARGE3;
unit3-~atom[0].charge = C_CHARGE4;
unit3-~atom[1].charge = C_CHARGE5;
unit3-~atom[2].charge = C_CHARGE6;
unit5-~atom[O].charge = C_CHARGEl;
unit5-~atom[l].charge = C_CHARGE2;
unit5-~atom[2].charge = C_CHARGE3;
unit6-~atom[O].charge = C_CHARGE4;
unit6-~atom[l].charge = C_CHARGE5;
unit6-,atom[2].charge = C_CHARGE6;
/* reassign first unit */
return(unit3);
}

/* This routine determines the main and side unit pointers */
void get_main side(rigid unit *unit, regrowth *main, regrowth *side, int *n main, int *n_side) {

rigid_unit *start, *unit2, *lastmain;
regrowth *mainO
int i;
mainO = main;

WO 96/~ C B ~5 PCT/US96/04Z29 *n_side = O
*n_main = Oi start = unit;
lastmain = NULL;
do {
main-~unit = unit;
main-~prev = lastmain;
main++;
(*n_main)++;
for (i=O; icunit-~n_bonds-1; i++) {
unit2 = unit-~bond[i]-~next;
if (unit2-~atom[O].residue != G) {
side-~unit = unit2;
side-~pre~ = unit;
side++;
(*n_side)++;
}
}

lastmain = unit;
unit = unit-~bond[i]-~next;
while (start != unit && unit-~n_bonds ~ O);
if (unit-~n_bonds == O) {
main-~unit = unit;
main-~prev = lastmain;
main++;
(*n_main)++;
else {
mainO-~prev = lastmain;
}
}

/* This routine reads in the torsion data file */
~oid read_torsion_data(~oid) {
#define LINE_LEN 200 ; FILE *fp;
char linetLINE_LEN];
- int n_torsions, itmp, i;
double ftmp;

torsion_data **data;
if ((fp = fopen("torsion.dat", ~r~)) == NULL) {
printf("Data file torsion.dat does not exist\n");
exit(1);
}

yetline(line, LINE_LEN, fp);
sscanf(line, "~d", &n_torsions);
if ((torsion_data_list = (torsion_data **) malloc((n_torsions+l)*sizeof(torsion_data *))) == NULL) out_of_memory();
data = torsion_data_list data[n_torsions] = NULL;
for (i=O; i~n_torsions; i++) {
if ((data[i] = (torsion_data *) malloc(sizeof(torsion_data))) == NULL) out_of_memory();
getline(line, LINE LEN, fp);
sscanf(line, "~lf ~d ~s ~s ~s ~s ~lf ~lf ~lf ~lf ~lf ~lf", &ftmp, &itmp, data[i]-~typel, data[i]-~type2, data[i]-~type3, data[i]->type4, &data[i]->vO[O], &data[i]->phiO[O], &data[i]->vO[1], &data[i]->phiO[l], &data[i]-~vO[2], &data[i]->phiO[2]);
data[i]->phiO[O] *= PIt180.0;
data[i]->phiO[1] *= PI/180.0;
data[i]->phiO[2] *= PI/180.0;
}

fclose(fp)i #undef LINE_LEN
}

/* This routine reads in the T-~nn~rd-Jones data file */
void read_lj_data(void) {

#define LINE_LEN 200 FILE *fp;
char line[LINE_LEN];
int n_terms, itmp, i;
double ftmp;

lj_data ~*data;
if ((fp = fopen("lj_param.dat", ~r~)) == NULL) {
printf(~Data file lj param.dat does not exist\n");
exit(1);
}

getline(line, LINE hEN, fp);
sscanf(line, "~d", &n_terms);
t i f ( ( l j _ d a t a 1 i s t = ( l j _ d a t a ~ * ) malloc((n_terms+l)~sizeof(lj_data *))) == NULL) out_of_memory();
data = lj_data_list;
data[n_terms] = NULL;
for (i=O; i~n_terms; i++) {
if ((data[i] = (lj_data ~) malloc(sizeof(lj_data))) == NULL) out_of_memory();
getline(line, LINE_LEN, fp);
sscanf(line, "~lf ~d ~s ~lf ~lf", &ftmp, &itmp, data[i]-,type, &data[i]-~ri, &data[i]-~ei);
}

fclose(fp);
#undef LINE_LEN
}

/* This routine reads in the H-bond data file */
void read_hbond_data(void) {

#define LINE_LEN 200 FILE *fp;
char line[LINE_LEN];
int n_terms, itmp, i;
double ftmp;
hbond_data **data;
if ((fp = fopen("hbond.dat", "r")) == NULL) {
printf("Data file hbond.dat does not exist\n");
exit(1);
}
getline(line, LINE_LEN, fp);
- sscanf(line, "~d", &n_terms);
if ((hbond_data_list = (hbond_data **) malloc((n_terms+l)*sizeof(hbond_data *))) == NULL) out_of memory();
data = hbond_data_list data[n_terms] = NULL;
for (i=0; icn_terms; i++) {
if ((data[i] = (hbond_data *) malloc(sizeof(hbond_data))) ==
NULL) out_of_memory();
getline(line, LINE_LEN, fp);
sscanf(line, "~lf ~d ~s ~s ~lf ~lf", &ftmp, &itmp, data[i]-~typel, data[i]-~type2, &data[i]-~a, &data[i]-~b);
}

fclose(fp);
#undef LINE_LEN
) /* write out the BIOSYM car files associated with this sequence */
void write_car_file(int n_amino_acids, int n_atoms_total, atom_list *atom, string file) {

int ii char name[NAME_LENGTH];
FILE *fp;
time_t t;
if ((fp = fopen(file, llw'')) == NULL) {
printf("Cannot open car file ~s\n", file);
exit(1);
}

fprintf(fp, "!BIOSYM archive 3\n");
fprintf(fp, ~PBC=OFF\n\n");
t = time(NULL);
fprintf(fp, "!DATE ~s", ctime(&t));
for (i=0; i~n_atoms_total; i++) {
amino acid_code_3(atom[i].p-~residue, name);
capitalize(name);
if (atomti].p-~residue_num == n_amino_acids-1) strcat(name,"N");

else if (atomti].p-~residue_num == o strcat(name,~n~
else i~ (atom[i].p-~residue == C) ~ strcat(name,"H~
fprintf(fp, "%-5s~15.9~15.9f~15.9f ~-4s ~-3d ~-2s . ~2c~8.3f\n", atomti].p-~name, ~ atom[i].position.x, atom[i].position.y, atom[i].position.z, name, atom[i].p-~residue_num+l, ~ atom[i].p-,type, atom[i].p-~typetO], atom[i].p-~charge);
}

fprintf(fp,"end\nend\n");
fclose(fp);
}

/~ this routine returns the next valid line from the file * /
string getline(string line, int len, FILE *fp) {

string ret;
do {
ret=fgets(line,len,fp);
strip(line);
} while (ret != NULL && *line=='\xO') ;
return(ret);
}

/* strip CR and LF from the end of a string also ignore everything to the right of !
*/
void strip(string string) {

for (; *string != '~xO' ~& *string != '\xA' ~& *string != '\xD' ~& *string != '!'; string++) *string = '\xO';
}
/* ~ ove commas from string, replacing with spaces /
void decomma(string string) CA 022l6994 l997-09-30 {

for (; *string != '\O'; string++) if (*string == ',') *string = ' ~;
}
/* This function capitalizes a string * / "
void capitalize(string s) {
int o;
o = 'a' - 'A';
for (; ~s; s++) if (*s ~= 'a' && *s c= 'z') *s -= o;
}

/* This function returns the 3-letter code for the amino acid */
void amino_acid_code_3(acid_label label, string code_3) {

switch (label) {
case G: strcpy(code_3, "Gly"); break;
case A: strcpy(code_3, "Ala"); break;
case V: strcpy(code_3, "Val"); break;
case L: strcpy(code_3, "Leu"); break;
case I: strcpy(code_3, "Ile"); break;
case S: strcpy(code_3, "Ser"); break;
case T: strcpy(code_3, "Thr"); break;
case D: strcpy(code_3, "Asp"); break;
case E: strcpy(code_3, "Glu")i break;
case N: strcpy(code_3, "Asn"); break;
case Q: strcpy(code_3, "Gln"); break;
case K: strcpy(code_3, "Lys"); break;
case H: strcpy(code_3, "His"); break;
case R: strcpy(code_3, "Arg"); break;
case F: strcpy(code_3, "Phe"); break;
case Y: strcpy(code_3, "Tyr"); break;
case W: strcpy(code_3, "Trp"); break;
case C: strcpy(code_3, "Cys"); break;
case M: strcpy(code_3, "Met"); break;
case P: strcpy(code_3, "Pro"); break;
default : strcpy(code_3, "???");
}

WO 96/30849 PCT/Ub~G/W229 }

/* This ~L~nction returns the 1-letter code for the amino acid */
~oid amino_acid_code_l(acid_label label, char code_1) {

switch (label) {
case G: code_1 = 'G'; break;
case A: code_1 = 'A'; break;
case V: code_1 = ~V~; break;
case L: code_1 = 'L'; break;
case I: code_1 = ~I~; break;
case S: code_1 = 'S'; break;
case T: code_1 = 'T'; break;
case D: code_1 = 'D~; break;
case E: code_1 = ~E~; break;
case N: code_1 = 'N'; break;
case Q: code_1 = ~Q~; break;
case K: code_1 = ~K~; break;
case H: code_1 = 'H'; break;
case R: code_1 = 'R'; break;
case F: code_1 = ~F~; break;
case Y: code_1 = 'Y'; break;
case W: code_l = ~W~; break;
case C: code_1 = 'C'; break;
case M: code_1 = 'M'; break;
case P: code_1 = ~P~; break;
default : code_1 = '?~;
}
}

/* This function returns the acid label from the 1-letter amino acid code */
acid_label amino acid_code(char code_1) ~. ~
acid_label ret;
switch (code_1) {
case ~G~: ret = G; break;
case ~A~: ret = A; break;
case 'V': ret = V; break;

CA 022l6994 l997-09-30 case 'L': ret = L; break;
case ~ ret = I; break;
case 'S': ret = S; break;
case 'T': ret = T; break;
case 'D': ret = D; break;
case 'E': ret = E; break;
case 'N': ret = N; break;
case 'Q': ret = Q; break;
case 'K': ret = K; break;
case 'H': ret = H; break;
case 'R~: ret = R; break;
case 'F': ret = F; break;
case 'Y': ret = Y; break;
case 'W': ret = W; break;
case 'C': ret = C; break;
case 'M': ret = M; breaki case 'P': ret = P; break;
default : ret = BAD;
}

return(ret);
}

********************~********************************************
MOLECULAR TOPOLOGY CREATION - PEPTIDE2.C
*****************************************************************

/* The topology creation routines */
#include "peptide.h"
/* This routine initializes the bond connection table */
~oid initialize_conneCtion_table(int **bond_table, int n_atoms_total) {

int i,j;
for(i=0; icn_atoms_total; i++) ~or(j=O; jcMAX_BONDS; j+l) bond_table[i][j] =
}

CA 022l6994 l997-09-30 W096/30849 PCT/U' 3G~'~,1229 /* This routine creates a connection table */
void make connection_table(int **bond_table, int *table_num, rigid_unit *unit, rigid_unit *st:art) {

~ int i, *j, il, sa~e[MAX_BONDS];
il = unit-~head.atom_num + *table num;
for (j=unit-~head.bond; *j != -1; j++) {
add_connection(bond_table, il, *j+*table_num);
add_connection(bond_table, *j+*table_num, il);
}

for (i=O; icunit-~n_bonds; i++) {
il = unit-~bond[i]-~tail.atom_num + *table_num;
for (j=unit-~bond[i]->tail.bond; ~j != -1; j++) {
add_connection(bond_table, il, *j+*table_num);
add_connection(bond_table, *j+*table_num, il);
}

save[i] = unit->bond[i]->tail.atom_num + *table_num;
}

*table_num += unit->n_atoms;
for (i=O; icunit->n_bonds; i++) {
il = unit->bond[i~->next->head.atom_num;
if (unit->bond[il->next != start) il += *table_num;
add_connection(bond_table, save[i], il);
add_connection(bond_table, il, save[i]);
if (unit->bond[i]->next != start) make_connection_table(bond_table, table_num, unit->bond[i]->next,start);
}
}

/* This routine adds a connection to the connection table */
void add_connection(int **bond_table, int il, int i2) ~ {
int *i, *ji for (i=bond_table[il]; *i != -1; i++) ;
for (j=bond table[il]; jci; j++) if (*j == i2) return;
*i = i2;
}

WO 96/30849 PCT/u~G/oq229 /* This routine prints out the connection table * /
void print_connection_table(int **bond_table int n_atoms_total) {

int i j;
for (i=0; icn_atoms_total; i++) {
printf("~5d ",i);
for (j=0; jcMAX_BONDS; j++) printf("~5d " bond_table[i][j]);
printf("\n");
}

}
/* This routine determines the torsional tenms p is set the head pointer and it returns the tail pointer */
void get_torsions(torsion_list **p int **bond_table int~table_num, atom_list *atom rigid_unit *unit rigid_unit~start) {

int i save[MAX_BONDS];
static torsion_list *q;
static int i2 *j, *k;
rigid_unit *new_unit;
if (!*p) q = NULL;
for (i=0; icunit-~n_bonds; i++) save[i] = unit-~bond[i]-~tail.atom_num + *table_num;
*table_num += unit-~n_atoms;
for (i=0; icunit-~n_bonds; i++) {
new_unit = unit-~bond[i]-~next;
i2 = new_unit-~head.atom num;
if (new_unit != start) i2 += *table_num;
for (j=bond_table[save[i]]; *j != -l; j++) for (k=bond_table[i2]; *k != -1; k++) if (*j != i2 &~ save[i] != *k) if (!*p) . *p = q = add_torsion(bond_table, atom, *j, save[i] i2,~k);
else i~ (q-~next = add_torsion(bond_table, atom, *j, WO 96/30849 PCTIU~ 2~9 save[i], i2, *k)) q = q-~next;
if (new_unit != start) get_torsions(p, bond_table, table_num, atom, new unit, start);
}
}

/~ This routine adds a torsion to the torsion list Wildcards on i and l (simultaneously) are allowed for */
torsion_list *add_torsion(int **bond_table, atom_list *atom, int i, int j, int k, int l) {

torsion_list t, *v;
char wild[]="*";
int degen, itmp;
/* count degeneracy for "general" torsions--don't count the torsion axis! */
/* "specific" torsions have a degeneracy of 1, ''generalll have a degeneracy of degen */
for (itmp=O; bond_table[j][itmp] != -1; itmp++) ;
for (degen=O; bond_table[k][degen] != -1; degen++) ;
itmp--;
degen--;
degen *= itmp;
t.degen = 1;
/* printf("~s ~s ~s ~s ~d\n", atom~i].p-~name, atom[j].p-~name, atom[k].p-~name, atom[l].p-~name, deger,); */
t.next = NULL;
- t.num[O] = i;
t.num[1] = j;
t.num[2] = k;
t.num[3] = l;
/* "specific" torsions */
if (!lookup torsion_data(atom[i].p->type, atom[j].p-~type, WO 96/30849 PCT/U' ~ i229 ~tom~k].p-,type atom[l].p-~type, &t.p)) {
/* "general" torsions */
if (!lookup_torsion_data(wild, atom[j].p-~type, atom[k].p-~type, wild,& t.p)) {
printf("Torsional data not found for ~s ~s ~s ~s\n", atom[i].p-~type, atom[j].p-~type, atom[k].p-~type, atom[l].p-~type);
return(NULL);
}

t.degen = degen;
}

/* only report nonzero torsional terms--this will screw up the 1/2 factor for AMBER! */
/* if (t.p->vO[O]==O && t.p->vO[l]==O && t.p->v0[2]==0) return(NULL); */
if ((v = (torsion_list *) malloc(sizeof(torsion_list))) == NULL) out_of_memory();
*v = t;
return(v);
}

/* This routine looks up the parameters for a torsional term in the torsion data base */
logical lookup_torsion_data(string typel, string type2, string type3, string type4, torsion_data **p) {

torsion_data **l;
for (l=torsion_data_list; *l; l++) {
if (strcmp((*l)-~typel, typel)==O && strcmp((*l)-~type2, type2)==0 &&
s t r c m p ( (* l ) - ~ t y p e 3 , t y p e 3 ) = = O & &
strcmp((*1)-~type4,type4)==0) goto done;
if (strcmp((*l)-~typel, type4)==0 && strcmpt(*l)-~type2, ~ype3 ) ==o lic&
s t r c m p ( ( * 1 ) - ~ t y p e 3 , t y p e 2 ) = = O
strcmp ( (*l~ -~type4, typel) ==0) goto done;
}

return ( FALSE );
done: i *P = *l;
return (TRUE );
}

/* This routine prints out the torsion terms */
void print_torsions (torsion_list *list atom_list *atom) {

torsion_list *t double theta;
for (t=list; t; t=t-~next) {

theta = torsion ( atom [ t - ~num [ O ] ] . pos it ion atom[t-~num[1] ] .position, a t om [ t - ~ num [ 2 ] ] . p o s i t i o n, atom[t-~num[3] ] .position);
printf (I'~4-s ~4-s ~4-s ~4-s",atom[t-~num[O] ] .p-~name, atom[t-~num[1] ] .p-~name, atom[t-~num[2] ] .p-~name, atom[t-~num[3] ] .p-~name);
/* printf ("~4-d 964-d ~4-d ~4-d",t-~num[O], t-~num[1], t-~num[2], t-~num[3] ); */
printf ~ " ~4d ", t - ~degen);
printf ( ~l~9 . 31f ~7 . 31f ~7 . 31f ~7 . 31f ~7 . 31f ~7 . 31f ~7 . 3:Lf\n~, 180 . O*theta/PI, t-~p-~vO tO], t-~p-~vO [1], t-~p-~vO [2], 180 . O*t-~p-~phiO [O] /PI, 180 . O*t-~p-~phiO [1] /PI, 180.0*t-~p-~phiO [2] /PI);

}
}

- /* This routine determines the torsional angle (in radians) defined by the 1~3 W0 96/30849 PCT/U' "~ 229 input positions--bonded in the order pl-p2-p3-p4 */
double torsion(vector pl, vector p2, vector p3, vector p4) {

vector bl, b2, b3, nl, n2;
double dot, len, theta;
/* define bond vectors */
b3.x = pl.x - p2.x; b3.y = pl.y - p2.y; b3.z = pl.z - p2.z;
b2.x = p3.x - p2.x; b2.y = p3.y - p2.y; b2.z = p3.z - p2.z;
bl.x = p4.x - p3.x; bl.y = p4.y - p3.y; bl.z = p4.z - p3.z;
b2 = vector_scale(b2, 1.0);
dot = vector_dot(bl,b2);
/* project bonds onto torsion axis */
nl.x = bl.x - dot*b2.x; nl.y = bl.y - dot*b2.y; nl.z = bl.z -dot*b2.z;dot = vector_dot(b3,b2);
n2.x = b3.x - dot*b2.x; n2.y = b3.y - dot*b2.y; n2.z = b3.z -dot*b2.z;len = vector length(nl)*vector_length(n2);
theta = vector_dot(nl,n2)/len;
/* watch out for theta=O,PI, which kill acos */
if (theta ~ l.O-EPS) theta = O.Oi else if (theta c -l.O+EPS) theta = PI;
else theta = acos(theta);
/* get proper sign on angle */
nl = vector cross(n2,nl);
if (vector_dot(nl, b2) c 0.0) theta = -theta;
return(theta);
}

/* This function assigns the lennard jones parameters */
void assign_lj parameters(rigid_unit *unit, rigid_unit *start) {
int i;
for (i=O; icunit-~n_atoms; i++) {
if (!lookup_lj data(unit-~atom[i].type, ~unit-~atom[i].ri, CA 022l6994 1997-09-30 W096/30849 PCT~S96/04229 &unit-~atomti].ei)) {
printf("Lennard-Jones parameters not found ~or atom ~s\n", unit-~atom[i].type);
exit(1);
}

}
for (i=0; i~unit->n_bonds; i++) if (unit->bond[i]-~next != start) assign_lj_parameters(unit-~bond[i]-~next, start);
}

/* This function looks up the lennard jones parameters ~or an atom */
loyical lookup_lj_data(string type, double *ri, double *ei) {

lj_data **1;
for (l=lj_data_list; *l; l++) if (strcmp((*l)->type, type)==0) {
*ri = (*l)-~ri;
*ei = (*l)->ei;
return(TRUE);
}
return(FALSE);
}

/* This routine determines the H-bonds that are in the molecule */
void get_hbonds(.~bond_list **list, atom_list *atom, int n_atoms) {

int i,j;
hbond_list t, *u, *v;
*list = NULL;
t.next = NULL;
for (i=0; icn_atoms; i++) for (j=i+1; jcn_atoms; j++) if (lookup_hbond_data(atom[i].p->type, atom[j].p-~type, &t.p)) {
t.num[0] = i;
t.numtl] = j;
- if ((v = (hbond_list *) malloc(sizeof(hbond_list))) == NULL) out_of_memory();

*v = t;
if (!*list) *list = u = v;
else {
u-~next = v;
u = u-~next;

}
}

/* This function looks up the H-bond parameters for an atom pair */
logical lookup_hbond_data(string typel, string type2 hbond_data **p) {

hbond_data **l;
for (l=hbond_data_list; ~l; l++) {
if (strcmp((*l)-~typel typel)==O && strcmp((*l)-~type2 type2)==0) goto done;
i~ ~strcmp((~ type2 typel)==O && strcmp((*l)-~typel type2)==0) goto done;
}

return(FALSE);
done: ;
*P = *l;
return(TRUE);
}

/* This function prints out the ~-bonds */
void print_hbonds(hbond_list *l atom_list *atom) {

for (; l; l=l-~next) {
printf("~s ~s ~lf ~lf\n"
atom[l-~num[O]].p-~name, atom[l-~num[l]].p-~name, l-~p-~a l-~p-~b);
}
}
/* This function assigns the atom pointers WO 96/30849 PCT/US96/042~9 */
~oid assign_atom_pointers(int *list_num, rigid_unit *unit, rigid unit *start, atom_list *atom) lnt 1;
for ~i=O; i~unit-~n_atoms; i++) atom[i+*list num].p ~unit-~atom[i];
*list_num += unit-~n_atoms;
for (i=O; i~unit-~n_bonds; i++) if (unit-~bond[i]-~next != start) assign_atom Pointers(list_num, unit-~bond[i]-~next, start, atom);
}

***********************~*****************************************
GEOMETRY CREATION ROUTINES - PEPTIDE3.C
******************************t**********************************

/* The geometry creation routines */
#include "peptide.h"
logical grow_backwards=FALSE;
/* This function creates the Rosenbluth factor for a.n old configuration */
~oid old_unit(int *list num, int nO, int nl, int n2, double *logrosen, rigid_unit *unit, rigid_unit *start, torsion_l:ist*t, hbond_list *1, atom_list *atom, vector *t.wig[], ~ector pO, ~ector bO) {
int i, ji ~ector p[MAX_BONDS], b[MAX_BONDS], pl, bl;
~ double e pl = unit-~atom[unit-~head.atom_num].position - bl = unit-~head.axis;
do_unit_sub(list_num, nO, nl, n2, logrosen, unit, t, 1, atom, . 157 WO 96/30849 PCTtUS96104229 ~wig, pl, bl, pO, bO, &e, p, b, FALSE);
for (j=O; jcunit-~n_bonds; j++) if (unit-~bondtj]-~next != start) old_unit(list_num, nO, nl, n2, logrosen, unit-~bondtj]-~next,~tart, t, l, atom, twig, p[j], b[j]);
~
/* This function creates the geometry of a peptide and the Rosenbluth factor. The growth is in one direction.
*/
void do_unit(int *list_num, int nO, int nl, int n2, double *logrosen, rigid_unit ~unit, rigid_unit *start, torsion_list *t, hbond_list *l, atom_list *atom, vector *twig[], vector pO, vector bO, double *e) {

int i, j;
vector p[MAX_BONDS], b[MAX_BONDS], pl, bl;
unit->list_num = *list_num;
pl = unit-~atom[unit-~head.atom_num].position;
bl = unit-~head.axis;
do_unit_sub(list_num, nO, nl, n2, logrosen, unit, t, l, atom,~wig, pl, bl, pO, bO, e, p, b, TRUE);
/* loop over r~m~in;ng units */
f or (j=o; j~unit-~n_bonds; j++) {
/* store side-chain regrowth info */
if (unit-~bond[j]-~next != start) do_unit(list_num, nO, nl, n2, logrosen, unit-~bond[j]-~next, start, t, l, atom, twig, p[j],~[j], e);
}
}

/* This function creates the geometry of a peptide and the Rosenbluth factor. The growth is forward.
/
void do_backbone_f(int i, int n_main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list ~l, atom_list *atom, vector *twig[], double ~e, logical new) {
int list_num, nl, n2;
vector p[MAX_BONDS], b[MAX_BONDS], pl, bl, pO, bO;
if (i==O) i+l;
pO = get_main_pO(atom, main, i);
bO = get_main_bO(atom, main, i);
main += i;
list_num = main->unit-~list_num;
nl = n2 = n_atoms total;
/t loop over backbone groups ~/
~or (; i~n_main; i++, main++) {
pl = main->unit-~atom[main->unit->head.atom_num].position;
bl = main-~unit-~head.axis;
/t add on backbone unit */
do_unit_sub(&list_num, O, nl, n2, logrosen, main-~unit, t, l, atom, twig, pl, bl, pO, bO, e, p, b, new);
if (Inew && i c n_main-l) {
pO = get_main_pO(atom, main, l);
bO = get_main_bO(atom, main, l);
} else i~ (new && i ~ n_main-l) {
pO = p[main-~unit-~n_bonds-l];
bO = b[main-~unit-~n_bonds-l];
}

/* add on side chain */
if (main-~unit-~n_bonds == 2) {
i~ (new) do_unit~&list_num, O, nl, n2, logrosen, m a i n - ~ u n i t - ~ b o n d [ O ] - ~ n e x t main-~unit-~bond[O]-~nex'c, t, l, atom, twig, p[O], b[O], e);
else - old unit(&list_num, O, nl, n2, logrosen, main- ~unit - ~bond.[ O ] - ~next, CA 022l6994 1997-09-30 W096/30849 PCT~S96/04229 ~ain-~unit-~bond[O]-~next, t, l, atom, twig, p[O], b[O]);

}
}

/* This ~unction creates the geometry of a peptide and the Rosenbluth factor. The growth is forward.
Side ch~ n~ are rigidly rotated.
*/~oid do_backbone_f_rigid(int i, int n_main, int n_atoms_total, double *logrosen, regrowth tmain, regrowth *side, torsion_list *t, hbond_list *l, atom_list *atom, atom_info *atom_tmp, vector *twig[], double *e, logical new) {
int list_num, nl, n2;
vector p[MAX_BONDS], b[MAX_BONDS], pl, bl, pla, bla, pO, bO;
logical ~alse=FALSE;

int n_atoms, j;
atom_info *q double len;
vector b2[MAX_BONDS], ~, v2;
if (i==O) i++;
pO = get_main_pO(atom, main, i);
bO = get_main_bO(atom, main, i);
main += i;
list_num = main-~unit-~list_num;
nl = n2 = n_atoms_total;
/* get first head ~ector */
p 1 = a t o m [ m a i n - ~ u n i t - ~ l i s t _ n u m f main-~unit-,head.atom_num].position;
bl = atom[main[-l].unit-~list_num +

main[-l]~unit-~bond[main[-l]~unit-~n-bonds-l]-~tail~atom-num]
.position;
bl.x = pl.x - bl.xi CA 022l6994 l997-09-30 bl.y = pl.y - bl.y;
bl.z = pl.z - bl.z;
~or (; icn-main; i++, main++) {
/~ change unit */
n_atoms = main-~unit-~n_atoms;
q = main->unit-~atom;
i~ (i c n_main-l) main-~unit-~n_atoms = main[l].unit->list_num main-~unit-~list_num;
main-~unit-~atom = atom_tmpi for (j=0; jcmain-~unit-~n_atoms; j++) main-~unit-~atom[j].position = atom[list_num+j].position;
for (j=0; j~main-~unit-~n_bond~; j++) {
b2[j] = main-~unit-~bond[j]-~tail.axis;
v = atom[main-~unit-~bond[j]-~next-~list_num +
main-~unit-~bond[j]-~next-~head.atom_num].pos tion;
v2 = atom[main-~unit-~list_num +
main-~unit-~bond[j]-~tail.atom_num].position;
v.x -= v2.x;
v.y -= v2.y;
v.z -= v2.z;
main-~unit-~bond[j]-~tail.axis = vector_scale(v,l.0);
}

/* get next head vector */
n_main-l) {
pla = atom[main[l].unit-~list_num +
main[l].unit-~head.atom_num].position;
bla = atom[main-~unit-~list_num +

main-,unit-,bondtmain-~unit-~n_bonds-l]-~tail.atom_num]
.position;
bla.x = pla.x - bla.x;
bla.y = pla.y - bla.y;
bla.z = pla.z - bla.z;

-/* add on unit */do_unit_sub(&list_num, 0, nl, n2, logrosen, main-~unit, t, 1, - atom, twig, pl, bl, p0, bO, e, p, b, new);

WO 96/30849 PCT/U' ,C/~229 /* change unit back */
main-,unit->n_atoms = n_atoms;
main-~unit-~atom = ~;
for (j=O; jcmain-~unit-~n_bonds; j++) main-~unit-~bond[j]-~tail.axis = b2[j]
/* change head vector */
if (!new && i c n_main-1) {
pO = get_main_pO(atom, main, 1);
bO = get_main_bO(atom, main, 1);
} else if (new && i c n_main-l) {
po = p[main-~unit-~n_bonds-1];
bO = b[main-~unit-~n_bonds-l];
}

pl = pla;
bl = bla;
}

}
/* This function creates the geometry of a peptide and the Rosenbluth factor. The growth is backward.
*/~oid do_backbone_b(int i, int n_main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list *l, atom_list *atom, vector *twig[], double *e, logical new) {

int list_num, nO, nl, n2, n_bonds;
vector p[MAX_BONDS], b[MAX_BONDS], bO, pO, tmp, pl, bl;
if (i == n main-1) i--;
main += i;
n2 = n_atoms_total;
bO = get_main_bO(atom, main, 1);
for (; i~=O; i--, main--) {
nl = main[l].unit-~list_num;
nO = list_num = main-~unit-~list_num;
/* get bond vectors */
p O
atom[maintl]~unit-~head.atom-num+main[l]~unit-~list-num]~position;

W096/30849 PCT/U~GJ'~229 bO.X = -bO.X; bO.y = -bO.y; bO.Z = -bO.Z;
n_bonds = main-~unit-~n_bonds;
pl = main-~unit-~atom[main-~unit-~bond[n_bonds-l]-~tail.atom_num].position;
bl = main-~unit-~bond[n_bonds-l]-~tail.axis;
,~ bl.x = -bl.x;
bl.y = -bl.y;
bl.z = -bl.z;
bl = vector_scale(bl, vector_length(main[l].unit-~head axis));
tmp = main-~unit-~bond[n_bonds-l]-,tail.axis;
main-~unit-~bond[n_bonds-l]-~tail.axis = main-~unit-~heacl.axis;
/* add on unit */
grow_backwards = TRUE;
do_unit_sub(&list_num, nC, nl, n2, logrosen, main-~unit, t, l, atom, twig, pl, bl, pO, bO, e, p, b, new);
yrow_backwards = FALSE;
main->unit-~bond[n_bonds-l]->tail.axis = tmp;
/* change head vector ~/
if (!new && i ~ O) bO = get_main_bO(atom, main-l, l);
else if (new && i , O) bO = vector_scale(b[n_bonds-l], 1.0);
/* add on side chain */
if (main-~unit-~n_bonds == 2) {
if (new) do_unit(&list_num, nO, nl, n2, logrosen, main- ,unit - ~bond [ O ] - ~next main-~unit-~bondtO]-~next, t, l, atom, twig, p[O], b[O], e);
else old_unit(&list_num, nO, nl, n2, logrosen, main- ~unit - ,bond [ O ] - ~next, main-~unit-~bond[O]-~next, t, l, atom, twig, p[O], b[O]);
}

}
/* This function creates the geometry of a peptide CA 022l6994 l997-09-30 WO 96/30849 PCT/Ub,G/01229 and the Rosenbluth factor. The growth is backward.
Side ch~ n~ are rigidly rotated.
*/
void do_backbone_b_rigid(int i, int n_main, int n_atoms_total, double *logrosen, regrowth ~main, regrowth *side, torsion_list *t, hbond_list *l, atom_list *atom, atom_info *atom_tmp, vector *twig[], double *e, logical new) {

int list_num, nO, nl, n2, n_bonds, n_atoms, j;
vector p[MAX_BONDS], b[MAX_BONDS], bO, pO, tmp, pl, bl, pla, bla, b2[MAX_BONDS], v, v2;
logical false=FALSE;
atom_info *q;
if (i == n_main-l) i--;
main += i;
n2 = n_atoms_total;
/* get first head unit */
pl=atom[main-~unit->bond[main-~unit->n_bonds-1]->tail.atom_num +

main-~unit-~list_num].position;
b 1 = a t o m [ m a i n [1] . u n i t - > l i s t _ n u m +
main[l].unit->head.atom_num].position;
bl.x = pl.x - bl.x;
bl.y = pl.y - bl.y;
bl.z = pl.z - bl.z;
bO = get_main bO(atom, main, l);
for (; i>=O; i--, main--) {
/* get current info */
list_num = main->unit-~list_num;
n_bonds = main-~unit-~n_bondsi p O
atom[main[l].unit-~head.atom_num+main[l].unit-~list_num].position bO.x = -bO.x; bO.y = -bO.y; bO.z = -bO.z;
nl = main[l].unit-~list_num;
nO = list_num = main-~unit-~list_num;
n_atoms = main-~unit-~n_atoms;

CA 022l6994 l997-09-30 WO 96/30849 PCT/U~C~'~ 1229 q = main-~unit-,atom;
/* change current unit */
main-~unit-~n_atoms = nl - nO;
main-~unit-~atom = atom_tmp;
for (j=O; j~main-~unit-~n_atoms; j++) main-~unit-~atom[j].position = atom[list_num+j].position;
/* compute bond axes */
~or (j=O; j~n_bonds; j++) {
b2[j] = main-~unit-~bond[j]-~tail.axis;
v = atom[main-~unit-~bond[j]-~next-~list_num +
main-,unit-~bond[j]-,next-,head.atom_num].position;
v2 = atom~list_num +
main-~unit-~bond[j]->tail.atom_num].position;
v.x -= v2.x;
v.y -= v2.y;
v.z -= v2.z;
main-~unit-~bond[j]-~tail.axis = vector_scale(v l.O);
}

main-~unit-~bond[n_bonds-l]-~tail.axis =
vector_scale(get_main_bO(atom main-i i) vector_length(main-~unit-~head.axis));
/* compute new head vector */
O ) {
p 1 a atom[main[-l].unit-~bond[main[-l].unit-~n_bonds-l]-~tail.atom_num+
main[-l].unit-~list_num].position;
bla=atom[list_num + main-,unit-~head.atom_num].position;
bla.x = pla.x - bla.x;
bla.y = pla.y - bla.y;
bla.z = pla.z - bla.z;

}

/* add on unit */
grow_backwards = TRUE;
do_unit_sub(&list_num, nO, nl, n2, logrosen, main-~unit, t, l atom, twig, pl, bl, pO, bO, e, p, b, new);
grow_backwards = FALSE;
- /* restore backbone unit */
main-~unit-~n_atoms = n_atoms;

WO 96/30849 PCTIU~ 610~229 main-,unit-,atom = q;
for (j=Oi jcn_bonds; j++) {
main->unit-~bondtj]-~tail.axis = b2[j];
/* change head vector */
if (!new && i ~ O) bO = get_main_bO(atom, main-1, 1); .
else if (new && i , O) bO = vector_scale(b[n_bonds-1], 1.0);
pl = pla;
bl = bla;
}
}

/* This routine creates the random positions.
For new units, it picks and copies the winner.
*/
void do_unit_sub(int *list_num, int nO, int nl, int n2, double~logrosen, rigid_unit *unit, torsion_list *t, hbond_list *l, atom_list *atom, vector *twig[], vector pl, vector~l, vector pO, ~ector bO, double *e, vector~[MAX_BONDS], vector b[MAX_BONDS], logical new) {
int i,j,iO;
vector bond[KMAX][MAX_BONDS], point[KMAX][MAX_BONDS];
double ftmp, cos_theta2, sin_theta2;
double de[KMAX], sum, max;
iO = O;
if (!new) {
/* copy old configuration to ~irst "guess~ */
iO = l;
for (j=O; jcunit-~n_atoms; j++) twig[O][j] = atom[*list_num + j].position;
}.
/* create gueses for new unit position *~
for (i=iO; icKMAX; i++) {
do {

CA 022l6994 l997-09-30 WO 96/30849 PCT/U~G/01229 cos_theta2 = 1-2*ran2(1.0);
sin_theta2 = 1-2~ran2(1.0);
ftmp = cos_theta2*cos_theta2 + sin_theta2*sin theta2 } while (ftmp > 1.0);
ftmp = sqrt(~tmp);
cos_theta2 /= ftmp;
sin_theta2 /= ftmp;
add_rigid_unit(unit, twig[i], pl, bl, pO bO, point[i] bond[i], cos_theta2 sin_theta2);
}

/* calculate probabilties -- be careful about zero of energy &
overflows */
max = -lE99;
for (j=O; jcKMAX; j++) {
de[j] = -BETA * delta_energy(t l atom twig[~] *list_num nO, nl, n2, unit-~n_atoms);
if (de[j] , max) max = de[j];
}

sum = O.O;
for (j=O; jcKMAX; j++) {
de[j] = exp(de[j] - max);
sum += de[j];
}

*logrosen += log(sum) + max - log(KMAX);
if (!new) {
/* determine points */
for (j=O; jcunit-~n_bonds; j++) {
p [ j ] = a t o m [ * l i s t _ n u m +
unit-~bond[j]-~tail.atom_num].position;
b[j] = atom[unit-~bond[j]-~next-~list_num +
unit-~bond[j]-~next-~head.atom_n~Lm].position;
b[j].x -= p[j].x;
b[j].y -= p[j].y;
- b[j].z -= p[j].z;
b[j] = vector_scale(b[j] 1.0);
}
*list_num +- unit-~n_atoms;

} else {
/* pick winner */
de[O] /= sumi for (j=l; j~KMAX; j++) de[j] = de[j-l] + de[j]/sum;
ftmp = ran2(1.0);
for (i=O; i~KMAXi i++) if (ftmp ~= de[i]) break;
ftmp = de[i];
if (i ~ O) ftmp -= de[i-l];
ftmp ~= sum;
*e -= (log(ftmp)+max)/BETA;
/* copy winner to atom array */
for (j=Oi j~unit->n_atomsi j++, (*list_num)++) atom[*list_num].position = twig[i][j];
for (j=O; j~unit-~n_bonds; j++) {
p[j] = point[i][j];
b[j] = bond[i][j];
}
}

/* This routine adds a rigid unit to the peptide structure */
void add_rigid_unit(rigid_unit *unit, vector *pos, vector pl, vector bl, vector pO, vector bO, vector point[MAX_BONDS], vector bond[MAX_BONDS], double cos_theta2, double sin_theta2) {

int ii double bond_len, cos_theta, sin_theta;
vector n, rOi bond_len = vector_length(bl);
rO.x = pO.x + bO.x*bond_len;
rO.y = pO.y + bO.y*bond_leni rO.z = pO.z + bO.z*bond_len;
bl.x /= bond_len;
bl.y /= bond_len;
bl.z /= bond_len;
n = vector_cross(bl,bO);
cos_theta = vector_dot(bO,bl);

WO 96r30849 PCT/U~:~{ilC 1229 sin_theta = vector_length(n);
if (sir theta c EPS) {
n.x = 1.0;
} else {
n.x /= sin_theta;
n.y /= sin_theta;
n.z /= sin_theta;
" }
for (i=O; icunit-~n_atoms; i+~) pos[i] = align(unit-~atom[i].position, rO, pl, n, cos_theta, sin_theta, bO, cos_theta2, sin_theta2);
for (i=O; icunit-~n_bonds; i++) point[i] = pos[unit-~bond[i]->tail.atom_num];
rO.x = O.O; rO.y = O.O; rO.z = O.O; pl=rO;
for (i=O; icunit-~n_bonds; i++) bond[i] = align(unit-~bond[i]-~tail.axis, rO, pl, n, cos_theta, sin_theta, bO, cos_theta2, sin_theta2);
}

/* This routine aligns the position */
vector align(vector p, vector rO, vector rl, vector n, double cos_theta, double sin_theta, vector n2, double cos_theta2, double sin_theta2) {

vector ret;
ret.x = p.x - rl.x;
ret.y = p.y - rl.y;
ret.z = p.z - rl.z;
ret = vector_rotate(ret, n, cos_theta, sin_theta);
ret = vector_rotate(ret, n2, cos_theta2, sin_theta2);
ret.x ~= rO.x;
ret.y += rO.y;
ret.z += rO.z;
return~ret);
}

CA 022l6994 l997-09-30 WO 96/30849 PCT/u~ 229 *****************************************************************
ENERGY DETERMINATION - PEPTIDE4.C
* * * ~ * * * * * * * * * * * * r /* The energy routines */
#include "peptide.h"
#define N0 8 #define N1 11 #define N2 81 #define N3 84 #define N2 63 #define N3 66 #define SCALE 100 /* This energy routine tries to force a S-S ring-closure for CA~A~C
*/
double zenergy(torsion_list *t, hbond_list *l, atom_list *atom, int n_atoms_total) {
double rl, r2;
vector x, y, v;
x = atom[Nl].position;
x.x -= atom[N0].position.x;
x.y -= atom[N0].position.y;
x.z -= atom[N0].position.z;
x = vector_scale(x, 2.038);
x.x += atom[N0].position.x x.y += atom[N0].position.y x.z += atom[N0].position.z y = atom[N3].position;
y.x -= atom[N2].position.x y.y -= atom[N2].position.y;
y.z -= atom[N2].position.z;
y = vector_scale(y, 2.038);
y.x += atom[N2].position.x;
y.y += atom[N2].position.y;
y.z l= atom[N2].position.z;
v = x;

WO 96/30849 PCT/U~ , 1229 v.x -= atom~N2].position.x;
v.y -= atom[N2].position.yi v.z -= atom[N2].position.z;
rl = vector_length2(v);
v = y;
v.x -= atom[NO].position.x;
v.y -= atom[NO].position.y;
v.z -= atom[NO].position.z;
r2 = vector_length2(v);
return(SCALE*(rl+r2)/BETA);
}

/* This energy routine tries to force a S-S ring-closure for CA~AAC
*/
double zdelta_energy(torsion_list *t, hbond_list *l, atom_list *atom, vector *twig, int n_atoms, int nO, int nl, int n2, int n_twig) {
double rl, r2;
vector x, y, v;
rl = r2 = 0.0;
if (INTERVAL(NO, n_atoms, n_atoms+n_twig) &&
INTERVAL(N2, nl, n2)) {
x = twig[Nl-n_atoms];
x.x -= twig[NO-n_atoms].x;
x.y -= twig[NO-n_atoms].y;
x.z = twig[NO-n_atoms].z;
x = vector_scale(x, 2.038);
x.x += twig[NO-n_atoms].x;
x.y += twig[NO-n_atoms].y;
x.z += twig[NO-n_atoms].z;
y = atom[N3].position;
y.x -= atom[N2].position.x;
y.y -= atom[N2].position.y;
y.z -= atom[N2].position.z;
y = vector_scale(y, 2.038);
y.x += atom~N2].position.x;

CA 022l6994 1997-09-30 W096/3084s PCT~S96/04229 y.y += atom[N2].position.y;
y.z += atom[N2].position.z;
v = x;
v.x -= atom[N2].position.x;
v.y -= atom[N2].position.y;
v.z -= atom[N2].position.z;
rl = vector_length2(v);
v = y;
v.x -= twig[NO-n_atoms].x;
v.y -= twig[NO-n_atoms].y;
v.z -= twig[NO-n_atoms].z;
r2 = vector_length2(v);
} else i~ (INTERVAL(N2, n_atoms, n_atoms+n_twig) &&
INTERVAL(NO, nO, n_atoms)) {
x = atom[Nl].position;
x.x -= atom[NO].position.x;
x.y -= atom[NO].position.y;
x.z -= atom[NO].position.z;
x = vector_scale(x, 2.038);
x.x += atom[NO].position.x;
x.y += atom[NO].position.y;
x.z += atom[NO].position.z;
y = twig[N3-n_atoms];
y.x -= twig~N2-n_atoms].x;
y.y -= twig[N2-n_atoms].y;
y.z -= twig~N2-n_atoms].z;
y = vector_scale(y, 2.038);
y.x += twig[N2-n_atoms].x;
y.y += twig[N2-n_atoms].y;
y.z += twig[N2-n_atoms].z;
v = x;
v.x -= twig[N2-n_atoms].x;
v.y -= twigtN2-n atoms].y;
v.z -= twig[N2-n atoms].z;
rl = vector length2(v);
v = y;
v.x -= atom[NO].position.x;
v.y -= atom[NO].position.y;
v.z -= atom[NO].position.z;

=
CA 022l6994 l997-09-30 WO 96/30849 PCT/U:i5G~ 1229 r2 = vector_length2(v);
}

return(SCALE*(rl+r2)/BETA);
~. }
/* This routine returns the Coulomb, LJ, H-bond, and torsion energies between the atoms in *atom and the atoms in *twig.
The atoms in ~twig must be those directly following those in *atom.
The atoms n_atoms to n_atoms+n_twig are in twig.
The atoms nO to n_atoms and nl to n2 are in atom.
nO c= n atoms c= nl c= n2 */
double delta_energy(torsion_list *t, hbond_list *1, atom_list *atom, vector *twig, int n_atoms, int nO, int nl, int n2, int n_twig) {

return( d_nonbond_energy(t, atom, twig, n_atoms, nO, nl, n2, n_twig) 1-d_hbond_energy(l, atom, twig, n_atoms, nO, nl, n2, n_twig) +

d_torsion_energy(t, atom, twig, n_atoms, nO, n.l, n2, n_twig) ) }

/* This routine returns the total energy */
double energy(torsion_list *t, hbond_list *1, atom_list *atom, int n_atoms_total) {

~ return( nonbond_energy(t, atom, n_atoms_total) +
hbond_energy~1, atom) +
torsion_energy(t, atom) );
}

/* This routine returns the Coulomb and LJ energies between the atoms in *atom and the atoms in *twig.
The atoms in *twig must be those directly ~ollowing those in *atom.
*/
double d_nonbond_energy(torsion_list *t atom_list *atom, vector *twig, int n_atoms int nO int nl int n2 int n_twig) {

#define FACT 332.06 /* converts from ei ej/rij to Kcal/mol */
int i, j, k;
vector r;
double r2 r6 e eij rij rij3 term a b;
e = 0.0;
~or (i=nO; icn2; i++) {
i~ (INTERVAL(i,n_atoms nl)) continue;
for (j=O; jcn_twig; j++) {
r.x = atom[i].position.x - twig[j].x;
r.y = atom[i].position.y - twig[j].y;
r.z = atom[i].position.z - twig[j].z;
r2 = vector_length2(r);
r6 = r2*r2*r2;
eij = sqr'(atom[i].p-~ei * atom[n_atoms+j].p-~ei);
rij = 0.5*(atom[i].p-~ri + atom[n_atoms+j].p-~ri);
rij3 = rij*rij*rij;
a = eij * rij3*rij3*rij3*rij3;
b = 2*eij * rij3*rij3;
/* epsilon = 4*r */
term = FACT * atom[i].p-~charge * atom[n_atoms+j].p-~charge / (4*r2) + a/(r6*r6) - b/r6;
e += term;
}

} 5 /* subtract off 1/2 of 1-4 interactions */
for (; t; t=t-~next) {
i = t-~num[~]; j = t-~numt3];

if (INTERVAL(i,n_atoms,n_atoms+n_twig)) {
k = i;
i = ji j = k;
}

if (INTERVAL(j,n_atoms,n atoms+n twig) &&
(INTERVAL(i,nO,n_atoms) ¦¦
I~ERVA~(i, nl, n2))) {
r.x = atom[i].position.x - twig[j-n_atoms].x;
r.y = atom[i].position.y - twig[j-n_atoms].y;
r.z = atom[i].position.z - twig[j-n_atoms].z;
r2 = vector_length2(r);
r6 = r2*r2*r2;
eij = sqrt(atom~i].p-~ei * atom[j].p->ei)i rij = 0.5 * (atom[i].p->ri + atom[j].p-~ri);
rij3 = rij*rij*rij;
a = eij * rij3*rij3*rij3*rij3;
b = 2*eij * rij3*rij3;
term = FACT * atom[i].p-~charge * atom[j].p-~charge / (4*r2) + a/(r6*r6) - b/r6;
e -= 0.5 * term;
}
}

return(e);
#unde~ FACT
}

/* This routine returns the Coulomb and LJ energies */
double nonbond energy(torsion_list *t, atom_list *atom, int n_atoms_total) {

#define FACT 332.06 /* converts ~rom ei ej/riJ to Kcal/mol */
int i, j;
vector ri double r2, r6, e, eij, rij, rij3, term, a, b;
7 e = ~-~i for (i=O; icn_atoms_total; i++) ~or (j=i+1; jcn_atoms_total; j++) {
r.x = atom[i].position.x - atom[j].position.x;

CA 022l6994 l997-09-30 WO 96~'3-L 1g PCT/U~_ ''01229 r.y = atom[i].position.y - atom[j].position.y;
r.z = atom[i].position.z - atom[j].position.z;
r2 = vector_length2(r) r6 = r2*r2*r2i eij = sqrt(atom[i].p-~ei * atom[j].p-,ei);
rij = 0.5*(atom[i].p-~ri + atom[j].p-~ri);
rij3 = rij*rij*rij;
a = eij * rij3*rij3*rij3*rij3;
b = 2*eij * rij3*rij3;
/* epsilon = 4*r */
term = FACT * atom[i].p-~charge * atom[j].p-~charge / (4*r2) + a/(r6*r6) - b/r6;
e += term;
}

/~ subtract off 1/2 of 1-4 interactions */
for (; t; t=t-~next) {

i = t-~num[0]; j = t-~num[3];
r.x = atom[i].position.x - atom[j].position.x;
r.y = atom[i].position.y - atom[j].position.y;
r.z = atom[i].position.z - atom[j].position.z;
r2 = vector_length2(r);
r6 = r2*r2*r2;
eij = s~rt(atom[i].p-~ei * atom[j].p-~ei);
rij = O.S * (atom[i].p-~ri + atom[j].p->ri);
rij3 = rij*rij*rij;
a = eij * rij3*rij3*rij3*rij3;
b = 2*eij * rij3*rij3;
term = FACT * atom[i].p-~charge * atom[j].p-~charge / (4*r2) + a/(r6*r6) - b/r6;
e -= 0.5 * term;
}

return(e);
#undef fact }
/* This routine returns the H-bond energy between the atoms in *atom and the atoms in *twig.
The atoms in *twig must be those directly following those in *atom.

WO 96)30849 PCT/US96/04229 */
double d_hbond_energy (hbond_list *l atom_list *atom vector *twiq int n_atoms int nO int nl int n2 int -n_twig ) {

int i j k;
vector r;
double r2 e;
e = O.O;
f or (; l; l =l - ~next ) {
i = l-~num[O]; j = l-~num[l];
i~ (INTERVAL(i n_atoms n_atoms+n_twig) ) {
k = i;
i = i;
j = k;
}

if ( INTERVA1 ( j n_atoms n_atoms+n_twig) &&
( INTERVAL ( i, nO n atoms ) ¦ I
INTERVAL(i,nl,n2) ) ) {
r.x = atom[i] .position.x - twig[j-n_atoms] .x;
r.y = atom[i] .position.y - twig [j -n_atoms] .y;
r. z = atom[i] .position. z - twig [j -n_atoms] . z;
r2 = ve ctor_l ength2 ( r );
e ~ p - ~a / ( r2 * r2 * r2 * r2 * r2 * r2 ) l-~p-~b/ (r2*r2*r2*r2*r2);
}
}

return ( e );
}

/* This routine returns the H-bond energy */
double hbond_energy (hbond_list *l atom_list *atom) {
vector r;
double r2, e;
e = O.O;
for (; l; l=l-~next) {
r.x = atom[l-~num[O] ] .position.x - atom[l-~num[l] ] .pos Ltion.x;
r.y = atom[l-~num[O] ] .position.y - atom[l-~num[l] ] .position.y;

r.z = atom[l-~num[O]].position.z - atomtl-,num[l]].position.z;
r2 = vector_length2(r);
e += l-~p-~a / (r2*r2*r2*r2*r2*r2) ~ p-~b/(r2*r2*r2*r2*r2);
}
return(e) } ~~
/* This routine returns the H-bond energy between the atoms in *atom and the atoms in *twig.
The atoms in *twig must be those directly following those in *atom.
* /
double d_torsion energy(torsion_list *t, atom list *atom, vector *twig, int n atoms int nO, int nl int n2 int n_twig) {

int i,j,k,l;
vector v[4];
double theta, e, tmp;
e = O.O;
for (; t; t=t-~next) {

if (t-~p-~vO[O] != O.O ¦¦ t-~p-~vO[l] != O.O ¦¦ t-~p-~v0[2] !=
0.0~ {
i = t-~num[O]; j = t-~num[l]; k = t-~num[2]i 1 = t-~num[3];
if (INTERVAL(i n_atoms+n twig,nl) ¦¦ i ,= n2 ¦¦ i < nO) .continue;
if (IN~ERVAL(j,n_atoms+n_twig nl) ¦¦ j ~= n2 ¦¦ j ~ nO) continue;
if (IN~ERVAL(k,n_atoms+n_twig,nl) ¦¦ k ~= n2 ¦¦ k ~ nO) continuei if (INTERVAL(l,n atoms+n_twig,nl) ¦¦ 1 ~= n2 ¦¦ 1 c nO) continue;
if (!(IN~ERVAL(i,n_atoms,n atoms+n twig) ¦¦
VAL(j,n atoms,n_atoms+n_twig) lN~ AL(k,n_atoms,n_atoms+n_twig) ll INTERVAL(1,n_atoms,n atoms+n twig))) continue;
/* printf("~d ~d ~d ~d", i, j, k, l); */
if (INl~AL(i,n_atoms,n_atoms+n_twig)) W~> 96130849 PCI~/US96/04229 v [ O ] = twig [ i - n_atoms ] ; el se v [ O ] = atom [ i ] . pos i tion;
if (INTERVAL(j,n_atoms n_atoms+n_twig) ) v[1] = twig~j-n_atoms]; else v[1] = atom[j].position;
if ( INTERVA~ (k, n_atoms, n_atoms+n_twig) ) v[2] = twig~k-n_atoms]; else v[2] = atom[k].position;
if ( IN~rERV~L (l, n_atoms, n_atoms+n_twig) ) v[3] = twig[l-n_atoms]; else v[3] = atom[l].position;
theta = torsion(v[O] v[1] v[2] v[3] );
tmp = (t-~p-~vO [O] * (1 + cos ( theta-t-,p-,phiO [O] ) ) +
t-~p-~vO [1] * (1 + cos (2*theta-t-~p-~phiO [1] ) ) +
t-,p-,vO [2] * tl + cos (3*theta-t-,p-,phiO [2] ) ) ) t - ~degen;
/* printf (" ~lf ~6lf\n" theta tmp); */
e += tmp;
}
}

return ( e );
}

/* This routine returns the torsional energy */
double torsion_energy (torsion_list *t, atom_list *atom) {

double theta, e, tmp;
e = O.O;
for (; t; t=t-,next) {

if (t-~p-~vO [O] ! = O . O ¦ ¦ t-~p-~vO [1] ! = O . O ¦ ¦ t-~p-~vO [2] ! =
0.0) {
theta = torsion(atom[t-~num[O] ] .pos:ition, atom[t-~num[1] ] .position, a t o m [ t - ~ n u m [ 2 ] ] . p o s i t i o n atom[t-~num[3] ] .position);
tmp = (t-~p-~vO [O] * (1 + cos ( theta-t-~p-~phiO [O] ) ) +
t-~p-~vO [1] * (l + cos (2*theta-t-~p-~phiO [1] ) ) t-~p-~vO [2] * (1 + cos (3*theta-t-~p-~phiO [2] ) ) ) t - ~degen i /* printf (~d ~d ~d ~d ~lf g6lf\n", t-~num[O], t-~num[1], t-~num[2], t-~num[3], theta, tmp); */

WO 96/30849 PCI~/US96/04229 e ~= tmp;
}
}

return(e);
}

1.
********************t****~******~**~***~***********************

MONTE CARLO ROUTINES - PEPTIDE5.C
*****************************************~***********~***********

/* The Monte Carlo routines */
#include "peptide.h"
/* This routine drives the configurational bias Monte Carlo */
void do_mc(rigid_unit *unit, torsion_list *t, hbond_list *l, atom_list *atom, atom_list *atom2, atom_info *atom_tmp, vector *twig[], regrowth *main, regrowth *side, int n_amino_acids, int n_atoms_total, int n_main, int n_side, logical cyclic) {

int list_num, i, j;
double logrosen, e, e2, emin;
vector pO, bO;
vector vl,v2;
emin = l.OE99;
list_num = O;
pO.x = 0.0; pO.y = O.O; pO.z = 0.0;
bO.x = 0.0; bO.y = 0.0; bO.z = 1.0;
e = O;
logrosen = O;
/* create initial geomeotry */
do_unit(&list_num, O, n_atoms_total, n_atoms_total, &logrosen, unit, unit, t, l, atom, twig, pO, bO, &e);
/* read in initial geometry */
if (O) read_restart(atom, n_atoms_total);
if (cyclic) WO 96130849 PCI'IUS96/04229 read_cycle(t, l, atom, main, side, twig, n_main, n_side, n_atoms_total);
/*
do_backbone_f(0, n_main, n_atoms_total, &logrosen, main, side, t, l, atom, twig, &e, TRUE);
do_backbone_b(n_main-1, n_main, n_atoms_total, ~logrosen, main, side, t, 1, atom, twig, &e, TRUE);
do_backbone_f_rigid(0, n_main, n_atoms_total, &logrosen, main, side, t, l, atom, atom_tmp, twig, &e, TRUE);
do_backbone_b_rigid(n main-1, n_main, n_atoms_total, &logrosen, main, side, t, l, atom, atom_tmp, twig, &e, TRUE );
*/
emin = e = energy(t, l, atom, n_atoms_total);
/t COpy old positions into new t/
for (j=0; jcn_atoms_totali j++) atom2[j] = atom[j];
/* do Monte Carlo */
for (i=0; i~16000; i++) {
printfti~d\nlrtiji rotate_main(atom, atom2, twig, main, side, t, l, n_main, n_atoms_total, &e) /*
regrow_main(t, l, atom, atom2, atom_tmp, twig, main, side, n_main, n_atoms_total, &e)i regrow_side(t, l, atom, atom2, twig, main, side, n_side, n_atoms_total, &e);
*/
i~ (e ~ emin) {
emin = e;
write_car_file(n_amino_acids, n_atoms_total, atom, "min.car");
}

-printf('lemin ~lf\n",emin);
}
/* This routine reads in a restart file */void read_restart(atom_list *atom, int n_atoms_total) WO 96/30849 PCT/u~ 4229 {

#define LINELEN 200 FILE *fp;
int i;
char name[30], line[LINELEN];
strcpy(name, "restart.car");
if ((fp = fopen(name, "r")) == NULL) {
printf("Data file ~s does not exist\n", name);
exit(1);
}

fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
for (i=O; icn_atoms_total; i++) {
fgets(line, LINELEN, fp);
sscanf(line, "~s ~lf ~lf ~lf", name, &atom[i].position.x, &atom[i].position.y, &atom[i].position.z);
}

fclose(fp);
}

/* This routine reads in the backbone units plus one side-chain atom for the geometry ~xxxxxxC. It then adds on each of the side groups randomly */
void read_cycle(torsion_list *t, hbond_list *l, atom_list *atom, regrowth *main, regrowth *side, vector *twig[], int n_main, int n_side, int n_atoms_total) {
#define LINELEN 200 FILE *fp;
int i, j, k, list_num;
char name~30], line[LINELEN];
double logrosen, e;
/* read in loop atoms plus one side group atom */

if (n_main != 2*8+3) {
printf("This cyclic geometry is not supported\n");
exit(l);
~, }
strcpytname, "CX6C.car");
if ((fp = fopen(name, "r")) == NULL) {
printf("Data file ~s does not exist\n", name);
exit(l);
}

fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
fgets(line, LINELEN, fp);
for (i=0; i~n_main; i++) {
/* printf("~d\n",main[i].unit-~list_num); */
for (j=0; jcmain[i].unit->n_atoms; j++) {
k = main[i].unit-~list_num + j;
fgets(line, LINELEN, fp);
sscanf(line, "~s ~lf ~lf ~lf", name, &atom[k].position.x, &atom[k].position.y, &atomtk].position.z);
/* printf("~d ~s ~lf ~lf ~lf\n",k,name, atom[k].position.x, atom[k].position.y, atom[k].position.z); */
}

if (main[i].unit-~n_bonds == 2) {
k++;
fgets(line, LINELEN, fp);
sscanf(line, "~s ~lf ~lf ~lf", name, &atom[k].posit:ion.x, &atom[k].positic~n.y, &atom[k].position.z), /* printf("~d ~s ~lf ~lf ~lf\n",k,name, atom[k].positioIl.x, atom[k].posit ion . y, atom[k]. position . Z ); * /

}

fclose(fp);
/* add on side groups */
for (i=O; icn_side; i++) {
list_num = side[i].unit-~list_num;
do_unit(&list_num, O, n_atoms_total, n_atoms_total, &logrosen, side[i].unit, side[i].unit, t, l, atom, twig, get_side_pO(atom, side, i), get_side_bO(atom, side, i), &e);
}
}

/* This routine regrows from a main chain unit onwards */~oid regrow_main(torsion_list *t, hbond_list *l, atom_list *atom, atom_list *atom2, atom_info ~atom_tmp, vector ~twig[], regrowth *main, regrowth *side, int n_main, int n_atoms_total, double *e) {

logical forward;
int list_num, i, j, k;
double logrosenl, logrosen2, x, e2, el;
/* pick main group to start regrowth from */
i = n_main*ran2(1.0);
/* pick direction to regrow */
forward = (ran2(1.0) > 0.5);
printf("regrowing ~s from unit ~d\n",(~orward) ? "forward"
"backward", i);
list_num = mainti].unit-~list_num;
/* copy old positions into new */
for (j=O; jcn_atoms_total; j++) atom2[j].position atom[j].position;
/* regrow new peptide */
e2 = o;
logrosen2 = O.O;
if (forward) do backbone f_riyid(i, n_ main, n_atoms_total, ~logrosen2, main, side, t, l, atom2, atom_tmp, twiy, &e2, TRUE ); ~
else =

WO 96130849 PCTIUS961042.Z9 do_backbone_b_rigid(i,n_main,n_atoms_total, &logrosen:2,main, side, t, l, atom2, atom_tmp, twig, ~e2, TRUE);
e2 = energy(t, l, atom2, n_atoms_total);
/* get old Rosenbluth weight */
list_num = main[i].unit-~list_num;
el = 0.0;
logrosenl = O.O
if (forward) do_backbone_f_rigid(i, n_main,n_atoms_total, &logrosen:L,main, side, t, l, atom, atom_tmp, twig, &el, FALSE);
else do_backbone_b_rigid(i,n_main,n_atoms_total, &logrosenl,main, side, t, l, atom, atom_tmp, twig, &el, FALSE);
printf("Wn Wo ~lf %lf\n",logrosen2, logrosenl);
printf("En Eo ~lf %lf\n",e2, *e);
/* perform acceptance test t /
x = 1.0;
if ~logrosenl ~ logrosen2) x = exp(logrosen2-logrosenl); .
/* accept new configuration ~/
if (ran2(1.0) c x) {
for (j=O; jcn_atoms_total; j++) atom[j].posit:ion =
atom2[j].position;
*e = e2i printf("SWAP\n");
}
}

/* This routine regrows a side chain */
void regrow_side(torsion_list *t, hbond_list *l, atom_list*atom, atom_list*atom2, vector*1wigr]/
regrowth *main, regrowth *side, int n_side, int n_atoms_total, double *e) {
int list_num, i, j, k, nl;
double logrosenl, logrosen2, x, e2;
if (n_side ==O ) return;

W 096/30849 PCT/us~lc1229 /* pick main group to start regrowth from */
i = n_side*ran2(1.0);
printf("regrowiny side chain ~d\n'l,i);
list_num = side[i].unit-~list_num;
logrosen2 = O.O;
/* copy old positions into new */ $
for (j=O; j~n_atoms_total; j++) atom2[j].position atom[j].position;
/* regrow side chain */
e2 = o;~* determine nl ~/
n side[i].prev-~bond[side[i].prev-~n_bonds-1]-~next->list_num do_unit(&list_num, O, nl, n_atoms_total, &logrosen2, side[i].unit, side[i].unit, t, 1, atom2, twig, get side_pO(atom, side, i), get_side_bO(atom, side, i), &e2);
e2 = energy(t, 1, atom2, n_atoms_total);
/* get old Rosenbluth weight */
list_num = side[i].unit-~list_num;
logrosenl = O.O;
old_unit(&list_num, O, nl, n_atoms_total, &logrosenl, side[i].unit, side[i].unit, t, 1, atom, twig, get_side_pO(atom, side, i), get_side_bO(atom, side, i));
printf("Wn Wo ~lf ~lf\n",logrosen2, logrosenl);
printf("En Eo ~lf ~lf\n",e2, *e);
/* perform acceptance test */
x = 1.0;
if (logrosenl ~ logrosen2) x = exp(logrosen2-logrosenl);
/* accept new configuration */
if (ran2(1.0) ~ x) {
for (j=side[i].unit-~list_numi jclist_num; j++) atomEj].position = atom2[j].position;
*e = e2;
printf("SWAP\n");
}

}

WO 96J30849 PCI~/Ub~G/0'1229 **********************************************************-~******
CONCERTED ROTATION ROUTINES - PEPTIDE6 . C
**********~***********************************************~*****llr /* The concerted rotation routines */
#include "peptide.h"
/* global variables */
vector 1[8], r[8];
double theta[8], m[3][3];
logical head[8];
/* This routine performs a concerted rotation on part of the main chain.
*/
void rotate_main(atom_list *atom, atom_list *atom2, vector *twig[], regrowth *main, regrowth *side, torsion_list *t, hbond_list *l, int n_mai.n, int n_atoms_total, double *e) {

double jo, jn, logroseno, logrosenn, x, phil, eo, en int no, nn, i, j, il, i2, iO;
~ector q;

logical valid[4];
double phi2[4], phi3[4], phi4[4], f[4];

iO = n_main * ran2(1.0);
printf("Rotating from position ~d\n",iO);
/* copy atom positions to atom2 */
for (i=O; i~n_atoms_total; i++) atom2[i].positi.on atom[i].position;
/* determine theta, r, l */
get_rot_params(atom, main, iO, n_main);
/* get original jacobian */
jo = jac(atom, main, iO, n_main);
- /* get constants needed by F5 */
F5init(get_main_bO(atom, main, (iO+1) ~ n_main), &phil);
/* get original Rosenbluth weight */
eo = energy(t, l, atom, n_atoms_total);

get_rot rosenbluth(atom, atom2, twig, main, t, l, iO, n_main, n_atoms_total, &no, &j, &loyroseno, &en);
printf("~d\n",no);
if (no == O) return; /* should never happen */
/* rotate rl and yet new constants */
q = rotate_rl(atom, main, iO, n_main);
F5init(q, &phil);
/* yet new Rosenbluth weiyht */
yet rot_rosenbluth(atom, atom2, twig, main, t, l, iO, n_main, n_atoms_total, &nn, &~, &logrosenn, &en);
printf("~d\n",nn);
if (nn == O) return; /* yeometric failure t/
/* copy atomic positions ~/
il = main[iO].unit-,list_num;
i2 = main[(iO+7) ~ n_main].unit-~list_num;
if (i2 c il) i2 += n_atoms_total;
for (i=il; ici2; i++) atom2[i ~ n_atoms_total].position = twig[j][i ~ n_atoms_total];
/* determine new Jacobian */
jn = jac(atom2, main, iO, n_main);
/* Doros move */
/* x = exp(-BETA*(en-eo)) * jn/jo * nn/no; */
/* CBMC move */
if (logrosenn - logroseno c -10.0) x = O.O;
else if (logrosenn - loyroseno ~ 10.0) x = 1.0;
else x = jn/jo * exp(logrosenn - loyroseno);
/* decide if move is accepted */
printf("Wn Wo ~lf ~lf\n",logrosenn, logroseno);
printf(~En Eo ~lf ~lf\n",en, eo);
if (ran2(1.0) c x) {
printf("SWAP\n");
*e = en;
/* copy atomic positions */
il = main[iO].unit-~list_numi i2 = main[(iO+7) ~ n_main].unit-~list_num if (i2 c il) i2 += n_atoms_total;

WO 96130849 PCT/US96/042:~9 for ~i=il; ici2; i++) atom[i ~ n_atoms_total].position = twig[j][i n_atoms_total];
} else *e = eo;
}
/* This routine gets the theta, r and 1 parameters */
~oid get_rot ~arams(atom_list *atom, regrowth tmain, int i0, int n_main) {

int ii vector t, v, v2;
double len;
rigid_unit *unit, ~unit2 tunit3;
/* determine theta */
for (i=0; ic8; i++) {
unit = main[(i+i0) ~ n_main].unit;
theta[i] = vector_dot(unit-~head.axis, unit-~bond[unit-~n_bonds-1]->ta.il.axis) vector_length(unit-~head.axis);
theta[i] = (theta[i] ~ 1.0-EPS) ? acos(theta[i]) : 0.0; }
/* determine r */
for (i=0; ic8i i++) head[i] = TRUE;
if (fabs(theta[5]) c EPS) head[5] = FALSE;
for (i=0; ic8; i++) {
unit = main[(i+i0) ~ n_main].uniti r[i] = atom[unit-~list_num + ((head[i]) ? unit-~head.atom_mIm unit-~bond[unit-~n_bonds-1]-~tail.atom_num)].positioIl;
}

/* determine 1 */
for (i=1; ic8; i++) {
t.x = r[i].x - r[i-l].x;
t.y = r[i].y - r[i-l].y;
t.z = r[i].z - r[i-l].z;
len = vector_length(t);
/* if (2.03clen ~ len c2.05) len = 2.038;
t = vector_scale(t, len); */

W 096/30849 PCTrUS96/04229 1 ti].x = len; l[i].y = l[i].z = o.O;
if (((main[(i+iO) ~ n_main].prev-,type == Cunit) &&
head[i-1]) ¦~ !head[i]) {
1[i].x = vector_dot(t, get_main_bO(atom, main, (i+iO) 9 n_main));
1[i].y = sqrt(len * len - l[i].x ~ l[i].x);

} ~r /*
for (i=1; ic8; i++) printf("~d ~lf %lf ~lf %lf\n",i, theta[i], 1 [i] .x, 1 [i] .y, 1 [i~ . z);
for (i=1; i~8; i++) printf("~d ~lf ~lf ~lf\n",i, r[i].x, r[i].y r[i].z);
*/
}

/~ This routine checks the rigid unit theta values */
void check_theta(atom_list ~atom, regrowth *main, int n_main) {

int ii vector t, v, v2, r;
double len, theta;
rigid_unit *unit, ~unit2 ~unit3;
for (i=O; i<n_main; i++) {
unit = main[i ~ n_main].unit;
unit2 = main[i % n_main].prev;
unit3 = main[(i+1) % n_main].unit;
r = atom[unit-~list_num + unit-~head.atom_num].position;
t = atom[unit2-~list_num +

unit2-~bond[unit2-~n_bonds-1]-~tail.atom_num].position;
t.x = r.x - t.x; t.y = r.y - t.y; t.z = r.z - t.z;
p r i n t f ( " % 1 f % 1 f ", v e c t o r_ 1 e n g t h ( t ) vector_length(unit-~head.axis));
v = atom[unit3-~list_num + unit3-~head.atom_num].position;
v2 = atom[unit-~list_num +
unit-~bond[unit-~n_bonds-1]-~tail.atom_num].position;
v.x -= v2.x; v.y -= v2.y; v.z -= v2.z;
theta = vector_dot(t, v) / (vector_length(v)*vector_length(t));

WO ~G.'3-~ ~5 PCTIUS961042,!9 theta = (theta c 1.0-EPS) ? acos(theta) : 0.0;
printf("~d ~lf ",i, theta)i theta = vector_dot(unit-~head.axis, unit-~bond[unit-~n_bonds-1]-~tail.axis) /
vector_length(unit-~head.axis);
theta = (theta c 1.0-EPS) ? acos(theta) : O.O;
printf("~lf \n",theta);

/t This routine detèrmines the Rosenbluth weight */
void get_rot_rosenbluth(atom_list *atom, atom_list *atom2, vector *twig[], regrowth *main, torsion_list *t, hbond_list *1, int i0, int n_main, int n_atoms_total, int *n, int *j, double *logrosen, double *e) {

double phi[MAX_ROOTS]~5], phil, max, sum, de[MAX_ROOTS], ftmp;
int i, k, kl, k2i /* get phiO-phil solutions ~/
get phil(phi, n);
if (*n == 0) return;
if (~n , MAX_ROOTS) {
printf("too many roots\n");
*n = 0;
return;
}

/* determine energies of solutions */
max = -lE99;
for (i=0; ic*n; i++) {
get_r(phiti][1], phi[i][2], phi[i][3], phi[i][4]);
do_rotation(atom, twig[i], main, i0, n_main, n_atoms_total);
kl = main[i0].unit-~list_num;
k2 = main[(i0+7) ~ n_main].unit->list_num if (k2 ~ kl) k2 += n_atoms_total;
for (k=kl; k~k2; k++) - atom2[k ~ n_atoms_total].position = twig[i][k n_atoms_total];
de[i] = -BETA*energy(t, 1, atom2, n_atoms_total);
if (de[i] ~ max) max = de[i];

}

sum = O.O;
for (i=O; ic*n; i++) {
de[i] = exp(de[i] - max);
sum += de[i];
}
*logrosen = log(sum) + max;
/* pick winner */
/* Doros move */
/* *j = *n*ran2(1.0); t/
/* CBMC move */
de[O] /= sum;
for (i=1; ic*n; i++) de[i] = de[i-1] + de[i]/sum ftmp = ran2(1.0);
for (*j=O; *jc*n; (*j)++) if (ftmp ~= de[*j]) break;
/~ get energy of winner */
~ ftmp = de[*j];
if (*j ~ O) ftmp -= de[*j-l];
ftmp *= sum;
*e = -(log(ftmp)+max)/BETA;
/* assign r to the winner */
get_r(phi[*j][l], phi[*j][2], phi[*j][3], phi[*j][4]);
}

/* This routine calculates the jacobian */
double jac(atom_list *atom, regrowth *main, int iO, int n_main) {

int i;
vector u[7], h[6], t, v;
double b[5][5];

/* form ui and hi */
for (i=1; ic7; i++) uti] = get_main_bO(atom, main, (iO+i3 ~n_main);
for (i=1; ic5; i++) hti] = rti];
ht5] = atomtmain[(iO+5)~n_main].unit-~list_num +
main[(iO+5)~n_main].unit-~head.atom_num].position;
v.x = rt6].x - h[5].x; v.y = rt6].y - ht5].y;
v.z = rt6].z - ht5].z;

WO 96t30849 PCT/USg~/0~2:Z9 v = ~ector scale(v, 1.0);
/~ form B matrix */
for (i=1; ic6; i++) {
t.x = r[5].x - h[i].x;
t.y = r[5].y - h[i].y;
t.z = r[5].z - h[i].z;
t = vector_cross(u[i], t);
b[O][i-1] = t.x;
b[l][i-1] = t.y;
b[2][i-1] = t.z;
}

for (i=1; i~6; i++) {
t = vector_cross(u[i], u[6]);
b[3][i-1] = t.x;
b[4][i-1] = t.y;
}

return(l.O/fabs(det5(b)));
}

/* This routine rotates phiO to change r[1].
It returns the new bO for unit iO+l.
*/~ector rotate_rl(atom_list *atom, regrowth *main, int iO, int n_main) {

double c, s, y vector x, n;
/* choose delta phiO */
y = DPHI * (1-2*ran2(1.0));
c = cos (y);
s = sin(y);
n = get_main_bO(atom, main, iO);
/* rotate about axis */
x = r[1];
x.x -= r[O].x;
x.y -= r[O].y;
x.z -= r[O].z;
x = ~ector_rotate(x, n, c, s);
r[l].x = r[O].x + x.x;
r[l].y = r[O].y + x.y;

CA 022l6994 l997-09-30 WO 9~'3C~ 19 PCT/US96/04229 r[l].z = r[O].z + x.z;
/* compute new bO for unit iO+1 */
return(~ector_rotate(get_main_bO(atom, main, (iO+1) ~ n_main), n, c, s));
}

/* This routine constructs r2-r4 from the theta, phi information */
void get_r(double phil, double phi2, double phi3, double phi4) {

int i;
vector x, y;
/*
printf("\n");
printf("~lf ~lf ~lf ~lf ~lf\n", phil, phi2, phi3, phi4) */
x = bxm(m, l[l])i r[l].x = x.x + r[O].x;
r[l] y = x.y + r[O].y;
r[l].z = x.z + r[O].z;
x = bxm(m, flory_rot(theta[1], phil, 1[2]));
r[2].x = x.x + r[l].x;
r[2].y = x.y + r[l].y;
r[2].z = x.z ~ r[l].z;
x = bxm(m, flory_rot(theta[1], phil, flory_rot(theta[2], phi2, 1[3]))) r[3].x = x.x + r[2].x r[3].y = x.y + r[2].y r[3].z = x.z + r[2].zi x = bxm(m, flory_rot(theta[1], phil, flory_rot(theta[2], phi2, flory_rot(theta[3], phi3, 1[4]))));
r[4].x = x.x + r[3].x;
r[4].y = x.y + r[3].y;
r[4].z = x.z + r[3].z /*
for (i=1; ic7; i++) printf("~d ~lf ~lf ~lf\n",i, r[i].x, r[i].y, r[i].z);
*/
}
/* This routine rotates the riyid units to the positions CA 02216994 1997~09~30 WO 9~ ~3~8 ~S PcI'/u~ r~ 122'9 o~ the concerted rotation.
*/
void do_rotation(atom_list *atom, vector *twig, regrowth ~~main, int iO, int n_main int n_atoms_total) {

int i, j, il, i2, i3, j2;
double m[3][3] a[3][3] tmp len2;
~ector xl x2 yl y2 x rigid_unit ~unit;
for (i=-l; ic6; i++) {
il = (i+iO+n_main) ~ n_main i2 = (i+iO+l) ~ n_main;
i3 = (i+iO+2) ~ n_main /* get xl & x2 */
xl = r[i+l];
x = (i ~ -1) ?
~wig[main[il].unit-~bond[main[il].unit-~n_bonds-l]-~tail.al:om_num+
main[il].unit->list_num] :
~tom[main[il].unit-~bond[main[il].unit-~n_bonds-l]-~tail.al:om_num+
main[il].unit-~list_num].position;
xl.x -= x.X; xl.y -= x.y; xl.z -= x.z;
x2 = atom[main[i2].unit-~list_num + ((head[i+l]) ?
main[i2].unit-~head.atom_num :
~ain[i2].unit-,bond[main[i2].unit-~n_bonds-1]-~tail.atom_num)~
.position;
x atom[main[il].unit-~bond[main[il].unit-~n_bonds-l]-~tail.atom_num +

main[il].unit-~list_num].position;
x2.x -= x.x; x2.y -= x.y; x2.z -= x.z;
/* yet rotation matrix */
flory_lab(a, xl, x2);
/* get yl & y2 */
yl = r[i+2];
x = (i ~ -l) ?

WO 96/30849 PCTIU:,~C~0 1229 ~ twig[main[il~.unit-~bond[main[il].unit->n_bonds-1]->tail.atom_num+
main[il].unit->list_num] :

atom[main[il~.unit->bond~main[il].unit->n_bonds-1]->tail.atom_num+
main[il].unit->list_num].position;
yl.x -= x.x; yl.y -= x.y; yl.z -= x.z;
y2 = atom[main[i3].unit->list_num ~ ((head~i+2]) ?
main~i3].unit->head.atom_num :

main[i3].unit-~bond[main[i3].unit->n_bonds-1]->tail.atom_num)]
.position;

atomlmain[ill.unit-~bond[main[il].unit->n_bonds-1]->tail.atom_num +

main[il].unit->list_num].position;
y2.x -= x.x; y2.y -= x.y; y2.z -= x.z;
y2 = mxb(a, y2);
/* get projection */
len2 = vector_length2(xl);
tmp = vector_dot(y2, xl) / len2;
y2.x -= xl.x * tmp;
y2.y -= xl.y * tmp;
y2.z -= xl.z * t~p;
tmp = vector_dot(yl, xl) / len2;
yl.x -= xl.x * tmp;
yl.y -= xl.y * tmp;
yl.z -= xl.z * tmp;
/* get rotation matrix */
~lory lab(m, yl, y2);
mxm (m, a)i /* perform rotation */

atom[main[il].unit->bond[main[il].unit->n-bonds-l]->tail.atom-num~
main[il~.unit-~list_num].position;
x2 = (i ~ -1) ?
~wiy[main[il].unit->bond[main[il].unit->n_bonds-1]->tail.atom_num+
main[il].unit-~list num] : xl;
j2 = main~i3].unit-~list num;

WO 96130849 PCT/Ub3G/01229 i~ (i3 == O) j2 = n_atoms_total;
for (j=main[i2].unit-~list_num; j c j2; j++) {
x = atomtj].position;
x.x -= xl.X;
x.y -= xl.y;
, x.z -= xl.z;
x = mxb(m, x);
x.x += x2.x;
x.y += x2.y;
x.z += x2.z;
twig[j] = x;
}
}

/* This routine determines the phil-phi3 values */
void get_phil(double phi[MAX_ROOTS][5], int *n) {

#define NTRY 10000 int i, j;
logical valid[NTRY+1][4];
double phil[NTRY+1], phi2[4], phi3[4], phi4[4i;
double f[NTRY+1][4];
*n = 0;
i = O;
/* Evaluate F5 */
for (i=0; ic=NTRYi i++) {
phil[i] = -PI + i*2*PI/NTRY;
F5(phil[i], phi2, phi3, phi4, f[i], valid[i]);
}

/* Now search for roots */
for (i=O; icNTRY; i++) {
for (j=0; jc4; j++) {
if (Ivalid[i][j] 'I !valid[i+l][j]) continue if ((f[i][j] c O ~ f[i+l][j] ~ 0) Il (~[i][j] ~ 0 &~ f[i+l][j] c 0)) {
if (*n ~= MAX_ROOTS) {
~ printf("Exce~sive number of roots failure in get phil\n");

return;
}

get_root(phil[i~, phil[i+1], &phi[*n][1], &phi[*n][2], &phi[*n][3], &phi[*n][4], j);
(*n)++;
}

} ~
#undef NTRY
}

/* This routine refines a root using bisection */
~oid get_root(double xO, double xl, double *pl, double *p2, double *p3, double *p4, int n) {

logical valid[4];
double phi2[4], phi3[4], phi4[4], f[4];
/* order roots: f(xO) < 0 && f(xl) , 0 ~/
F5(xl, phi2, phi3, phi4, f, valid);
if (f[n] c 0.0) {
*pl = xO;
xO = xl;
xl = *pl;
}
/* do bisection to refine root */
do {
*pl = 0.5*(xl+xO);
F5(*pl, phi2, phi3, phi4, f, valid);
if (f[n] > 0) xl = *pl; else xO = *pl;
} while (fabs(xl-xO) ~ EPS);
*p2 = phi2[n];
*p3 = phi3[n];
*p4 = phi4[n];
}

/* constants */
double clO, cll, c12, ql2, c20, c21, c22, factl, fact2;
vector xO, u60;
/* This routine sets up constants that F5 uses.
The constants are independent of phil W~ 96)30849 PCTIUS96/04229 */
void F5init(vector ~2, double *phil) {

int i,j;
vector t double cl, c2, a[3]t3], tmp t.x = 1.0; t.y = t.z = 0.0;
flory_labinv(m, q2, t)i ~ t.x = r[l].x - r[O].x; t.y = r[l].y - rtO].y; t.z = r[l].z -r[O].z t = mxb(m, t)i if (fabs(t.y) c EPS && fabs(t.z) < EPS) {
cl = 1.0;
c2 = 0.0;
} else {
cl = (l[l].y*t.y + t.z*l[l].z)/(t.y*t.y + t.z*t.z);
~ c2 = (-l[l].z*t.y + t.z*l[l].y)/(t.y~t.y + t.z*t.z);
if (fabs(cl) ~ EPS && fabs(c2) c EPS) cl = 1.0;
}

a[O][O] = 1; a[O][l] = O; a[O][2] = 0;
a[1][0] = 0; a[1][1] = cl; a[1][2] = c2;
a[2][0] = 0; a[2][1] = -c2; a[2][2] = cl;
mxm(a, m)i for (i=O; ic3; i++) for (j=O; jc3; j++) m[i][j] = a[i][j];
t.x = r[2].x - r[l].x; t.y = r[2].y - r[l].y; t.z = r[2].z -r[l].z;
t = mxb(m, t);
tmp = (sin(theta[1])*1[2].x - cos(theta[1])*1[2].y);
*phil = atan2(t.z/tmp, t.y/tmp);
xO.x = r[5].x - r[O].x; xO.y = r[5].y - r[O].y; xO.z = r[5].z -r[O].z;
xO = mxb(m, xO);
xO . x - = 1 [ i ] . x ;
xO.y -= 1[1].y;
xO .z -= 1 [1] .z;
if (fabs(thetat5]) ~ EPS && fabs(theta[3]) < EPS) {
clO = 1[3].x*cos(theta[4]);

cll = -(cos(theta[2])*1[3].x + sin(theta[2])*1[3] y);
tmp = sin(theta[2])*1[3].x - cos(theta[2])*1[3].y;
clO /= tmpi cll /= tmp;
else if (fabs(theta[5]) c EPS && ~abs(theta[3]) ~ EPS) {
clO = -1[5].x - 1[4].x*cos(theta[4]);
cll = -(cos(theta[2])*1[3].x + sin(theta[2])*1~3].y);
c12 = 1.0/(sin(theta[2])*1[3].x - cos(theta[2])*1[3].y);
else if (fabs(theta[3]) ~ EPS) {
t.z = 0.0;
t.x = 1[4].x*cos(theta[4]) - 1[4].y*sin(theta[4]) + 1[5].x;
t.y = 1[4].x*sin(theta[4]) + 1[4].y*cos(theta[4]) + 1[5].y ql2 = vector_length2(t);
clO = ql2 - vector_length2(1[3]);
cll = 2*(cos(theta[2])*1[3].x + sin(theta[2])*1[3].y);
c12 = -l~o/(2*(sin(theta[2])*l[3]~x - cos(theta[2])*113] y));
else {
clO = 1[3].x + 1[4].x + 1[5].x*cos(theta[4]);
cll = -cos(theta[2]);
tmp = sin(theta[2]);
clO /= tmp;
cll /= tmp;
}

c20 = vector_length2(1[5]) - vector_length2(1[4]);
c21 = 2*(cos(theta[3])*1[4].x + sin(theta[3])tl[4].y);
c22 = -1.0/(2*(sin(theta[3])*1[4].x - cos(theta[3])*1[4].y));
factl = sin(theta[4])*1[5].x - cos(theta[4])*1[5].y;
fact2 = 1[6].x*cos(theta[5]) + 1[6].y*sin(theta[5]);
u60.x = r[6].x - r[5].x; u60.y = r[6].y - r[5].y; u60.z = r[6].z r[5].z;
}

/* This routine returns the F5 function of Doros.
*n is the number of solutions, which are in */
void F5(double phil, double phi2[4], double phi3[4], double phi4[4], double f[4], logical valid[4]) { ~
int i, j;
double tmp, cl, c2;

CA 022l6994 l997-09-30 W~ 9613~849 PCI'/U:,,GIC 12;'9 vector vl, ql, q2, x, y, t, u6;
double a~3][3], rotlt3][3]l rot2[3][3], rot3[3][3], rot4[3][3]
/* detenmine cl */
valid[0] = valid[l] = valid[2] = valid[3] = FALSE;
flory_rot matrix(theta[l], phil, rotl);
x = bxm(rotl, xO);
x.x -= 1[2].x; x.y -= 1[2].y; x.z -= 1~2].z;
vl = X;
if (fabs(theta[5]) c EPS && fabs(theta[3]) c EPS) {
x = bxm(rotl, mxb(m, vector_scale(u60, l.o)));
cl = (clO + x.x*cll) / sqrt(x.y*x.y + x.z~x.z);
} else if (fabs(theta[5~) < EPS ~& fabs(theta[3]) , EPS) {
x = bxm(m, flory_rot(theta[l], phil, 1[2]));
r[2].x = x.x + r[l].x; r[2].y = x.y + r[l].y; r[2].z = x.z +
r[l].z;
t.x = r[5].x - r[2].x; t.y = r[5].y - r[2].y; t.z = r[5].z -r[2].zi x = bxm(rotl, mxb(m, vector_scale(u60,1.0)));
cl = c12*(clo + vector_dot(t, u60)/vector_length(u60) + x.x*cll) / sqrt(x.y*x.y +
x.z*x.z);
} else if (fabs(theta[3]) ~ EPS) {
cl = c12*(clO - vector_length2(x) + x.x*cll) / sqrt(x.y*x.y +
x.z*x.z);
} else {
cl = (clO + x.x*cll) / sqrt(x.y*x.y + x.z*x.z);
}

/* printf("cl ~lf\n",cl); */
if (fabs(cl) ~ 1) return;
/* determine phi2 */
tmp = asin(cl);
phi2[0] = phi2[2] = -atan(x.y/x.z);
if (x.z c 0) phi2[0] = phi2[2] = phi2[0] - PI;
phi2[0] += tmp phi2[2] += PI - tmp phi2[1] = phi2[0];
phi2[3] = phi2[2];
x = vl;
/* determine c2 and phi3 */

CA 022l6994 l997-09-30 WO 96/30849 PCT/U' 3G1~ 1229 for (i=0; ic2; i++) {
y = flory_rotinv(theta[2], phi2[2*i], x);
y.x -= lt3].x; y.y -= 1[3].y; y.z -= 1[3].z;
c2 = c22*(c20 - vector_length2(y) + y.x*c21) / s~rt(y.y*y.y +
y . z*y . Z ) ;
/t printf("c2 ~lf\n",c2); */ ~.
if (fabs(c2) c= 1) {
tmp = asin(c2);
phi3[2*i] = phi3[2*i+1] = -atan(y.y/y.z);
if (y.z c 0) phi3[2~i] = phi3[2*i+1] = phi3[2*i+1] - PI;
phi3[2*i] += tmp;
phi3[2*i+1] += PI - tmp;
valid[2*i] = valid[2*i+1] = TRUE;
}
}

for (i=0; ic4; i++) {
if (!valid[i]) continue;
/~ determine r4 */
flory_rot_matrix(theta[2], phi2[i], rot2);
flory_rot_matrix(theta[3], phi3[i], rot3);
x = mxb(rot3, 1[4]);
x.x += 1[3].x; x.y += 1[3].y; x.z += 1[3].z;
x = mxb(rot2, x);
x.x += 1[2].x; x.y += 1[2].y; x.z += 1[2].z;
x = mxb(rotl, x);
x.x += 1 [1] .x; x.y += 1 [1] .y; x.z += 1 [1] .z;
x = bxm(m, x);
x.x += r[O].x; x.y += r[O].y; x.z += r[O].z;
/* determine ~5 */
if (fabs(theta[5]) c EPS && fabs(theta[3]) c EPS) {
vl.x = r[6].x - x.x; vl.y = r[6].y - x.y; vl.z = r[6].z -x . z ;f[i] - sqrt((l[6].x+1[5].x)*(1[6].x+1[5].x) +
1[5].y*1[5].y) - vector_length(vl);
} else if (fabs(theta[5]) c EPS && fabs(theta[3]) ~ EPS) {
x = bxm(m, mxb(rotl, mxb(rot2, mxb(rot3, 1[4]))));
f[i] = vector_dot(x, u60) /
(vector_length~x)*vector_length(u60)) - cos(theta[4]);
} else {

W~ 96)31)849 PCT/U' ,. '~ ~22'9 x.x = r[5].x - x.x; x.y = r[5].y - x.y; x.z = r[5].z - x.z;
x = mxb(m, x);
x = bxm(rot3, bxm(rot2, bxm(rotl, x)));
phi4[i] = atan2(x.z/factl, x.y/factl);
u6 = mxb(m, u60);
~, x.x = 1.0; x.y = 0; x.z = 0;
f[i] = vector_dot~u6, mxb(rotl, mxb(rot2, mxb(rot3, ~ lory_rot(theta[4], phi4[i], x))))) fact2;
}
}

*************************************************t*********~****~

GEOMETRY/ROTATION ROUTINES - PEPTIDE7.C
*****t********t********************************************~****~

/* The geometry routines */
#include "peptide.h"
/* This routine rotates the vector a about n by theta (counterclockwise is +) r' = r cos(theta) + n(n.r)(l-cos(theta)) + nxr sin(theta) */
vector vector_rotate(vector a, vector n, double cos_theta, clouble sin_theta) {

double fact;
vector ret, v;
fact = (n.x*a.x + n.y*a.y + n.z*a.z) * (1.0 - cos_theta);
v = vector_cross(n,a)i ret.x = a.x*cos_theta + n.x*fact + v.x*sin_theta;
ret.y = a.y*cos_theta + n.y*~act + v.y*sin_theta;
ret.z = a.z*cos_theta + n.z*fact + v.z*sin_theta;
return(ret);
,~ }
/* This routine returns main-chain bO
i=0 noncyclic case should never happen--it won't be right */

vector get_main_bO(atom_list *atom regrowth *main, int i) {

vector x, y;
if (mainti].prev == NULL) {
x.x = x.y = 0.0;
x.z = 1.0; ~.
return(x);
}
x = a t o m [ m a i n [ i ] . u n i t - > 1 i s t _ n u m +
main[i].unit-,head.atom_num].position;
Y
atom[main[i].prev-~bond[main[i].prev-~n_bonds-1]-,tail.atom_num +
main[i].prev-~list_num].position;
.x.x -= y.x;
x.y -= y.yi x.z -= y.z;
return(vector_scale(x, 1.0));
}

/* This routine returns main-chain pO
i=O noncyclic case should never happen--it won t be right ~/
vector get_main pO(atom_list *atom, regrowth *main int i) {

vector x;
i~ (main[i].prev == NULL) {
x.x = x.y = x.z = 0.0;
return(x);
}

x atom[main[i].prev-~bond[main[i].prev->n_bonds-1]->tail.atom_num +
main[i].prev->list_num].position;
return(x);
} ~
/* This routine returns side-chain bO */
vector get_side_bO(atom_list *atom, regrowth *side, int i) {

vector x, y;
x = a t o m [ s i d e [ i ] . u n i t - > 1 i s t _ n u m +
side[i].unit-~head.atom_num].position;

WO 96130849 PCI'JUS96/0422~
y = a t o m [ s i d e [ i ] . p r e v - , 1 i s t _ n u m +
side[i].prev-~head.atom_num].position;
x.x -= y.x;
x.y -= y-Y;
x.z -= y.Z;
~ return(vector_scale(x, 1.0));
}

/* This routine returns side-chain pO */
vector get_side_pO(atom_list *atom, regrowth *side, int i) {

vector x;
x = a t o m [ s i d e [ i ] . p r e v - ~ 1 i s t _ n u m +
side[i].prev-~head.atom_num].position;
return(x);
}

/* This routine gives the Flory rotation matrix *~
void flory_rot_matrix(double theta, double phi, double m[3][3]) {

double cost, sint, cosp, sinp;
cost = cos(theta); sint = sin(theta);
cosp = cos(phi); sinp = sin(phi);
m[0][0] = cost;
m[0][1] = sint;
m[0][2] = 0.0;
m[1][0] = sint*cosp;
m[1][1] = -cost*cosp;
m[1][2] = sinp;
m[2][0] = sint*sinp;
m[2][1] = -cost*sinp;
m[2][2] = -cosp;
}

/* This routine does the Flory rotation */
vector ~lory_rot(double theta, double phi, vector a) ,.

vector t;
double cost, sint, cosp, sinp, tmp;
cost = cos(theta); sint = sin(theta);

WO 96/30849 PCT/US96/0~1229 cosp = cos(phi); sinp = sin(phi);
tmp = sint*a.x - cost*a.y;
t.x = cost*a.x + sint*a.y;
t.y = cosp*tmp + sinp*a.z;
t.z = sinp*tmp - cosp*a.z;
return(t)i ~, }

/* This routine does the inverse Flory rotation */
vector flory_rotinv(double theta, double phi, vector a) {

vector t;
double cost, sint, cosp, sinp, tmp;
cost = cos(theta); sint = sin(theta);
cosp = cos(phi); sinp = sin(phi);
tmp = cosp*a.y + sinp*a.z;
t.x = cost*a.x + sint*tmp;
t.y = sint*a.x - cost*tmp;
t.z = sinp*a.y - cosp*a.z;
return(t);
}

/* This routine constructs the lab trans~ormation to go ~rom 1 to r */
void ~lory_lab(double m[3][3], vector r, vector 1) {

double sin_theta, cos_theta;
vector n;
r = vector_scale(r, 1.0);
1 = vector_scale(l, 1.0);
n = vector_cross(l,r);
cos_theta = vector_dot(l,r);
sin_theta = vector_length(n);
i~ (sin_theta ~ EPS) {
n.x = 1.0;
} else {
n.x /= sin_theta n.y /= sin_theta;
n.z /= sin thetai WO 96131~1~49 PCI~/U~!~G/1~42:29 }

m[0][0] = cos_theta + n.x*n.x*(1.0-cos_theta) m[0][1] = n.x*n.y*~1.0-cos_theta) - sin_theta*n.z m[0][2] = n.x~n.z*(l.0-cos_theta) + sin_theta*n.yi m[1][0] = n.y*n.x*(1.0-cos_theta) + sin_theta*n.z;
m[1][1] = cos_theta + n.y*n.y*(1.0-cos_theta) m[1][2] = n.y*n.z*(l.0-cos_theta) - sin_theta*n.x;
m[2][0] = n.z~n.x*(1.0-cos_theta) - sin_theta*n.y;
m[2][1] = n.z*n.y*(1.0-cos_theta) + sin_theta*n.x m[2][2] = cos_theta + n.z*n.z*(1.0-cos_theta) }

/* This routine constructs the inverse lab transformation */
void flory_labinv(double m[3][3], vector r, vector 1) {

double sin_theta, cos_theta;
vector n;
r = vector_scale(r, 1.0);
1 = vector_scale(l, 1.0);
n = vector_cross(l,r);
cos_theta = vector_dot(l,r);
sin_theta = vector_length(n);
if (sin_theta c EPS) {
n.x = 1.0;
} else {
n.x /= sin_theta n.y /= sin_theta n.z /= sin_theta }

m[0][0] = cos_theta + n.x*n.x*(1.0-cos_theta) m[1][0] = n.x*n.y*(l.0-cos_theta) - sin_theta*n.z;
m[2][0] = n.x*n.z*(1.0-cos_theta) + sin_theta*n.y;
m[0][1] = n.y*n.x*(1.0-cos_theta) + sin_theta*n.z m[1][1] = cos_theta + n.y*n.y*(1.0-cos_theta) m[2][1] = n.y*n.z*(1.0-cos_theta) - sin_theta*n.x;
m[0][2] = n.z*n.x*(1.0-cos_theta) - sin_theta*n.y;
m[1][2] = n.z*n.y*(1.0-cos_theta) + sin_theta*n.x;
m[2][2] = cos_theta + n.z*n.z*(1.0-cos_theta) }

/* This routine returns a vector cross product */
vector vector_cross(vector a, vector b) { ~
vector ret;
ret.x = a.y*b.z - a.z*b.y;
ret.y = a.z*b.x - a.x*b.z;
ret.z = a.x*b.y - a.y*b.x;
return(ret);
}

/* This function scales the vector v so that Ivl = r */
vector vector_scale(vector v, double r) {

double ~tmp;
ftmp = sqrt(v.x*v.x + v.y*v.y + v.z*v.z);
v.x *= r/ftmp;
v.y *= r/~tmp;
v.z *= r/ftmp return(v);
}

/* This routine returns mxn in m */
void mxm(double m[3][3], double n[3][3]) {

int i,j,k;
double a[3][3];
for (i=0; ic3; i++) for (j=0; jc3; j++) {
a[i][j] = 0.0;
for (k=0; kc3; k++) a[i][j] += m[i][k]*n[k][j];
}

for (i=0; ic3; i++) for (j=0; j~3; j++) m[i][j] = a[i][j];
} , ,.
/* This routine deturns det(m), where m is Sx5 */
double det5(double m[5][5]) CA 022l6994 l997-09-30 WO 96130849 PCT/u~crc 1229 {

int i,j,k;
double a[5][5], ~act;
for (i=0; ic5; i++) for (j=0; jc5; j++) a[i][j] = m[i]ti]
for (i=0; ic4; i++) {
for (k=i+l; kcS; k++) {
~act = a[k][i] / a[i][i];
for (j=i; jc5; j++) a[k][j] -= fact*a[i][j];
}
}

return(a[O][O]*a[l][l]*a[2][2]*a[3][3]*a[4][4]);
}

/* This routine returns det(m), where m is 3x3 */
double det(double m[3][3]) {

return(m[O][O]*m[l][l]*m[2][2] + m[O][l]*m[1][2]*m[2][0 m[0][2]*m[1][0]*m[2][1] - m[2][0]*m[1][1]*m[0][2j -m[l][O]*m[O][l]*m[2][2] - m[O][O]*m[2][1]*m[1][2j);
}
/* This routine returns Mb */
vector mxb(double m[3][3~, vector b) {

vector t;

t.x = m[O][O]*b.x + m[O][l]*b.y + m[0][2]*b.z;
t.y = m[l][O]*b.x + m[l][l]*b.y + m[1][2]*b.z;
t.z = m[2][0]*b.x + m[2][1]*b.y + m[2][2]*b.z;
return(t);
}
/* This routine returns Mb */
vector bxm(double m[3][3], vector b) {

vector t;

W096/30849 PCT~S96104229 t.x = m[O][O]*b.x + m[l][O]*b.y + m[2][0]*b.zi t.y = m[O][l]*b.x + m[l][l]*b.y + m[2][1]*b.z;
t.z = m[0][2]*b.x + m[1][2]*b.y + m[2][2]*b.z;
return(t);
}

/t This routine returns bl.b2 */
double vector_dot(vector bl, vector b2) {

return(bl.x*b2.x + bl.y*b2.y + bl.z*b2.z);
}

/* This routine returns ¦v¦
*/
double vector_length(vector v) {

return(sqrt(v.x*v.x + v.y*v.y + v.z*v.z));
}

/* This routine returns ¦v¦-2 */
double vector_length2(vector v) {

return(v.x*v.x + v.y*v.y + v.z*v.z);
}

*****************************************************************
RANDOM NUMBER GENERATOR - RANDOM.C
*****************************************************************

/*
This is the pseudo-random number library.
*/
#include ctime.h~

This function returns a random number in [0,1).
It uses a linear-congruential method.
ran(0.0) initializes the random number seed with a time dependant value and returns the value o~ the seed that the generator recognizes.

WO9~ t 1~ PCT/U~/llS2.~9 ran(1.O) returns the next number in the random sequence.
Other arguments initialize the seed with the user-supplied value.
Initializing the generator with a seed from the sequence, wil].
cause the subsequent ran(1.0) to generate the next value of the se(~uence This is usefull, for example, to shut down and start up the generator without a loss of continuity in the sequence.
Values r 1 or ~ 0 are not recommended.
It has a period of M.
*/
double ran(double dummy) {

static long int ix;
double rm = 566927.0, ~n2 = 1.0/rm;
long int k = 5701, j = 3621, m = 566927, tmp;
/* make sure parameters not too far off */
if (dummy > 2.0) dummy = 2.0;
if (dummy c -2.0) dummy = -2.0;
if (dummy != 1.0) {

if ((tmp = dummy*rm) c m) ix = tmp;
else ix = m-~;
if (ix c 0) ix = O;
} else ix = (j*ix + k) ~ m;
return(ix * rm2);
}

/*
This function returns a pseudo-random number in (0,1).
This is a more robust pseudo-random number generator than a simple linear-~ congruential gererator is.
It uses three linear congruential generators to get one randornnumber.
ran2(0.0) initializes the generator with time-dependent ~Jalues WO 96/30849 PCT/U~ 229 ran2~1.0) returns a pseudo-random number.
Other arguments are used as an initializing seed.
Arguments r 1 or s 0 are ill-advised.
It has a period of (ml-l)(m2-l)(m3-1)/4.
*/
double ran2(double dummy) {

double fl=1.0/30269.0 ,f2=1.0/30307.0, f3=1.0/30323.0, tmp;
int ml=30269, m2=30307, m3=30323, seed, itmp;
static x,y,z;
/* make sure parameters not too far off */
if (dummy > 1.1) dummy = 1.1;
if (dummy c -1.1) dummy = -1.1;
if (dummy != 1.0) {

/* initialize with user's seed ~alue */
if ((itmp = dummy*ml) c ml) seed = itmp;
else seed = ml-l;
if (seed c 1) seed = 1;
/* initialize first generator */
x = seed;
/* initialize second generator */
y = 172 * (x ~ 176) - 35 * (x/176);
if (y c 0) y += m2;
/* initialize third generator */
z = 170 * (y ~ 178) - 63 * (y/178);
if (z c 0) z += m3 }
/* first generator */
x = 171 * (x ~ 177) - 2 * (x/177);
if (x c 0) x += ml;
/* second generator */
y = 172 * (y ~ 176) - 35 * (y/176);
if (y c 0) y += m2;
/* third generator */
z = 170 * (z ~ 178) - 63 ~ (z/178);
if (z ~ 0) z += m3i /* amalgamated resu:Lt * /
itmp = tmp = x*fl + y*f2 + z*f3;
return(tmp - itmp);
}

***************************~t******
*************************~************************************~**
C INCLUDE FILES
_ **********t****~******
**********~******************************************************

************~*********************~******************************
GLOBAL VARIABLE TYPES - PEP_TYPE.H
**********************************************************~******

/* Global types used in the program */
typedef enum {FALSE, TRUE} logicali typedef enum {BAD, G, A, V, L, I, S, T, D, E, N, Q, K, H, F', F, ~, W, C, M, P}
acid_label;
typedef enum {UNKNOWN, nonCunit, Cunit} unit_label;
typedef struct {
double x,y,z } ~ector;
typedef struct {
vector axis;
int atom_num;
int bond[MAX_BONDS];
} connector;
typedef struct bond_struct {
connector tail;
struct rigid_unit_struct *next;
} bond_type;
typedef char *string;

typedef struct {
char nametNAME_LENGTH];
char type[NAME LENGTH];
double charge, ri, ei;

vector position;
acid_label residue;
int residue_num;
} atom_info;
typedef struct rigid_unit_struct {
unit_label type connector head;
int list_num;
int n_bonds;
bond_type **bond;
int n_atoms;
atom_info *atom;
} rigid_unit;
typedef struct {
atom_info *p;
vector position;
} atom_list;
typédef struct {
char typel[NAME_LENGTH], type2[NAME_LENGTH], type3[NAME_LENGTH], type4[NAME_LENGTH];
double v0[3], phiO~3];
} tcrsion_data;
typedef struct torsion_list_struct {
int num[4];
torsion_data *p;
int degen;
struct torsion_list_struct *next;
} torsion_list;
typedef struct {
char type[NAME_LENGTH];
double ri, ei;
} lj_data;
typedef struct {
char typel[NAME_LENGTH], type2[NAME_LENGTH];
double a, b;
} hbond_data;
typedef struct hbond_list_struct {
int num[2];
hbond_data *p;

WO 96130849 PCTIUS96/042~!9 struct hbond_list_struc~ ~next;
} hbond_list typedef struct {
rigid unit *unit, *prev;
} resrowth;

*********~***********~r*****~r********t*~**************************

GLOBAL VARIABLES - PEP_VAR.H
*********~********t****~r********************~r*******************~

/* Global variables used in the program */
#if defined(MAIN) #de~ine EXT extern #else #define EXT
#endi~
EXT torsion_data ~-*torsion_data_list;
EXT lj_data **lj_data_list;
EXT hbond_data **hbond_data_list;
#undef EXT

************************t*********************************~lr*****ir GLOBAL FUNCTIONS - PEPTIDE . H
***************************************************~r******l!r*****~1~

/* Include files needed by peptide code */
#include ~stdio.h~
#include ~float.h~
#include ~math.h~
#include ~fcntl.h~
#include cstdio.h~
#include cmemory.h~
#include ~malloc.h~
#include ~string.h~
#include csearch.h~
#include ~stdlib.h~
#include ~errno.h~
#include ~string.h~
#include ~time.h~

#include ~varargs.h~
/* global constants */
#define BETA 1.6886683 /* kB T at 298K */
#define MAX_BONDS 8 #define PI 3.1415927 #define EPS l.OE-9 #define NAME_LENGTH 10 #define KMAX 100 #define MAX_ROOTS 100 #define DPHI .01 /* global macros */
#define INTERVAL(a,nl,n2) ((a) ~= (nl) && (a) ~ (n2)) /* Include files relevant to this program */
#include "pep_type.h"
#include "pep_var.h"
/* random.c */
~double ran(double dummy);
double ran2(double dummy);
/* peptidel.c */
void out_of_memory(void)i void get_sequence(string **sequence, int *n_peptides);
rigid_unit *read_peptide_data(string sequence, int *n_atoms_total, int *max_atoms_per_unit);
rigid_unit *read_unit(string file, acid_label label, in~
residue_num, int *n_atoms_total, int *max-atoms-per-unit);
void couple_unit(rigid_unit *unitl, rigid_unit *unit2);
rigid_unit *modify_cystine_ends(rigid_unit *unit, int n_amino_acids, int *n_atoms_total);
void get_main_side(rigid_unit *unit, regrowth *main, regrowth *side, int *n_main, int *n_side);
void read_torsion_data(void) void read_lj_data(void) void read_hbond data(void)i void write_car_file(int n_amino_acids, int n_atoms_total, atom_list *atom, string file);

string getline(string line, int len, FILE *fp);
void strip(string string)i ~oid decomma(string string);
void capitalize(string s);
void amino_acid_code_3(acid_label label, string code_3);
void amino_acid_code_l(acid_label label, char code_1);
acid_label amino_acid_code(char code_1);
/* peptide2.c */
void initialize_connection_table~int **bond_table, int n_atoms_total);
void make connection_table(int **bond_table, int *table_num, rigid_unit *unit, rigid_unit *start);
void add_connection(int **bond_table, int il, int i2);
void print_connection_table(int **bond_table, int n_atoms_~otal);
void get_torsions(torsion_list **p, int **bond_table, int *table_num, atom_list *atom, rigid_unit *unit, rigid uni *start);
torsion_list *add_torsion(int **bond_table, atom_list *atom, inl i, int j, int k, int l);
logical lookup_torsion_data(string typel, string type2, strinq type3, string type4, torsion_data **p);
void print_torsions(torsion_list *list, atom_list *atom);
double torsion(vector pl, vector p2, vector p3, vector p4);
void assign_lj_parameters(rigid_unit *unit, rigid_unit *start);
logical lookup_lj_ data(string type, double ~ri, double *ei);
logical lookup_lj_ data(string type, double *ri, double *ei);
void get_hbonds(hbond_list **list, atom_list *atom, int n_atoms);
logical lookup_ hbond_data(string typel, string type2, hbond_data **p);
void print_hbonds(hbond_list *l, atom_list *atom);
void assign_atom_pointers(int *list_num, rigid_unit *unit, rigid_unit *start, atom_list *atom);
/* peptide3.c */
void old_unit(int *list_num, int nO, int nl, int n2, double *logrosen, W096/30849 PCTtUS96tO4229 rigid_unit *unit, rigid_unit *start, torsion_list *t, hbond_list *1, atom_list *atom, vector *twig[], vector pO, vector bO);
void do_unit(int *list_num, int nO, int nl, int n2, double *logrosen, rigid_unit *unit, rigid_unit *start, torsion_list *t, hbond_list *1, atom_list *atom, ~ector ttwig[], vector pO, vector bO, double *e);
void do_backbone_f(int i, int n_main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list *1, atom_list *atom, vector ttwig[], double *e, logical new);
void do_backbone_f_rigid(int i, int n_main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list *1, atom_list *atom, atom_info *atom_tmp, vector *twig[], double *e, logical new);
void do_backbone_b(int i, int n_main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list *1, atom_list *atom, vector *twig[], double *e, logical new);
void do_backbone_b_rigid(int i, int n main, int n_atoms_total, double *logrosen, regrowth *main, regrowth *side, torsion_list *t, hbond_list *1, atom list *atom, atom_info *atom_tmp, vector *twig~], double *e, logical new);
void do_unit_sub(int *list_num, int nO, int nl, int n2, double *logrosen, rigid_unit *unit, torsion_list *t, hbond_list *1, atom_list *atom, vector *twig[], vector pl, vector bl, ~ vector pO, vector bO, double *e, vector p[MAX_BONDS], vector b[MAX BONDS], logical new);
r void add_rigid_unit(rigid_unit ~unit, vector *pos, vector pl, vector bl, vector pO, vector bO, vector point[MAX_BONDS], vector bond[MAX_BONDS], double cos_theta2, double sin_theta2);
vector align(vector p, vector rO, vector rl, vector n, double cos_theta, double sin_theta, vector n2, double cos_theta2, double sin_theta2);
/* peptide4.c */
double delta_energy(torsion_list *t, hbond_list *l, atom_list *atom, vector *twig, int n_atoms, int nO, int nl, in.t n2, int n_twig);
double energy(torsion_list *t, hbond_list *l, atom_list *c~tom, int n_atoms total);
double d_nonbond_energy(torsion_list *t, atom_list *atom, vector *twig, int n_atoms, int nO, int nl, int n2, in.t n_twig);
double nonbond_energy(torsion_list *t, atom_list *atom, in.t n_atoms_total);
double d_hbond_energy(hbond_list *l, atom_list *atom, vecto~ *twig, int n_atoms, int nO, int nl, int n2, in.t n_twig);
double hbond_energy(hbond_list *l, atom_list *atom);
double d_torsion_energy(torsion_list *t, atom_list *atom, vector *twig, int n_atoms, int nO, int nl, int :n2, int n_twig);
double torsion_energy(torsion_list *t, atom_list *atom);
/* peptide5.c */
void do_mc(rigid_unit *unit, torsion_list *t, hbond_list W O 96130849 PC~rrUS96/04229 atom_list *atom, atom_list *atom2, atom_info *atom_tmp, vector *twig[], regrowth *main, regrowth *side, int n_amino_acids, int n_atoms_total, int n_main, int n_side, logical cyclic);
void read_restart(atom_list *atom, int n_atoms_total);
void read_cycle(torsion_list *t, hbond_list *1, atom_list *atom, regrowth *main, regrowth *side, vector *twig[], int n_main, int n_side, int n_atoms_total);
void regrow_main(torsion_list *t, hbond_list *1, atom_list *atom, atom_list *atom2, atom_info *atom_tmp, vector *twig[], regrowth *main, regrowth *side, int n_main, int n_atoms_total, double ~e);
void regrow_side(torsion_list *t, hbond_list *1, atom_list *atom, atom_list *atom2, vector *twig[], regrowth ~main, regrowth *side, int n_side, int n_atoms_total, double *e) /* peptide6.c */
void rotate_main(atom_list *atom, atom_list *atom2, vector *twig[], regrowth *main, regrowth *side, torsion_list *t, hbond_list *1, int n_main, int n_atoms_total, double *e);
void get_rot_params(atom_list *atom, regrowth *main, int iO, int n_main);
void get_rot_rosenbluth(atom_list *atom, atom_list *atom2, vector *twig[], regrowth *main, torsion_list *t, hbond_list *1, int iO, int n_main, int n_atoms_total, int *n, int *j, double *logrosen, double *e);
double jac(vector rt7]);
vector rotate_rl(atom_list *atom, regrowth *main, int iO, int n_main);
void get_r(double phil, double phi2, double phi3, double phi4, double phi5);
void do_rotation(atom_list *atom, vector *twig, regrowth *main, int CA 022l6994 lgg7-o9-3o W096/30849 PCT~S96/04229 ~O, int n_main, int n_atoms_total);
void get phil(double phi[MAX_ROOTS][6], int *n);
void get_root(double xO, double xl, double *pl, double *p2, double *p3, double *p4, double *p5, int n);
void F5init(vector q2, double tphil);
void F5(double phil, double phi2[4], double phi3[4], double phi4[4], double phi5[4], double f[4], logical valid[4]);
/* peptide7.c */
vector vector_rotate(vector a, vector n, double cos_theta, double sin theta);
vector yet_main bO(atom_list ~atom, regrowth *main, int i);
vector get_main pO(atom_list *atom, regrowth *main, int i);
vector get_side_bO(atom_list *atom, regrowth ~side, int i);
vector get_side pO(atom list *atom, regrowth *side, int i);
void flory_rot matrix(double theta, double phi, double m[',][3]);
vector flory_rot(double theta, double phi, vector a) vector ~lory rotinv(double theta, double phi, vector a) void flory_lab(double m[3][3], vector r, vector l);
void flory_labinv(double m[3][3], vector r, vector l);
vector vector cross(vector a, vector b);
vector vector scale(vector v, double r);
void mxm(double m[3][3], double n[3][3]);
double det5(double m[5][5]);
double det(double m[3][3])i vector m~(double mt3][3], vector b);
vector bxm(double m[3][3], vector b);
double vector dot(vector bl, vector b2);
double vector length(vector v);
double vector_length2(vector v);
r **~*******************************************************~******
*****************************************************~******
DATA FILES D~l~l~G GEOMETRIC STRUCT~E
*********************************~*****.
**********************************************************~*****,~

****************************************************************
DATA FILE FOR UNIT A - UNITA.DAT
*****************************************************************

! data file for rigid unit A--the NH2 terminus 1 !rigid unit in this structure ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit N0.039039567-0.0280482040.000005808 ALAn 1 NT
N -0.463 HN1-0.2945954200.9464196560.000007165 ALAn 1 H
H 0.126 HN2-0.309849501-0.509882152-0.840834498 ALAn 1 H
H 0.126 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond--doesn't mean anything, but must not be 1 0 0 .00000001!beginning of incoming bond -- just an overall displacement 1 !bond out from this unit -1 !don't know which unit this bond goes to 0 1 2 -1 -1 !beginning of outgoing backbone bond 1.498959541 -0.043336947 -0.000000042 !ending of outoing bond *****************************************************************
DATA FILE FOR UNIT B - UNITB.DAT
*****************************************************************

! data ~ile for rigid unit B--the CH alpha carbon unit 1 !rigid unit in this structure ! ATOM INFORMATION
! rigid unit 0 2 !atoms in this rigid unit CA4.0473437312.755753756 -0.000011837 ALA 2 CT
C 0.035 HA3.7792725563.294512749 -0.928205431 ALA 2 HC
H 0.032 WO 96/30849 PCI~/US96/042:Z9 ~ BOND INFOR~qATION
! rigid unit 0 0 1 -1 -1 -l!ending of incoming backbone bond 3.370934725 1.461895347 -0.000009674 !beginning of :incoming backbone bond 2 !bonds out from this unit -1 !don~t know which unit this bond yoes to 0 1 -1 -1 -1 !beginning of outgoing side-chain bond 3.538550615 3.547572851 1.217100978 !ending of outgo:in side-chain bond -1 !don't know which unit this bond goes to 0 1 -1 -1 -l!beginning of outgoing backbone bond 5.547336102 2.582198620 -0.000015057 !ending of outgoiIlg backbone bond ~t*~*~*~*************~****************************~***~****~*

DATA FILE FOR UNIT C - UNITC.DAT
*~t~t~t~**~*~*~*~*~*t~**~*****~******t~*~*.~*

! data file for rigid unit C--the OCNH amide bond unit 1 !rigid unit in this structure ! ATOM INFORMATION
! rigid unit 0 4 !atoms in this rigid unit C 2.054825068 1.360626340 0.000001071 ALAn :. C
C 0.616 O 1.320880890 2.356072187 0.011419594 ALAn ~ o O -0.504 N 3.370934725 1.461895347 -0.000009674 ALA ,' N
N -0.463 HN 3.917454243 0.530382395 -0.000003380 ALA 2 H
H 0.252 ! BOND INFORMATION
! rigid unit 0 O 1 2 -1 -1 !ending of incoming main-chain bond 1.498959541 -0.043336947 -0.000000042 !beginning of :incoming main-chain bond 1 !bond out from this unit -1 !don't know which unit this bond goes to WO 96/30849 PCT/US96/0~229 2 0 3 -1 -1 !beginning of outgoing main-chain bond 4.047343731 2.755753756 -0.000011837 !ending of outging main-chain bond **************~***********~**************************************
DATA FILE FOR UNIT D - UNITD.DAT e ****************************************************************

! data file for rigid unit D--the HCO terminus 1 !rigid unit in this structure ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit C 8.274295807 5.082911491 -0.000008575 ALAN 3 C
C 0.616 HC 9.361082077 5.166533947 -0.000010758 ALAN 3 HC
H 0.000 O 7.540351391 6.078356743 0.011415332 ALAN 3 O
O -0.504 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming main-chain bond 7.718430996 3.678948641 -0.000013665 !beginning of incoming main-chain bond 0 !bonds out from this unit *************************************************************
DATA FILE FOR A~ANINE - A.DAT
********************************t****************************

! The side-chain structure file for Alanine 1 !rigid unit in side-chain ! ATOM INFORMATION
! rigid unit 0 4 !atoms in this rigid unit CB 3.178086281 3.790203094 1.217109203 ALA 2 CT C -0.098 HB1 3.502361059 4.845792770 1.274110079 AhA 2 HC H 0.038 CA 022l6994 1997-09-30 wos6l30s4s PCT/U~3GJ01229 B2 2.072028160 3.800241470 1 180677295 ALA 2 HC H 0.038 B3 3.465983868 3.309211969 2.172164917 ALA 2 HC H 0.038 ! BOND INFORMATION
! rigid unit 0 0 1 2 3 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634676 -0.000003090 !beginning of bond for ~ unit 0 0 !~onds out from rigid unit 0 t~*~*~******~t~***~***********************

DATA FILE FOR CYSTEINE - C.DAT
~**t~***********~*t*************~**********************

! The side-chain structure file for Cysteine ! Do not modify the atom order in this file 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.185384274 3.813543320 1.210355163 CYSH 2 CT C -0.060 B 1 2.082855701 3.742515087 1.217666388 CYSH 2 HC H 0.038 HB2 3.528102398 3.371057510 2.168041706 CYSH 2 HC H 0.038 ! rigid unit 1 4 !atoms in this rigid unit SG 3.628824234 5.564641953 1.168115854 CYSH 2 SH S 0.827 LGl 2.774378061 6.223292828 1.382826447 CYSH 2 LP L -0.481 LG2 4.018448353 5.879447937 0.188784361 CYSH 2 LP L -0.481 HG 4.543437004 5.521058083 2.133599997 CYSH 2 HS H 0.135 ! BOND INFORMATION
! rigid unit 0 W096/30849 PCT/U~G;~229 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634914 -0.000003354 !beginning of ~ond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.628824234 5.564641953 1.168115854 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 2 3 -1 !ending of incoming bond for unit 1 and nn 3.185384274 3.813543320 1.210355163 !beginning of bond for unit 1 0 !bonds out from rigid unit 1 ********************~******t******************************

DATA FILE FOR ASPARTATE - D.DAT
**********~r**********************************************~*

! The side-chain structure file for Aspartate 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.195193052 3.859569550 1.198083878 ASP 2 CT C -0.398 HB1 2.099623203 3.734851122 1.256908774 ASP 2 HC H 0.071 HB2 3.574837923 3.424842119 2.144523859 ASP 2 HC H 0.071 ! rigid unit 1 3 !atoms in this rigid unit CG 3.488366127 5.366341114 1.240691185 ASP 2 C C 0.714 OD1 3.752036572 5.965095997 2.273211718 ASP 2 02 O -0.721 OD2 3.445515871 5.949848175 0.005213364 ASP 2 02 O -0.721 ! BOND INFORMATION
! rigid unit 0 CA 022l6994 l997-09-30 W096l30849 PCT/U' ,~ '012:~9 0 l 2 -l l ! ending o~ incoming bond for unit 0 an~ nn 3.783586502 3.069634438 -0.000003352 !beginning of bond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.488366}27 5.366341114 1.240691185 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 2 -1 -1 !ending of incoming bond for unit 1 and nn 3.195193052 3.859569550 1.198083878 !beginning of bonl for unit 1 0 !bonds out from rigid unit 1 *********************************************************
DATA FILE FOR GLUTAMINE - E.DAT
*********~***********************************************

! The side-chain structure file ~or Glutamine 3 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.210191727 3.806770086 1.242457986 GLU 2 CT C -0.184 HB1 3.453276873 4.884052753 1.160096049 GLU 2 HC H 0.092 HL2 2.103818655 3.775332928 1.193925381 GLU 2 HC H 0.092 ! rigid unit 1 3 !atoms in this rigid unit CG 3.670672178 3.303917646 2.650651217 GLU 2 CT C -0.398 HG1 3.495624304 2.214699984 2.732162237 GLU 2 HC H 0.071 HG2 4.766538143 3.410970449 2.754028797 GLU 2 HC H 0.071 ! rigid unit 2 3 !atoms in this rigid unit CD 3.044564962 3.944746017 3.891577959 GLU 2 C C 0.714 OE1 3.318646908 3.594962835 5.031950951 GLU 2 02 O -0.721 OE2 2.157183647 4.937835217 3.607111931 GLU 2 02 O -0.721 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634438 -0.000003351 !beginning of bond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.670672178 3.303917646 2.650651217 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 2 -1 -1 !ending of incoming bond for unit 1 and nn 3.210191727 3.806770086 1.242457986 !beginning of bond for unit 1 1 !bonds out from rigid unit 1 2 !unit 1 is bonded to unit 2 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.044564962 3.944746017 3.891577959 !ending of outgoing bond for unit 1 ! rigid unit 2 0 1 2 -1 -1 !ending of incoming bond for unit 1 and nn 3.670672178 3.303917646 2.650651217 !beginning of bond for unit 2 0 !bonds out from rigid unit 2 ********************************************************
DATA FILE FOR PHENYLALANINE - F.DAT
*********************************************************

! The side-chain structure file for Phenylalanine 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 W~ 96130849 PCr/US96/042'~9 3 !atoms in this rigid unit CB 3.271046400 3.829343796 1.261018753 PHE 2 CT C -0.100 B 1 3.711064339 3.375446320 2.172759056 PHE 2 HC H 0.108 HB2 3.680548668 4.858696938 1.261503935 PHE 2 HC H 0.108 ! rigid unit 1 11 !atoms in this rigid unit CG 1.746863961 3.913921356 1.435816050 PHE 2 CA C -O . 100 CDl 1.070973635 2.894981861 2.116770267 PHE 2 CA C -0.150 HDl 1.621361971 2.061387062 2.533305407 PHE 2 HC H 0.150 CD2 1.019180536 4.963639259 0.869901121 PHE 2 ~A C -O.150 HD2 1.528048277 5.750367641 0.331381440 PHE 2 HC H 0.150 CEl -0.315989435 2.915796280 2.214086056 PHE 2 CA C -0.150 HEl -0.830357015 2.108316422 2.715482712 PHE 2 HC H 0.150 CE2 -0.369023502 4.989082813 0.977358818 PHE 2 CA C -0.150 HE2 -0.928361893 5.798536777 0.531342983 PHE 2 HC H 0.150 CZ -1.036266327 3.964326382 1.646436572 PHE 2 CA C -0.150 HZ -2.113304853 3.975853443 1.718335271 PHE 2 HC H 0.150 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending o~ incoming bond and nn 3.783586264 3.069634914 -0.000003353 !beginning of bond 1 !bonds out 1 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 1.746863961 3.913921356 1.435816050 !ending o~ outcgoing WO 96/30849 PCT/U' 3C~0~229 bond ! rigid unit 1 0 1 3 -1 -1 !ending of incoming bond and nn 3.271046400 3.829343796 1.261018753 !beginning of bond 0 !bonds out ***********************************************************
DATA FILE FOR GLYCINE - G.DAT
*******,,,*************************~***************************

! The side-chain structure ~ile for Glycine 1 !rigid unit in side-chain ! ATOM INFORMATION
! rigid unit 0 1 !atom in this rigid unit HA2 2.054570675 -0.518772364 -0.887896836 GLYN 1 HC H 0.032 ! BOND INFORMATION
! rigid unit 0 0 -1 -1 -1 -1 !ending of incoming bond for unit 0 and nn 1.612465143 -0.031237146 -0.000000015 !beginning of incoming bond for unit 0 0 !bonds out ~rom rigid unit 0 ***************~*************************t*****************

DATA FILE FOR HISTIDINE - H.DAT
**********************************************************

! The side-chain structure file for Histidine 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.239844084 3.731920242 1.277127385 HIS 2 CT C -0.098 B1 2.644425392 3.025787830 1.893024564 HIS 2 HC H 0.038 B2 4.064783096 4.071127415 1.934927344 HIS 2 HC H 0.038 WO 96/30849 PCT/US96tO422'9 ! rigid unit 1 8 !atoms in this rigid unit CG 2.370461226 4.918142319 0.978080690 HIS 2 CC C 0.251 ND1 2.062596560 5.403582573 -0.290515751 HIS 2 NB N -0.502 CEl 1.272076607 6.440367222 0.045922592 HIS 2 CR C 0.241 NE2 1.048720956 6.674089432 1.367565274 HIS 2 NA N -0.146 CD2 1.767608762 5.675839901 1.972463250 HIS 2 CW C -0.184 HE1 0.858503580 7.036557198 -0.757577479 HIS 2 HC H 0.036 HE2 0.480951071 7.411210537 1.809884906 HIS 2 H H 0.228 HD2 1.867301583 5.485908508 3.037219763 HIS 2 HC H 0.114 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634438 -0.000003353 !beginning of bond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 2.370461226 4.918142319 0.978080690 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 4 -1 -1 !ending of incoming bond for unit 1 and nn 3.222899199 3.830397844 1.236912012 !beginning of bond for unit 1 0 !bonds out from rigid unit 1 ., ***********************************************************
~ DATA FILE FOR ISOLEUCINE - I.DAT
***********************************************************,~**

! The side-chain structure file for Isoleucine W 096/30849 PCTrUS96/~4229 4 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 2 !atoms in this rigid unit CB 3.184130907 3.905461311 1.203313947 ILE 2 CT C -0.012 7 HB 3.579479933 3.448693275 2.135145664 ILE 2 HC H 0.022 ! rigid unit 1 4 !atoms in this rigid unit CG2 3.632628202 5.399640560 1.184555411 ILE 2 CT C -0.085 HG21 3.256929159 5.962747097 2.057613134 ILE 2 HC H 0.029 HG22 4.728721142 5.525658131 1.229067683 ILE 2 HC H 0.029 HG23 3.277012348 5.929985046 0.281316549 ILE 2 HC H 0.029 ! rigid unit 2 3 !atoms in this rigid unit CGl 1.625806093 3.868085861 1.310235620 ILE 2 CT C -0.049 HGll 1.169472456 4.395492077 0.450418025 ILE 2 HC H 0.027 HG12 1.273633957 2.823534966 1.211708426 ILE 2 HC H 0.027 ! rigid unit 3 4 !atoms in this rigid unit CDl 1.028863907 4.391342163 2.632859945 ILE 2 CT C -0.085 HDll -0.068560459 4.262083530 2.654643297 ILE 2 HC H 0.028 HD12 1.436750174 3.852109432 3.508637428 ILE 2 HC H 0.028 HD13 1.222232699 5.468014240 2.787941933 ILE 2 HC H 0.028 ! BOND INFORMATION
! rigid unit 0 0 1 -1 -1 -1 !ending of incoming bond and nn CA 022l6994 l997-09-30 WO 96r30849 PCT/U:~5G~0122'9 3.783586502 3.069634438 -0.000003350 !beginning of bond 2 !bonds Out 1 !unit bonded to 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 3.632628202 5.399640560 1.184555411 !ending of outgoing bond 2 !unit bonded to 0 l -l -1 -1 ! beginning of outgoing bond and nn 1.625806093 3.868085861 1.310235620 !ending of outgoing bond ! rigid Ullit 1 0 1 2 3 -1 !ending of incoming bond and nn 3.184130907 3.905461311 1.2033139~7 !beginning of incoming bond 0! bonds out ! rigid UIlit 2 0 1 2 -1 -1 !ending of incoming bond and nn 3.184130907 3.905461311 1.203313947 !beginning of incoming bond 1 !bonds out 3 !unit bonded to 0 1 2 -1 1 ! beginning of outgoing bond and nn 1.028863907 4.391342163 2.632859945 !ending of outgoing bond ! rigid unit 3 0 1 2 3 -1 !ending of incoming bond and nn 1.625806093 3.868085861 1.310235620 !beginning of bond 0 !bonds out ************************************************************
DATA FILE FOR LYSINE - K.DAT
*********************************************~***************

! The side-chain structure file for Lysine 5 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this riyid unit CB 3.218223095 3.8297~5770 1.231236458 LYS 2 CA 022l6ss4 lgg7-o9-3o W096/30849 PCT~S96/04229 CT C -0.098 B 1 2.112416506 3.764609814 1.234413505 LYS 2 HC H 0.038 B 2 3.536234617 3.317805290 2.163102627 hYS 2 HC H 0.038 ! rigid unit 1 3 !atoms in this rigid unit CG 3.638167858 5.320005417 1.281187057 LYS 2 CT C -0.160 HGl 4.741127968 5.406830788 1.274424553 LYS 2 HC H 0.116 HG2 3.295989990 5.833013058 0.360635072 LYS 2 HC H 0.116 ! rigid unit 2 3 !atoms in this rigid unit CD 3.153400660 6.084614754 2.516160011 LYS 2 CT C -0.180 HDl 2.046517849 6.074027538 2.552636147 LYS 2 HC H 0.122 HD2 3.501233101 5.571547031 3.435809374 LYS 2 HC H 0.122 ! rigid unit 3 3 !atoms in this rigid unit CE 3.699187756 7.518018246 2.469964743 LYS 2 CT C -0.038 HEl 4.805956841 7.515174866 2.558616400 LYS 2 HC H 0.098 HE2 3.475801945 8.000639915 1.495867610 LYS 2 HC H 0.098 ! rigid unit 4 4 !atoms in this rigid unit NZ 3.098134756 8.306216240 3.560437918 LYS 2 N3 N -0.138 HZl 3.463554621 9.268757820 3.530759573 LYS 2 H3 H 0.294 HZ2 2.074491024 8.324481964 3.447653770 LYS 2 H3 H 0.294 HZ3 3.335658073 7.877095222 4.466163158 LYS 2 H3 H 0.294 W096/30849 PCT~S96/042:29 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond and nn 3.783586502 3.069634914 -0.000003353 !beginning of bond 1 !bonds out 1 !unit bonded to 0 1 2 -1 -1 ! beg;nn;ng of outgoing bond and nn 3.638167858 5.320005417 1.281187057 !ending of outgoing bond ! rigid unit 1 0 1 2 -1 -1 !ending of incoming bond and nn 3.218223095 3.829745770 1.231236458!beginning of bond 1 !bonds out 2 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.153400660 6.084614754 2.516160011 !ending of outgoing bond ! rigid unit 2 0 1 2 -1 -1 !ending of incoming bond and nn 3.638167858 5.320005417 1.281187057 !beginning of bond 1 !bonds out 3 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.699187756 7.518018246 2.469964743 !ending of outgoing bond ! rigid unit 3 0 1 2 -1 -1 !ending of incoming bond and nn 3.153400660 6.084614754 2.516160011!beginning of bond 1 !bonds out 4 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.098134756 8.306216240 3.560437918 !ending of outgoing bond ! rigid unit 4 0 1 2 3 -1 !ending of incoming bond and nn 3.699187756 7.518018246 2.469964743!beginning of bond 0 !bonds out -*************************************************************

CA 022l6sg4 lgg7-o9-3o W096/308~9 PCT/u~5~'01229 DATA FILE FOR LEUCINE - L.DAT
*************************************~******~******************

! The side-chain structure file for heucine 4 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.217977524 3.8606934551.213688374 LEU 2 CT C -0.061 HB1 3.617908239 3.4132370952 146348953 LEU 2 HC H 0.033 HB2 3.641148329 4.8841538431.193638206 LEU 2 HC H 0.033 ! rigid unit 1 2 !atoms in this rigid unit CG 1.676206470 3.9749443531.357627273 LEU 2 CT C -0.010 HG 1.273801684 2.9625828271.570222020 LEU 2 HC H 0.031 ! rigid unit 2 4 !atoms in this rigid unit CD1 1.322771311 4.8803067212.545703411 LEU 2 CT C -0.107 HD11 0.229164675 4.9364266402.704123735 LEU 2 HC H 0.034 HD12 1.758654118 4.5070152283.491832256 LEU 2 HC H 0.034 HD13 1.684926391 5.9167380332.406197309 LEU 2 HC H 0.034 ! rigid unit 3 4 !atoms in this rigid unit CD2 0.998154640 4.5042629240.083184890 LEU 2 CT C -Q.107 HD21 -0.093163513 4.6228127480.214309067 LEU 2 HC H 0.034 HD22 1.406615853 5.481475830-0.234147355 LEU 2 HC H 0.034 HD23 1.130140185 3.802904606-0.761629283 LEU 2 CA 022l6ss4 lgg7-o9-3o W096/30849 PCT~S961042;!9 EC H 0.034 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond and nn 3.783586502 3.069634438 -0.000003367!beginning of boncl 1 !bonds out 1 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 1.676206470 3.974944353 1.357627273 !ending of outgoing bond ! rigid unit 1 0 1 -1 -1 -1 !ending of incoming bond and nn 3.184130907 3.905461311 1.203313947 !beginning of incoming bond 2! bonds out 2 !unit bonded to 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 1.322771311 4.880306721 2.545703411 !ending o~ outgoing bond 3 !unit bonded to 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 0.998154640 4.504262924 0.083184890 !ending of outgoing bond ! rigid unit 2 0 1 2 3 -1 !ending of incoming bond and nn 1.676206470 3.974944353 1.357627273 !beginning of incoming bond 0 !bonds out ! rigid unit 3 0 1 2 3 -1 !ending of incoming bond and nn 1.676206470 3.974944353 1.357627273 !beginning of bond 0 !bonds out ********,,~,~.**************************************************
DATA FILE FOR METHIONINE - M.DAT
. ** *****************************************

! The side-chain structure file for Methionine 4 !rigid units in side-chain CA 022l6994 1997-09-30 W096/30849 PCT~S96/04229 ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.219568014 3.840672970 1.22S060582 MET 2 CT C -0.151 HBl 3.54786S868 3.348565578 2.163037539 MET 2 HC H 0.027 HB2 3.671003819 4.850576401 1.262409329 MET 2 HC H 0.027 ! rigid unit 1 3 !atoms in this rigid unit CG 1.685955524 4.011272907 1.265707970 MET 2 CT C -0.054 HGl 1.291312337 4.382569790 0.302083224 MET 2 HC H 0.0652 HG2 1.199923158 3.034499168 1.452733874 MET 2 HC H 0.0652 ! rigid unit 2 3 !atoms in this rigid unit SD 1.234688163 5.162067413 2.574714422 MET 2 S S 0.737 LDl 1.486726403 6.202064514 2.319993973 MET 2 LP L -0.381 LD2 1.747960329 4.937880516 3.521441460 MET 2 LP L -0.381 ! rigid unit 3 4 !atoms in this rigid unit CE -0.532971203 4.837210655 2.617241383 MET 2 CT C -0.134 HEl -0.987815082 4.991072178 1.622043610 MET 2 HC H 0.0652 HE2 -1.033426285 5.510134220 3.335405111 MET 2 HC H 0.0652 HE3 -0.725545764 3.794905424 2.929581165 MET 2 HC H 0.0652 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond and nn 3.783586502 3.069634438 -0.000003354 !beginning of bond WO 96~30849 PCT/US96/04229 1 !bonds out 1 !unit bonded to o 1 2 -1 -1 ! beginning of outgoing bond and nn - 1.685955524 4.011272907 1.265707970 !ending o~ outqoing bond ! rigid unit 1 0 1 2 -1 -1 !ending of incoming bond and nn 3.219568014 3.840672970 1.225060582 !beginning of bond 1 !bonds out 2 !unit bonded to o 1 2 -1 -1 ! beginning of outgoing bond and nn 1.234688163 5.162067413 2.~74714422 !ending of outgoing bond ! rigid unit 2 0 1 2 -1 -1 !ending of incoming bond and nn 1.685955524 4.011272907 1.265707970 !beginning of bond 1 !bonds out 3 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoiny bond and nn -0.532971203 4.837210655 2.617241383 !ending of outgoing bond ! rigid unit 3 0 1 2 3 -1 !ending of incoming bond and nn 1.234688163 5.162067413 2.574714422!beginning of bond 0 !bonds out ********************t******t*******t***tt*~*****************~***

DATA FILE FOR APSARAGINE - N.DAT
*********************************************************t****

! The side-chain structure file for Asparagine 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.222899199 3.830397844 1.236912012 ASN 2 CT C -0.086 B 1 3.611397266 3.364436865 2.163546562 ASN 2 HC H 0.038 B 2 3.616078854 4.863478184 1.264652491 ASN 2 HC H 0.038 ! rigid unit 1 5 !atoms in this rigid unit CG 1.698638678 3.892561436 1.381467938 ASN 2 C C 0.675 OD1 1.085211635 3.155725241 2.139311790 ASN 2 O O -0.470 ND2 1.031797171 4.746669292 0.652490914 ASN 2 N N -0.867 HD21 0.019928589 4.602556705 0.711063743 ASN 2 H H 0.344 HD22 1.562326550 5.282481670 -0.034363598 ASN 2 H H 0.344 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634438 -0.000003353 !beginning of bond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -} ! beginning of outgoing bond and nn 1.698638678 3.892561436 1.381467938 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 2 -1 -1 'ending of incoming bond for unit 1 and nn 3.222899199 3.830397844 1.236912012 !beginning of bond for unit 1 0 !bonds out from rigid unit 1 **************************************************************
DATA FILE FOR GLUTAMINE - Q.DAT
****************************************************************

! The side-chain structure file for Glutamine 3 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CA 022l6ss4 lgg7-o9-3o O~F~3~ P~llU~r~ Z29 ~B 3.221223593 3 805351734 1.236027122 GLN 2 CT C -0.098 H~31 2.115758896 3.733683825 1.223282218 GLN 2 HC H 0.038 HB2 3.538368225 3.258102417 2.148239136 GLN 2 HC H 0.038 ! rigid unit 1 3 !atoms in this rigid unit CG 3.619170427 5.311230183 1.384292126 GLN 2 CT C -0.102 HGl 4.719832420 5.417502403 1.395145655 GLN 2 HC H 0.057 HG2 3.298108339 5.879051685 0.491232127 GLN 2 HC H 0.057 ! rigid unit 2 5 !atoms in this rigid unit CD 3.148421526 6.090956688 2.618209839 GLN 2 C C 0.675 OEl 3.471138716 7.255728722 2.789397001 GLN 2 O O -0.470 NE2 2.408394814 5.500250816 3.521779537 GLN 2.
N N -0.867 HE21 2.231919527 4.508390427 3.353902817 GLN 2 H H 0.344 HE22 2.192787886 6.069860935 4.342392445 GLN 2 H H 0.344 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634438 -0.000003353 !beginning of bond for unit 0 1 !bonds out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.619170427 5.311230183 1.384292126 !ending of outgoing bond for un;.t 0 ! rigid unit: 1 0 1 2 -1 -1 !ending of incoming bond for unit 1 and nn 3.221223593 3.805351734 1.236027122 !beginning of bond for WO 96t30849 PCT/US96/04229 unit 1 1 !bonds out ~rom rigid unit 0 2 !unit 1 is bonded to unit 2 0 1 2 -1 -1 ! beginning o~ outgoing bond and nn 3.148421526 6.090956688 2.618209839 !ending of outgoing bond for unit 2 ! rigid unit 2 0 1 2 -1 -1 !ending of incoming bond for unit 2 and nn 3.619170427 5.311230183 1.384292126 !beginning o~ bond ~or unit 2 0 !bonds out from rigid unit 2 ***************************************~********************~
DATA FILE FOR ARGININE - R.DAT
********~***************************************************~*

! The side-chain structure file ~or Arginine 4 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.207483053 3.819248199 1.232642174 ARG 2 CT C -0.080 B 1 2.121760130 3.616136551 1.319550753 ARG 2 HC H 0.056 B2 3.644849300 3.393733978 2.159598827 ARG 2 HC H 0.056 ! rigid unit 1 3 !atoms in this rigid unit CG 3.412360668 5.357305527 1.216631651 ARG 2 CT C -0.103 HG1 4.487451553 5.614737511 1.132390837 ARG 2 HC H 0.074 HG2 2.938670874 5.796108723 0.315252036 ARG 2 HC H 0.074 ! rigid unit 2 3 !atoms in this rigid unit CD 2.850392818 6.038671017 2.471077681 ARG 2 CT C -0.228 PCT/US96/042Z'9 WO 96131)849 HDl 1.7694808245.816972256 2.580044270 ARG :2 HC H 0.133 ED2 3.3539898405.649005413 3.379585028 ARG 2 HC H 0.133 ! rigid unit 3 9 !atoms in this rigid unit NE 3.0696160797.502031326 2.345978022 ARG :2 N2 N -0.324 HE 3.5398659717.837357998 1.493146777 ARG 2 H8 H 0.269 CZ 2.7107996948.413488388 3.240067959 ARG :2 CA C O.760 NHl 2.9725720889.643490791 2.971310854 ARG 2 N2 N -0.624 HHll 3.4399552359.745957375 2.068439484 ARG 2 H3 H 0.361 HH12 2.69742274310.348603249 3.651821136 ARG 2 H3 H 0 . 361 NH2 2.1143651018.144207001 4.363539696 ARG .' N2 N -0.624 EH21 1.8880478148.930854797 4 .969158173 ARG 2 H3 H 0.361 HH22 1.9471074347.146794796 4.499028206 ARG 2 E3 H 0.361 ! 80ND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.783586502 3.069634914 -0.000003315 !beginning of bon~ for unit 0 1 !bond out from rigid unit 0 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.412360668 5.357305527 1.216631651 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.207483053 3.819248199 1.232642174 !beginning of bon~ ~or - unit 1 1 !bond out from rigid unit 1 WO 96/30849 PCT/US96tO4229 2 !unit 1 is bonded to unit 2 0 1 2 -1 -1 ! beginning of outgoing bond and nn 2.850392818 6.038671017 2.471077681 !ending of outgoing bond ! rigid unit 2 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 3.412360668 5.357305527 1.216631651 !beginning of bond for unit 2 1 !bond out from rigid unit 2 3 !unit 2 is bonded to unit 3 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.069616079 7.502031326 2.345978022 !ending of outgoing bond ! rigid unit 3 0 1 2 -1 -1 !ending of incoming bond for unit 0 and nn 2.850392818 6.038671017 2.471077681!beginning of bond for unit 3 0 !bonds out from rigid unit 3 ******************************************,~.*********~,****~***
DATA FILE FOR SERINE - S.DAT
*********~*****~*******************************~*********~**

! The side-chain structure file for Serine 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.203660250 3.871555328 1.191825747 SER 2 CT C 0.018 B1 3.445731640 4.945727825 1.071671009 SER 2 HC H 0.119 B2 2.097403765 3.828571320 1.202566266 SER 2 HC H 0.119 ! rigid unit 1 2 !atoms in this rigid unit OG 3.711599350 3.433972597 2.457015276 SER 2 OH O -0.550 HG 3.430009127 2.523327112 2.580434084 SER 2 CA 022l6994 l997-09-30 W~96130849 PCT/Ub,C~0~229 ! BOND INFORMATION

! rigid ~mit 0 0 1 2 -1 -1 !ending o~ incoming bond for unit 0 and nn 3.783586502 3.069634438 -0.000003353 !beginning oi. bond for unit 0 1 !bonds out ~rom rigid unlt o 1 !unit 0 is bonded to unit 1 0 1 2 -1 -1 ! beginning of outgoing bond and nn 3.711599350 3.433972597 2.457015276 !ending of out:going bond f or unit 0 ! riyid unit 1 o 1 -1 -1 -1 !ending of incoming bond for unit 1 and nn 3.203660250 3.871555328 1.191825747 !beginning o~- bond for unit 1 o !bonds out f rom rigid unit l *********************************************************t.**
DATA FILE FOR THREONINE - T.DA
*******t*************************************************~**

! The side-chain structure f ile f or Threonine 3 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 2 !atoms in this rigid unit CB 3.220216751 3.864162445 1.226425409 THR 2 CT C 0.170 H~3 3.504307270 3.322291374 2.154003382 THR 2 HC H 0.082 ! rigid unit 1 2 !atoms in this rigid unit OG1 1.802008867 3.940322876 1.161503792 THR 2 OH O -0.550 HG1 1.520381451 4.374082565 1.972538352 THR 2 HO H 0.310 ! rigid unit 2 4 !atoms in this rigid unit CG2 3.680637360 5.331728935 1.361316323 THR 2 CA 022l6994 l997-09-30 W096,'3-819 PCT/u~,'0~229 CT C -0.191 HG21 3.224400043 5.832503796 2.234619141 THR 2 HC H 0.065 HG22 4.774106026 5.420624733 1.502453089 THR 2 HC H 0.065 HG23 3.418393373 5.928008556 0.466874599 THR 2 HC H 0.065 ! BOND INFORMATION
! rigid unit 0 0 1 -1 -1 -1 !ending of incoming bond and nn 3.783586502 3.069634438 -0.000003353 !beginning of bond 2 !bonds out 1 !unit 0 is bonded 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 1.802008867 3.940322876 1.161503792 !ending of outgoing bond for unit 0 2 !unit 0 is bonded 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 3.680637360 5.331728935 1.361316323 !ending of outgoing bond for unit 0 ! rigid unit 1 0 1 -1 -1 -1 !ending of incoming bond and nn 3.220216751 3.864162445 1.226425409 !beginning of bond for unit 1 0 !bonds out ! rigid unit 2 0 1 2 3 -1 !ending of incoming bond and nn 3.220216751 3.864162445 1.226425409 !beginning of bond for unit 1 0 !bonds out ***************************************************************
DATA FILB FOR VALINE - V.DAT
**************************************************************

! The side-chain structure file for Valine 3 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 WO 96r30849 PCT/US96/04229 2 !atoms in this rigid unit CB 3.211601496 3.852613449 1.247815728 VAL 2 CT C -0.012 HB 3.447319269 3.248452187 2.150032282 VAL 2 HC H 0.024 ! rigid unit 1 4 !atoms in this rigid unit CGl 1.676198244 4.045934200 1.217347741 VAL 2 CT C -0.091 HGll 1.351996183 4.697401524 0.384493083 VAL 2 HC H 0.031 HG12 1.142809749 3.084587097 1.106773376 VAL 2 HC H 0.031 HG13 1.300095797 4.498250008 2.155061245 VAL 2 HC H 0.031 ! rigid unit 2 4 !atoms in this rigid unit CG2 3.797980547 5.269292355 1.500991821 VAL 2 CT C -0.091 HG21 3.634918213 5.953960419 0.647068620 VAL 2 HC H 0.031 HG22 3.359194279 5.751780510 2.395626068 VAL 2 HC H 0.031 HG23 4.886912346 5.247161865 1.696415067 VAL 2 HC H 0.031 ! BOND INFORMATION
! rigid unit 0 0 1 -1 -1 -1 !ending of incoming bond and nn 3.783586502 3.069634438 -0.000003354 !beginning of bond 2 !bonds out 1 !unit bonded to 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 1.676198244 4.045934200 1.217347741!ending of out:going bond 2 !unit bonded to 0 1 -1 -1 -1 ! beginning of outgoing bond and nn 3.797980547 5.269292355 1.500991821!ending of out:going bond ! rigid unit 1 WO 96t30849 PCT/US96/04229 0 1 2 3 -1 !ending of incoming bond and nn 3.211601496 3.852613449 1.247815728 !beginning of outgoing bond 0 !bonds out ! rigid unit 2 0 1 2 3 -1 !ending of incoming bond and nn 3.211601496 3.852613449 1.247815728 !beyinning of outgoing bond 0 !bonds out **************************~**********~***************************
DATA FILE FOR TRYPTOPHAN - W.DAT
*************************t***************************************

! The side-chain structure file for Tryptophan 2 !rigid units in side-chain ! ATOM INFORMATION
! rigid unit 0 3 !atoms in this rigid unit CB 3.247885227 3.809360981 1.256884575 TRP 2 CT C -0.098 HB1 3.555066347 3.270197153 2.175767183 TRP 2 HC H 0.038 HB2 3.728011608 4.802421093 1.350249052 TRP 2 HC H 0.038 ! rigid unit 1 15 !atoms in this rigid unit CG 1.731538415 4.025276661 1.276940465 TRP 2 C* C -0.135 CD1 0.792832434 3.205200195 1.936712861 TRP 2 CW C 0.044 NE1 -0.527979255 3.628766537 1.692452073 TRP 2 NA N -0.352 CE2 -0.376119167 4.727549076 0.861387193 TRP 2 CN C 0.154 CD2 0.994750261 4.975831032 0.602216363 TRP 2 CB C 0.146 HD1 1.058894038 2.330861330 2.516448259 TRP 2 HC H 0.093 HE1 -1.402328849 3.197247982 2.011827707 TRP 2 CA 022l6994 1997-09-30 wos6l30~4s PCT~S96/04229 CE3 1.387488961 6.039774895 -0.250452638 TRP ;~
CA C -O.173 - HE3 2.430646658 6.226261139 -0.463923573 TRP 2 HC H 0.086 CZ3 0.392907262 6.841813087 -0.810243368 TRP :~
CA C -0.066 HZ3 0.674497783 7.661212444 -1.455789328 TRP :~
HC H 0.057 CH2 -0.963685811 6.602497578 -0.548699141 TRP 2 CA C -O.077 HH2 -1.710847259 7.243553162 -0.992942095 TRP 2 HC H 0.074 CZ2 -1.364877820 5.549452305 0.277642310 TRP 2 CA C -O.168 HZ2 -2.410887718 5.363564491 0.470484644 TRP 2 HC H 0.084 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of incoming bond and nn 3.783586740 3.069634914 -0.000003497 !beginning of bond 1 !bonds out 1 !unit 0 is bonded 0 1 2 -1 1 ! beginning of outgoing bond and nn 1.731538415 4.025276661 1.276940465!ending of outyoing bond for unit 0 ! rigid unit 1 0 1 4 -1 -1 !ending of incoming bond and nn 3.247885227 3.809360981 1.256884575 !beginning of bond for unit 1 0 !bonds out **************************************************************
DATA FILE FOR TYROSINE - Y.DAT
************************************************************'~****
., ! The side-chain structure file for Tyrosine - 3 !rigid units in side-chain ! ATOM INFORMATION

! rigid unit 0 3 !atoms in this rigid unit CB 3.293353796 3.842515945 1.259159327 TYR 2 CT C -0.098 B 1 3.703839302 3.358918667 2.169649363 TYR 2 HC H 0.038 B 2 3.749134064 4.852351665 1.277104497 TYR 2 HC H 0.038 ! rigid unit 1 10 !atoms in this rigid unit CG 1.778211594 4.019127369 1.411828637 TYR 2 CA C -0.030 CDl 1.068759203 3.196300983 2.292453527 TYR 2 CA C -0.002 HDl 1.585003138 2.435774803 2.862824917 TYR 2 HC H 0.064 CD2 1.095163584 4.989490032 0.672801077 TYR 2 CA C -0.002 HD2 1.629922271 5.630218983 -0.014210327 TYR 2 HC H 0.064 CEl -0.309100747 3.338460445 2.427857637 TYR 2 CA C -0.264 HEl -0.845880806 2.691843510 3.105883360 TYR 2 HC H 0.102 CZ -0.983952701 4.304777145 1.686211467 TYR 2 C C 0.462 CE2 -0.283983082 5.129064560 0.809688389 TYR 2 CA C -0.264 HE2 -0.814125061 5.873366833 0.234044328 TYR 2 HC H 0.102 ! rigid unit 1 2 !atoms in this rigid unit OH -2.337103367 4.443373203 1.815491915 TYR 2 OH O -0.528 HH -2.648404837 3.798558235 2.453088284 TYR 2 HO H 0.334 ! BOND INFORMATION
! rigid unit 0 0 1 2 -1 -1 !ending of ;noo~;ng bond and nn CA 022l6994 l997-09-30 WC~ 9613~849 PCT/U~3.'; '~12:29 3.783586264 3.069634914 -0.000003354 !~eginning of bond 1 !bonds out 1 !unit bonded to 0 1 2 -1 -1 ! beginning of outgoing bond and nn 1.778211594 4.019127369 1.411828637!ending of outgoing bond for unit 0 ! rigid unit 1 0 1 3 -1 -1 !ending of incoming bond and nn 3.293353796 3.842515945 1.259159327 !beginning of bond for unit 1 1 !bonds out 2 !unit bonded to 7 5 8 -1 -1 ! beginning of outgoing bond and nn -2.337103367 4.443373203 1.815491915 !ending of outgoing bond for unit 0 ! rigid unit 2 0 1 ~ 1 !ending of incoming bond and nn -0.983952701 4.304777145 1.686211467 !beginning of bond for unit 1 0 !bonds out *************************************t**********************

DATA FILE FOR INITIAL PROlOTY~ - CX6C.CAR
************************************************************

!BIOSYM archive 3 PBC=OFF
!DATE Thu Mar 2 10:02:29 1995 SG 0.051616628 8.775964550 2.653307337 CYSn 1 S S 0.824 LGl -0.116704460 8.906803991 3.732450018 CYSn 1 LP L -0.405 LG2 -0.816371929 8.216369655 2.274560255 CYSn 1 LP L -0.405 CB 1.625257994 7.970290997 2.280061368 CYSn 1 CT C -0.098 HBl 1.743097230 7.117856362 2.972980432 CYSn 1 HC H 0.050 B2 2.457560406 8.667686711 2.506611212 CYSn 1 CA 02216994 lgg7-09-30 wos6l3o84s PCT~S96/04229 HC H 0.050 CA 1.664891168 7.503978115 0.811322158 CYSn 1 CTC 0.035 HA2.715618613 7.453348875 0.469159517 CYSn 1 HC H 0.032 N0.954382540 8.512673633 0.003030230 CYSn 1 NT N -0.463 C1.063568189 6.132700222 0.616111991 CYSn 1 CC 0.616 O0.248707622 5.654726837 1.414398016 CYSn 1 O0 -0.504 N1.449902196 5.479885680 -0.464156147 GLY 2 NN -0.463 HN2.157106102 5.992384244 -1.099457509 GLY 2 HH 0.252 CA0.868490592 4.154014497 -0.652902307 GLY 2 CTC 0.035 HAl1.5509081493.403064022 -0.212395307 GLY 2 HC H 0.032 HA2-0.0976605584.132736815 -0.116611463 GLY 2 HCH 0.032 C0.730531165 3.827591429 -2.120728786 GLY 2 CC 0.616 O1.559375145 4.206208097 -2.957020570 GLY 2 OO -0.504 N-0.320742949 3.103195380 -2.456098946 GLY 3 NN -0.463 HN-0.976177839 2.817016114 -1.646836012 GLY 3 HH 0.252 CA-0.454134161 2.787581074 -3.875321662 GLY 3 CTC 0.035 HAl-0.9074228301.783240810 -3.972773051 GLY 3 HCH 0.032 HA2-1.1276485663.540414569 -4.323795441 GLY 3 HCH 0.032 C0.896974016 2.736484179 -4.547627543 GLY 3 CC 0.616 O1.315189212 1.712629073 -5.101282348 GLY 3 OO -0.504 CA 022l6994 l997-09-30 WO 96130'B49 PCT~US96/0~2;Z9 N 1.599575272 3.853622667 -4.520184621 GLY 4 N N -0.463 HN 1.137216234 4.691535216 -4.019658253 GLY 4 H H 0.252 CA 2.905944550 3.804217731 -5.170228610 GLY 4 CT C 0.035 HAl 3.056204584 2.789614618 -5.584558431 GLY 4 HC H 0.032 HA2 2.897891721 4.540755026 -5.994216851 GLY 4 HC H 0.032 C 4.0149800674.050747291 -4.175561433 GLY 4 C C 0.616 O 4.978871195 4.780583329 -4.436272241 GLY 4 O O -0.504 N 3.8877590743.450944950 -3.006608050 GLY 5 N N -0.463 HN 3.0032761912.844372268 -2.879487738 GLY 5 H H 0.252 CA 4.9600713823.689311240 -2.044877031 GLY 5 CT C 0.035 HAl 5.7095929982.881830301 -2.144167698 GLY 5 HC H 0.032 HA2 5.4273937184.658369322 -2.297948016 GLY 5 HC H 0.032 C 4.4371744703.643619035 -0.629041435 GLY 5 C C 0.616 O 3.7983223522.676595378 -0.197242766 GLY 5 O O -0.504 N 4.7136631134.691871185 0.124033264 GLY 6 N N -0.463 HN 5.2860021665.476492875 -0.348403798 GLY 6 H H 0.252 CA 4.2080807534.647691975 1.492986659 GLY 6 CT C 0.035 HAl 3.3038001824.010943092 1.515218779 GLY 6 HC H 0.032 HA2 4.9930573744.194323221 2.125265975 GLY 6 HC H 0.032 C 3.7992659816.023038258 1.963510280 GLY 6 C C 0.616 O 4.0068245227.036283245 1.285298717 GLY 6 O O -0.504 N 3.1956902116.077750863 3.136158080 GLY 7 N N -0.463 HN 3.0551078135.133307510 3.640799839 GLY 7 H H 0.252 CA 2.8004124177.407555656 3.591101372 GLY 7 CT C 0.035 HAl 1.9466876777.303619509 4.286815466 GLY 7 HC H 0.032 HA2 3.6608620817.847316876 4.127520148 GLY 7 HC H 0.032 C 2.3345781648.258959996 2.434291753 GLY 7 C C 0.616 O 2.3374112369.494643783 2.487154063 GLY 7 O O -0.504 N 1.936206121 7.605756209 1.358640986 CYSN 8 N N -0.463 HN 1.9836324576.5282407681.414418956 CYSN 8 H H 0.252 CA 1.4857969198.4289682160.240136508 CYSN 8 CT C 0.035 HA 0.399931102 8.271042216 0.100059529 CYSN 8 HC H 0.032 C 2.167493478 8.018162291 -1.043072620 CYSN 8 C C 0.616 CB 1.746659419 9.902481747 0.610166221 CYSN 8 CT C -0.098 HBl 2.709270705 10.016688002 1.140264476 CYSN 8 HC H 0.050 HB2 1.816139488 10.541353385 -0.293951287 CYSN 8 HC H 0.050 SG 0.440719361 10.532225816 1.688457720 CYSN 8 S S 0.824 LGl -0.40423909710.9571459371.126774557 CYSN 8 LP L -0.405 LG2 0.793091788 11.329491558 2.359427872 CYSN 8 LP L -0.405 CA 022l6994 l997-09-30 WO 96130849 PCr/U,,,. ' 1229 end end ****************************************
***********************************************************
END OF LISTING
**********,~.*************************************************J~***
******************************************************~******"***

**********************************************************~***
**************************~********************************
DATA FILE WEINER FORCES - AMBER.FRC
**********~***************~*********************************~***
*********************************************************

!BIOSYM forcefield 2 ~version amber.frc 1.0 19-Oct-90 #version amber.frc 1.1 8-Aug-92 #define amber This is the new format version of the amber forcefield !Ver Ref Function Label !---- --- -----------_----_________________ ______ 1.O 1 atom_types amber 1.0 1 equivalence amber 1.0 1 hbond_definition amber 1.0 1 quadratic_bond amber 1.0 1 quadratic_angle amber 1.0 1 torsion_3 amber 1.0 1 out of_plane amber 1.0 1 nonbond(12-6) amber 1.0 1 hydrogen_bond(10-12) amber #atom_types amber Atom type definitions for any variant of amber Masses from CRC 1973/74 pages B-250.
!Ver Ref Type Mass Element Comment !---- --- ---- -_________ _______ 1.0 1 C 12.000000 C Kollman's Field: Masses from CRC 1973/74 pages B-250.
1.0 1 C* 12.000000 C

1.0 1 C212.000000 C
1.0 3 C315.000000 C
1.0 1 CA12.000000 C
1.0 1 CB12.000000 C
1.0 1 CC12.000000 C
1.0 3 CD13.000000 C
1.0 3 CE13.000000 C
1.0 3 CF13.000000 C
1.0 3 CG13.000000 C
1.0 3 CH13.000000 C
1.0 3 CI13.000000 C
1.0 3 CJ13.000000 C
1.0 1 CK12.000000 C
1.0 1 CM12.000000 C
1.0 1 CN12.000000 C
1.0 3 CP13.000000 C
1.0 1 CQ12.000000 C
1.0 1 CR12.000000 C
1.0 1 CT12.000000 C
1.0 1 CV12.000000 C
1.0 1 CW12.000000 C
1.0 1 H1.007825 H
1.0 1 H21.007825 H
1.0 1 H31.007825 H
1.0 1 HC1.007825 H
1.0 1 HO1.007825 H
1.0 1 HS1.007825 H
1.0 3 LP3.000000 H
1.0 1 N14.003070 N
1.0 1 N*14.003070 N
1.0 1 N214.003070 N
1.0 1 N314.003070 N
1.0 1 NA14.003070 N
1.0 1 NB14.003070 N
1.0 1 NC14.003070 N
1.0 1 NP14.003070 N
1.0 1 NT14.003070 N
1.0 1 015.994910 0 1.0 1 0215.994910 O

WO 96130849 PCTIUS961042.~9 1.0 1 OH 15.994910 O
1.0 1 OS 15.994910 O
1.0 1 P 30.993760 P
1.0 1 S 31.972070 S
1.0 1 SH 31.972070 S
1.0 3 C0 40.080000 Ca 1.0 3 HW 1.008000 H
1.0 3 IM 35.450000 Cl - 1.0 3 CU 63.550000 Cu 1.0 3 I 22.990000 1.0 3 MG 24.305000 Mg 1.0 3 OW 16.000000 O
1.0 3 QC 132.90000 Cs l.o 3 QK 39.100000 K
1.0 3 QL 6.940000 Li 1.0 3 QN 22.990000 Na 1.0 3 QR 85.470000 Rb 1.1 4 CS 12.000000 Ccarbohydrate sp3 carbc,n 1.1 4 AC 12.000000 C carbohydrate alpha-anome.ric carbon 1.1 4 BC 12.000000 Ccarbohydrate beta-anomeric carbon 1.1 4 HT 1.007825 Hcarbohydrate sp3 hydro 1.1 4 AH 1.007825 Hcarbohydrate alpha-anomeric hydrogen 1.1 4 BH 1.007825 H carbohydrate beta-anomeric hydrogen 1.1 4 HY 1.007825 H carbohydrate hydrc,xyl hydrogen 1.1 4 OT 15.994910 O carbohydrate hydrcxyl oxygen 1.1 4 OA 15.994910 O carbohydrate alpha-anomeric oxygen 1.1 4 OB 15.994910 O carbohydrate beta-anomeric oxygen ~ 1.1 4 OE 15.994910 O carbohydrate ring oxygen 1.O 1 h$ 1.007825 HHydrogen atom for aTOMATIC
PARAMETER assignment 1.0 1 c$ 12.000000 CCarbon atom ~or automatic W 096/30849 PCTrUS96/04229 parameter assignment 1.0 1 n$ 14.003070 N Nitrogen atom for automatic parameter assignment 1.0 1 o$ 15.994910 O Oxygen atom for automatic parameter assignment 1.0 1 s$ 31.972070 S Sulfur atom for automatic parameter assignment 1.0 1 p$ 30.993760 PPhosphorous atom for automatic parameter assignment #e~uivalence a~ber Equivalence table for any variant of amber ! Equivalences -------------_-__________________________ !Ver Ref Type NonB Bond Angle Torsion OOP
!---- --- ---- ---- ---- _____ _______ ____ 1.0 1 C C C C C C
1.O 1 C* C* C* C* C* C*
1.0 1 C2 C2 C2 C2 C2 C2 1.0 1 C3 C3 C3 C3 C3 C3 1.0 1 Q Q Q CA CA Q
1.0 1 CB CB CB CB CB CB
1 . O 1 CC CC CC CC CC CC
1.0 1 CD CD CD CD CD CD
1.0 1 CE CE CE CE CE CE
1.0 1 CF CF CF CF CF CF
1.0 1 CG CG CG CG CG CG
1.0 1 CH CH CH CH CH CH
1.0 1 CI CI CI CI CI CI
1.0 1 CJ CJ CJ CJ CJ CJ
1.0 1 CK CK CK CK CK CK
1.0 1 CM CM CM CM CM CM
1.0 1 CN CN CN CN CN CN
1.0 1 CP CP CP CP CP CP
1.0 1 CQ CQ CQ CQ CQ CQ
1.0 1 CR CR CR CR CR CR
1.0 1 CT CT CT CT CT CT
1. 0 1 CV CV CV CV CV CV
1.O 1 CW CW CW CW CW CW
1.0 1 H H H H H H

WO 9613~1849 PCT/U:,,G/O~ZZ9 1.0 1 H2 H2 H2 H2 H2 H2 1.0 1 H3 H3 H3 H3 H3 H3 1.0 1 HC HC HC HC HC HC
1.0 1 HO HO HO HO HO HO
1.0 1 HS HS HS HS HS HS
1.0 1 LP LP LP LP LP LP
1.0 1 N N N N N N
1.0 1 N* N* N* N* N* N*
1.0 1 N2 N2 N2 N2 N2 N2 1.0 1 N3 N3 N3 N3 N3 N3 1.0 1 NA NA NA NA NA NA
1.0 1 NB NB NB NB NB NB
1.0 1 NC NC NC NC NC NC
1.0 1 NP NP NP NP NP NP
1.0 1 NT NT NT NT NT NT
1.0 1 0 0 0 0 0 0 1.0 1 02 02 02 02 02 02 1.0 1 OH OH OH OH OH OH
1.0 1 OS OS OS OS OS OS
1.0 1 P P P P P P
1.0 1 S S S S S S
1.0 1 SH SH SH SH SH SH
1.0 3 1.0 3 CU CU CU CU CU CU
1.0 3 IM IM IM IM IM IM
1.0 3 CO CO CO CO CO CO
1.0 3 HW HW HW HW HW HW
1.0 3 MG MG MG MG MG MG
1.0 3 OW OW OW OW OW OW
1.0 3 QC QC QC QC QC QC
1.0 3 QK QK QK QK QK QK
1.0 3 QL QL QL QL QL QL
1.0 3 QN QN QN QN QN QN
1.0 3 QR QR QR QR QR QR
1.1 4 CS CS CS CS CS CS
1.1 4 AC AC AC AC AC AC
1.1 4 BC BC BC BC BC BC
1.1 4 HT HT HT HT HT HT
1.1 4 AH AH AH AH AH AH

W096/30849 PCT~S96/04229 1.1 4 BH BH BH BH BH BH
1.1 4 HY HY HY HY HY HY
1.1 4 OT OT OT OT OT OT
1.1 4 OA OA OA OA OA OA
1.1 4 OB OB OB OB OB OB
1.1 4 OE OE OE OE OE OE
1.0 1 h$ h$ h$ h$ h$ h$
1.0 1 c$ c$ c$ c$ c$ c$
1.0 1 n$ n$ n$ n$ n$ n$
1.0 1 o$ o$ o$ o$ o$ O$
1.0 1 s$ s$ s$ s$ s$ s$
1.0 1 p$ p$ p$ p$ p$ p$
#hbond_de~inition amber 1.0 1 distance2.5000 1.0 1 angle 90.0000 1.0 1 donorsH HO H2 H3 HS
1.0 1 acceptors NB NC 02 O OH S SH
#quadratic_bond amber > E = K2 * (R - R0)~2 !Ver Ref I J R0 K2 !---- --- ---- ---- _______ ________ 1.0 3 OW HW 0.9572 553.0000 1.0 3 HW HW 1.5136 553.0000 1.0 3 CH N3 1.471 367.0000 1.0 3 C3 SH 1. 810 222.0000 1.0 1 C C2 1.5220 317.0000 1.0 1 C C3 1.5220 317.0000 1.0 1 C CA 1.4000 469.0000 1.0 1 C CB 1.4190 447.0000 1.0 1 C CD 1.4000 469.0000 1.0 1 C CH 1. 5220 317.0000 1.0 1 C CJ 1.4440 410.0000 1.0 1 C CM 1.4440 410.0000 1.0 3 C CT 1.5220 317.0000 1.0 1 C N 1.3350 490.0000 1.0 1 C N~ 1.3830 424.0000 1.0 1 C NA 1.3880 418.0000 1.0 1 C NC 1.3580 457.0000 1.0 1 C O 1.2290 570.0000 CA 022l6994 l997-09-30 W096130849 PCT~S96/042Z9 1.0 1 C 02 1.2500 656.0000 1.0 1 C OH 1.3640 450.0000 1.0 1 C* C2 1.4950 317.0000 1. 0 1 C* CB 1.4590 388.0000 1. 0 1 C* CG 1. 3520 546.0000 1. 0 1 C* CT 1. 4950 317.0000 1.0 1 C* CW 1.3520 546.0000 1.0 1 C* HC 1.0800 340.0000 1.0 1 C2 C2 1.5260 260.0000 1.0 1 C2 C3 1.5260 260.0000 1.0 1 C2 CA 1.5100 317.0000 1.0 1 C2 CC 1.5040 317.0000 1.0 1 C2 CH 1.5260 260.0000 1.0 1 C2 N 1.4490 337.0000 1.0 1 C2 N2 1.4630 337.0000 1.0 1 C2 N3 1.4710 367.0000 1.0 1 C2 NT 1.4710 367.0000 1.0 1 C2 OH 1.4250 386.0000 1.0 1 C2 OS 1.4250 320.0000 1.0 1 C2 S 1.8100 222.0000 1.0 1 C2 SH 1.8100 222.0000 1.0 1 C3 CH 1.5260 260.0000 1.0 1 C3 CM 1.5100 317.0000 1.0 1 C3 N 1.4490 337.0000 1.0 1 C3 N* 1.4750 337.0000 1.0 1 C3 N2 1.4630 337.0000 1.0 1 C3 N3 1.4710 367.0000 1.0 1 C3 OH 1. 4250 386.0000 1.0 1 C3 OS 1.4250 320.0000 1.0 1 C3 S 1.8100 222.0000 1.0 1 CA CA 1. 4000 469.0000 1.0 1 CA CB 1.4040 469.0000 1.0 1 CA CD 1.4000 469.0000 1.0 1 CA CJ 1.4330 427.0000 1.0 1 CA CM 1.4330 427.0000 1.0 1 CA CN 1.4000 469.0000 1. 0 1 CA CT 1. 5100 317.0000 1. 0 1 CA HC 1. 0800 340.0000 1. 0 1 CA N2 1. 3400 481.0000 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 1.0 l CA NA 1.3810 427.0000 1.0 1 CA NC 1.3390 483.0000 1.0 1 CB CB 1.3700 520.0000 1.0 1 CB CD 1.4000 469.0000 1.0 1 CB CN 1.4190 447.0000 1.0 1 CB N* 1.3740 436.0000 1.0 1 CB NB 1.3910 414.0000 1.0 1 CB NC 1.3540 461.0000 1.0 1 CC CF 1.3750 512.0000 1.0 1 CC CG 1.3710 518.0000 1.0 1 CC CT 1.5040 317.0000 1.0 l CC CV 1.3750 512.0000 1.0 1 CC CW 1.3710 518.0000 1.0 1 CC NA 1.3850 422.0000 1.0 1 CC NB 1.3940 410.0000 1.0 1 CD CD 1.4000 469.0000 1.0 1 CD CN 1.4000 469.0000 1.0 1 CE N* 1.3710 440.0000 1.0 1 CE NB 1.3040 529.0000 1.0 1 CF NB 1.3940 410.0000 1.0 1 CG NA 1.3810 427.0000 1.0 1 CH CH 1.5260 260.0000 1.0 1 CH N 1.4490 337.0000 1.0 1 CH N* 1.4750 337.0000 1.0 1 CH NT 1.4710 367.0000 1.0 1 CH OH 1.4250 386.0000 1.0 1 CH OS 1.4250 320.0000 1.0 1 CI NC 1.3240 502.0000 1.0 1 CJ CJ 1.3500 549.0000 1.0 1 CJ CM 1.3500 549.0000 1.0 1 CJ N* 1.3650 448.0000 1.0 1 CK HC 1.0800 340.0000 1.0 1 CK N* 1.3710 440.0000 1.0 1 CK NB 1.3040 529.0000 1.0 1 CM CM 1.3500 549.0000 1.0 1 CM CT 1.5100 317.0000 1.0 1 CM HC 1.0800 340.0000 1.0 1 CM N* 1.3650 448.0000 1.0 1 CN NA 1.3800 428.0000 WO 96130849 PCTIUS96/042,!9 1.0 1 CP NA 1.3430 477.0000 1.0 1 CP N~3 1.3350 488.0000 1.0 1 CQ HC 1.0800 340.0000 1.0 1 CQ NC 1.3240 S02.0000 1.0 1 CR HC 1.0800 340.0000 1.0 1 CR NA 1.3430 477.0000 1.0 1 CR N~3 1.3350 488.0000 1.0 1 CT CT 1.5260 310.0000 1.0 1 CT HC 1.0900 331.0000 1.0 3 CT N 1.4490 337.0000 1.0 1 CT N* 1.4750 337.0000 1.0 1 CT N2 1.4630 337.0000 1.0 1 CT N3 1.4710 367.0000 1.0 1 CT OH 1.4100 320.0000 1.0 1 CT OS 1.4100 320.0000 1.0 1 CT S 1.8100 222.0000 1.0 1 CT SH 1.8100 222.0000 1.0 1 CV HC 1.0800 340.0000 1.0 1 CV N~3 1.3940 410.0000 1.0 1 CW HC 1.0800 340.0000 1.0 1 CW NA 1.3810 427.0000 1.0 1 H N 1.0100 434.0000 1.0 1 H N2 1.0100 434.0000 1.0 1 H NA 1.0100 434.0000 1.0 1 H N* 1.0100 434.0000 1.0 1 H2 N 1.0100 434.0000 1.0 1 H2 N2 1.0100 434.0000 1.0 1 H2 NT 1.0100 434.0000 1.0 1 H3 N2 1.0100 434.0000 1.0 1 H3 N3 1.0100 434.0000 1.0 1 HO OH 0.9600 553.0000 1.0 1 HO OS 0.9600 553.OG00 1.0 1 HS SH 1.3360 274.0000 1.0 3 LP S 0.6790 150.0000 1.0 3 LP SH 0.6790 150.0000 1.0 1 02 P 1.4800 525.0000 1.0 1 OH P 1.6100 230.0000 _ 1.0 1 OS P 1.6100 230.0000 1.0 1 S S 2.0380 166.0000 CA 022l6994 l997-09-30 W096/30849 PCTtUS96tO4229 1.1 4 OH HO 0 9600 553.0000 1.1 4 OT HY 0.9720 460.5000 1.1 4 OA HY 0.9720 460. S000 1.1 4 OB HY 0.9720 460.5000 1.1 4 CS HT 1.0990 337.3000 1. l 4 AC AH 1.0990 337.3000 1.1 4 BC BH 1.0990 337.3000 1.1 4 AC HT 1.0990 337.3000 1.1 4 BC HT 1.0990 337.3000 1.1 4 AC OA 1.4110 334.3000 1.1 4 BC OB 1.3900 334.3000 1.1 4 CS OA 1.4400 334.3000 1.1 4 CS OB 1.4400 334.3000 1.1 4 CS CS 1.5230 214 8000 1.1 4 CS CT 1 5230 214.8000 1.1 4 AC CS 1.5230 214.8000 1.1 4 BC CS 1 5230 214.8000 1.1 4 CS OT 1.4110 334.3000 1.1 4 CS OE 1.4270 296.7000 1.1 4 AC OE 1.4270 296.7000 1.1 4 BC OE 1.4270 296.7000 1.1 4 CS N 1.4490 355 0000 1.1 4 H N 1.0100 434.0000 1.1 4 C N 1.3350 490.0000 1.1 4 C O 1.2290 570.0000 1.1 4 C CS 1.5220 335.0000 1.0 1 C$1 C$1 1.5260 260.0000 1.0 1 C$2 C$2 1.4000 469.0000 1.0 1 C$3 C$3 1.3700 520.0000 1.0 1 C$5 C$5 1.2040 590.0000 1.0 1 C$1 0$1 1.4250 386.0000 1.0 1 C$2 0$2 1.2500 280.0000 1.0 1 C$3 0$3 1.2300 300.0000 1.0 1 C$1 N$1 1.4490 337 0000 1.0 1 C$2 N$2 1.3810 427.0000 1.0 1 C$5 N$5 1.1580 649.0000 1.0 1 C$1 S$1 1.8100 222.0000 1.0 1 C$1 H$1 1.0900 331.0000 CA 022l6994 lgg7-o9-3o wos6l30s4s PCT~S96/042;~9 .0 1 0$1 0$1 1.4800 590.0000 1.0 1 0$3 0$3 1.2080 590.0000 1.0 1 0$1 N$1 1.2400 300.0000 1.0 1 0$2 N$2 1.1900 450.0000 1.0 1 0$3 N$3 1.1860 590.0000 1.0 1 0$1 H$1 0.9600 553.0000 1.0 1 N$1 N$1 1.1300 300.0000 1.0 1 N$1 H$1 1.0100 434.0000 1.0 1 S$1 S$1 2.0380 166.0000 1.0 1 S$1 H$1 1.3360 274.0000 1.0 1 0$1 P$1 1.6100 230.0000 1.0 1 0$2 P$2 1.4800 525.0000 1.0 1 P$1 H$1 1.5000 200.0000 ~quadratic_angle amber , E = K2 * (Theta - ThetaO)A2 !Ver Ref I J K ThetaO K2 !---- --- ---- ---- ---- -______________ 1.0 3 HW OW HW104.5200100.0000 1.0 3 0 C 0 126.000080.0000 1.0 3 C CH N3109.700080.0000 1.0 3 CH CH N3109.700080.0000 1.0 3 C CT N3112.000080.0000 1.0 3 CH N3 H3109.500035.0000 1.0 3 CT N3 CT113.000050.0000 1.0 3 P OS P 120.5000100.0000 1.0 1 C C2 C2112.400063.0000 1.0 1 C C2 CH112.400063.0000 1.0 1 C C2 N 110.300080.0000 1.0 1 C C2 NT111.200080.0000 1.0 1 C CA CA120.000085.0000 1.0 1 C CA HC120.000035.0000 1.0 1 C CB CB119.200085.0000 1.0 1 C CB NB130.000070.0000 1.0 1 C CD CD120.000085.0000 1.0 1 C CH C2111.100063.0000 1.0 1 C CH C3111.100063.0000 1.0 1 C CH CH111.100063.0000 1.0 1 C CH N 110.100063.0000 1.0 1 C CH NT109.700080.0000 1.0 1 C CJ CJ 120.7000 85.0000 1.0 1 C CM C3 119.7000 85.0000 1.0 1 C CM CJ 120.7000 85.0000 1.0 1 C CM CM 120.7000 85.0000 1.0 1 C CM CT 119.7000 70.0000 1.0 1 C CM HC 119.7000 35.0000 1.0 1 C CT CT 111.1000 63.0000 1.0 1 C CT HC 109.5000 35.0000 1.0 1 C CT N 110.1000 63.0000 1.0 1 C N C2 121.9000 50.0000 1.0 1 C N C3 121.9000 50.0000 1.0 1 C N CH 121.9000 50.0000 1.0 1 C N CT 121.9000 50.0000 1.0 1 C N H 119.8000 35.0000 1.0 1 C N H2 120.0000 35.0000 1.0 1 C N* CH 117.6000 70.0000 1.0 1 C N* CJ 121.6000 70.0000 1.0 1 C N* CM 121.6000 70.0000 1.0 1 C N* CT 117.6000 70.0000 1.0 1 C N* H 119.2000 35.0000 1.0 1 C NA C 126.4000 70.0000 1.0 1 C NA CA 125.2000 70.0000 1.0 1 C NA H 116.8000 35.0000 1.0 1 C NC CA 120.5000 70.0000 1.0 1 C OH HO 113.0000 35.0000 1.0 1 C* C2 CH 115.6000 63.0000 1.0 1 C* CB CA 134.9000 85.0000 1.0 1 C* CB CD 134.9000 85.0000 1.0 1 C* CB CN 108.8000 85.0000 1.0 1 C* CG NA 108.7000 70.0000 1.0 1 C* CT HC 109.5000 35.0000 1.0 1 C* CW HC 120.0000 35.0000 1.0 1 C* CW NA 108.7000 70.0000 1.0 1 C2 C N 116.6000 70.0000 1.0 1 C2 C O 120.4000 80.0000 1.0 1 C2 C 02 117.0000 70.0000 1.0 1 C2 C* CB 128.6000 70.0000 1.0 1 C2 C* CG 125.0000 70.0000 1.0 1 C2 C* CW 125.0000 70.0000 WO 96~30849 PCT/U~ 12:29 1.0 1 C2 C2 C2112.400063.0000 1.0 1 C2 C2 CH112.400063.0000 1.0 1 C2 C2 N111.200080.0000 1.0 1 C2 C2 N2111.200080.0000 1.0 1 C2 C2 N3111.200080.0000 1.0 1 C2 C2 NT111.200080.0000 1.0 1 C2 C2 OS109.500080.0000 1.0 1 C2 C2 S114.700050.0000 1.0 1 C2 CA CA120.000070.0000 1.0 1 C2 CA CD120.000070.0000 1.0 1 C2 CC CF131.900070.0000 1.0 1 C2 CC CG129.000070.0000 1.0 1 C2 CC CV131.900070.0000 1.0 1 C2 CC CW129.000070.0000 1.0 1 C2 CC NA122.200070.0000 1.0 1 C2 CC NB121.000070.0000 1.0 1 C2 CH C3111.500063.0000 1.0 1 C2 CH CH111.500063.0000 1.0 1 C2 CH N109.700080.0000 1.0 1 C2 CH N~109.500080.0000 1.0 1 C2 CH NT109.700080.0000 1.0 1 C2 CH OH109.500080.0000 1.0 1 C2 CH OS109.500080.0000 1.0 1 C2 N CH118.000050.0000 1.0 1 C2 N H118.400038.0000 1.0 1 C2 N2 CA123.200050.0000 1.0 1 C2 N2 H118.400035.0000 1.0 1 C2 N2 H3118.400035.0000 1.0 1 C2 N3 H3109.500035.0000 1.0 1 C2 NT H2109.500035.0000 1.0 1 C2 OH HO108.500055.0000 1.0 1 C2 OS C2111.8000100.0000 1.0 1 C2 OS C3111.8000100.0000 1.0 1 C2 OS HO108.500055.0000 1.0 1 C2 OS P120.5000100.0000 1.0 1 C2 S C398.900062.0000 1.0 3 C2 S LP96.7000150.0000 1.0 1 C2 S S103.700068.0000 1.0 1 C2 SH HS96.000044.0000 1.0 3 C2 SH LP96.7000150.0000 1.0 1 C3 C N116.600070.0000 1.0 1 C3 C O120.400080.0000 1.0 1 C3 C 02117.000070.0000 1.0 1 C3 C2 CH112.400063.0000 1.0 1 C3 C2 OS109.500080.0000 1.0 1 C3 CH C3111.500063.0000 1.0 1 C3 CH CH111.500063.0000 1.0 1 C3 CH N109.500080.0000 1.0 1 C3 CH NT109.700080.0000 1.0 1 C3 CH OH109.500080.0000 1.0 1 C3 CM CJ119.700085.0000 1.0 1 C3 N H118.400038.0000 1.0 1 C3 N* CB125.800070.0000 1.0 1 C3 N~ CE128.800070.0000 1.0 1 C3 N* CK128.800070.0000 1.0 1 C3 N2 CA123.200050.0000 1.0 1 C3 N2 H2118.400035.0000 1.0 1 C3 N3 H3109.500035.0000 1.0 1 C3 OH HO108.500055.0000 1.0 1 C3 OS P120.5000100.0000 1.0 3 C3 S LP96.7000150.0000 1.0 1 C3 S S103.700068.0000 1.0 1 C3 SH HS96.000044.0000 1.0 3 C3 SH LP96.7000150.0000 1.0 1 CA C CA120.000085.0000 1.0 1 CA C OH120.000070.0000 1.0 1 CT C OH117.000070.0000 1.0 3 CT C 02117.000070.0000 1.0 1 CA C2 CH114.000063.0000 1.0 1 CA Q CA120.000085.0000 1.0 1 CA CA CB120.000085.0000 1.0 1 CA CA CN120.000085.0000 1.0 1 CA CA CT120.000070.0000 1.0 1 CA CA HC120.000035.0000 1.0 1 CA CB CB117.300085.0000 1.0 1 CA CB CN116.200085.0000 1.0 1 CA CB NB132.400070.0000 1.0 1 CA CD CD120.000085.0000 CA 022l6994 l997-09-30 W096J30849 PCTAUS96~042;!9 1.0 1 CA CJ CJ 117.0000 85.0000 1.0 1 CA CM CM 117.0000 85.0000 1.0 1 CA CM HC 123.3000 35.0000 1.0 1 CA CN CB 122.7000 85.0000 1.0 1 CA CN NA 132.8000 70.0000 1.0 l CA CT CT 114.0000 63.0000 1.0 1 CA CT HC 109.5000 35.0000 1.0 1 CA N2 CT 123.2000 50.0000 1.0 l CA N2 H 120.0000 35.0000 1.0 1 CA N2 H2 120.0000 35.0000 1.0 1 CA N2 H3 120.0000 35.0000 1.0 1 CA NA H 118.0000 35.0000 1.0 1 CA NC CB 112.2000 70.0000 1.0 1 CA NC CI 118.6000 70.0000 1.0 1 CA NC CQ 118.6000 70.0000 1.0 1 CB C NA 111.3000 70.0000 1.0 1 CB C O 128.8000 80.0000 1.0 1 CB C* CG 106.4000 85.0000 1.0 1 CB C* CT 128.6000 70.0000 1.0 1 CB C* CW 106.4000 85.0000 1.0 l CB C* HC 126.8000 35.0000 1.0 1 CB CA HC 120.0000 35.0000 1.0 l CB CA N2 123.5000 70.0000 1.0 1 CB CA NC 117.3000 70.0000 1.0 1 CB CB N* 106.2000 70.0000 1.0 1 CB CB NB 110.4000 70.0000 1.0 1 CB CB NC 127.7000 70.0000 1.0 1 CB CD CD 120.0000 85.0000 1.0 1 CB CN CD 122.7000 85.0000 1.0 l CB CN NA 104.4000 70.0000 1.0 l CB N* CE 105.4000 70.0000 l.0 1 CB N* CH 125.8000 70.0000 1.0 l C8 N* CK 105.4000 70.0000 1.0 1 CB N* CT 125.8000 70.0000 1.0 1 CB N* H 127.3000 35.0000 1.0 1 CB NB CE 103.8000 70.0000 1.0 1 CB NB CK 103.8000 70.0000 1.0 1 CB NC CI 111.0000 70.0000 1.0 1 CB NC CQ 111.0000 70.0000 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 1.0 1 CC C2 CH 113.1000 63.0000 1.0 1 CC CF N~3 109.9000 70.0000 1.0 1 CC CG NA 105.9000 70.0000 1.0 1 CC CT CT 113.1000 63.0000 1.0 1 CC CT HC 109.5000 35.0000 1.0 1 CC CV HC 120.0000 35.0000 1.0 1 CC CV N~3 109.9000 70.0000 1.0 1 CC CW HC 120.0000 35.0000 1.0 1 CC CW NA 105.9000 70.0000 1.0 1 CC NA CP 107.3000 70.0000 1.0 1 CC NA CR 107.3000 70.0000 1.0 1 CC NA H 126.3000 35.0000 1.0 1 CC N~3 CP 105.3000 70.0000 1.0 1 CC N~3 CR 105.3000 70.0000 1.0 1 CD C CD 120.0000 85.0000 1.0 1 CD C OH 120.0000 70.0000 1.0 1 CD CA CD 120.0000 85.0000 1.0 1 CD CB CN 116.2000 85.0000 1.0 1 CD CD CD 120.0000 85.0000 1.0 1 CD CD CN 120.0000 85.0000 1.0 1 CD CN NA 132.8000 70.0000 1.0 1 CE N* CH 128.8000 70.0000 1.0 1 CE N~ CT 128.8000 70.0000 1.0 1 CE N~ H 127.3000 35.0000 1.0 1 CF CC NA 105.9000 70.0000 1.0 1 CF N~3 CP 105.3000 70.0000 1.0 1 CF N~3 CR 105.3000 70.0000 1.0 1 CG CC NA 108.7000 70.0000 1.0 1 CG CC N~3 109.9000 70.0000 1.0 1 CG NA CN 111.6000 70.0000 1.0 1 CG NA CP 107.3000 70.0000 1.0 1 CG NA CR 107.3000 70.0000 1.0 1 CG NA H 126.3000 35.0000 1.0 1 CH C N 116.6000 70.0000 1.0 1 CH C O 120.4000 80.0000 1.0 1 CH C 02 117.0000 65.0000 1.0 1 CH C OH 115.0000 70.0000 1.0 1 CH C2 CH 112.4000 63.0000 1.0 1 CH C2 OH 109.5000 80.0000 CA 022l6994 l997-09-30 W096130849 PCT/u~3G/c122!9 1.0 1 CH C2 OS 109.500080.0000 1.0 1 CH C2 S 114.700050.0000 1.0 1 CH C2 SH 108.600050.0000 1.0 1 CH CH CH 111.500063.0000 1.0 1 CH CH N 109.700080.0000 1.0 1 CH CH N* 109.500080.0000 1.0 1 CH CH NT 109.700080.0000 1.0 1 CH CH OH 109.500080.0000 - 1.0 1 CH CH OS 109.500080.0000 1.0 1 CH N H 118.400038.0000 1.0 1 CH N* CJ 121.200070.0000 1.0 1 CH N* CK 128.800070.0000 1.0 1 CH NT H2 109.500035.0000 1.0 1 CH OH HO 108.500055.0000 1.0 1 CH OS CH 111.8000100.0000 1.0 1 CH OS HO 108.500055.0000 1.0 1 CH OS P 120.5000100.0000 1.0 1 CJ C NA 114.100070.0000 1.0 1 CJ C O 125.300080.0000 1.0 1 CJ CA N2 120.100070.0000 1.0 1 CJ CA NC 121.500070.0000 1.0 1 CJ CJ N* 121.200070.0000 1.0 1 CJ CM CT 119.700085.0000 1.0 1 CJ N* CT 121.200070.0000 1.0 1 CJ N* H 119.200035.0000 1.0 1 CK N* CT 128.800070.0000 1.0 1 CM C NA 114.100070.0000 1.0 1 CM C O 125.300980.0000 1.0 1 CM CA N2 120.100070.0000 1.0 1 CM CA NC 121.500070.0000 1.0 1 CM CJ N* 121.200070.0000 1.0 1 CM CM CT 119.700070.0000 1.0 1 CM CM HC 119.700035.0000 1.0 1 CM CM N* 121.200070.0000 1.0 1 CM CT HC 109.500035.0000 1.0 1 CM N* CT 121.200070.0000 1.0 1 CM N* H 119.200035.0000 1.0 1 CN CA HC 120.000035.0000 1.0 1 CN NA CW 111.600070.0000 CA 022l6994 l997-09-30 WO~5i3~15 PCTIU',GI'~1229 1.0 l CN NA H123.100035.0000 1.0 1 CP NA H126.300035.0000 1.0 1 CR NA CW107.300070.0000 1.0 1 CR NA H126.300035.0000 1.0 1 CR N}3 CV105.300070.0000 1.0 1 CT C N116.600070.0000 1.0 1 CT C O120.400080.0000 1.0 1 CT C* CW125.000070.0000 1.0 1 CT CC CV131.900070.0000 1.0 1 CT CC CW129.000070.0000 1.0 1 CT CC NA122.200070.0000 1.0 1 CT CC N}3121.000070.0000 1.0 1 CT CT CT109.500040.0000 1.0 1 CT CT C~115.600063.0000 1.0 1 CT CT HC109.500035.0000 1.0 1 CT CT N109.700080.0000 1.0 1 CT CT N*109.500050.0000 1.0 1 CT CT N2111.200080.0000 1.0 1 CT CT N3111.200080.0000 1.0 1 CT CT OH109.500050.0000 1.0 1 CT CT OS109.500050.0000 1.0 1 CT CT S114.700050.0000 1.0 1 CT CT SH108.600050.0000 1.0 1 CT N CT118.000050.0000 1.0 1 CT N H118.400038.0000 1.0 1 CT N2 H3118.400035.0000 1.0 1 CT N3 H3109.500035.0000 1.0 1 CT OH HO108.500055.0000 1.0 1 CT OS CT109.500060.0000 1.0 1 CT OS P120.5000100.0000 1.0 1 CT S CT98.900062.0000 1.0 3 CT S LP96.7000150.0000 1.0 1 CT S S103.700068.0000 1.0 1 CT SH HS96.000044.0000 1.0 3 CT SH LP96.7000150.0000 1.0 1 CV CC NA105.900070.0000 1.0 1 CW C* HC126.800035.0000 1.0 1 CW CC NA108.700070.0000 1.0 1 CW CC NB109.900070.0000 WO 96130~49 PCT/US96/04229 1.0 1 CW NA H125.300035.0000 1.0 1 H N H120.000035.0000 1.0 1 H2 N2 H2120.000035.0000 1.0 1 H2 NT H2109.500035.0000 1.0 1 H3 N H3120.000035.0000 1.0 1 H3 N2 H3120.000035.0000 1.0 1 H3 N3 H3109.500035.0000 1.0 1 HC CK N*123.000035.0000 1.0 1 HC CK ~3123.000035.0000 1.0 1 HC CM N*119.100035.0000 1.0 1 HC CQ NC115.400035.0000 1.0 1 HC CR NA120.000035.0000 1.0 1 HC CR ~3120.000035.0000 1.0 1 HC CT HC109.500035.5000 1.0 1 HC CT N109.500038.0000 1.0 1 HC CT N~109.500035.0000 1.0 1 HC CT N2109.500035.0000 1.0 1 HC CT N3109.500035.0000 1.0 1 HC CT OH109.500035.0000 1.0 1 HC CT OS109.500035.0000 1.0 1 HC CT S109.500035.0000 1.0 1 HC CT SH109.500035.0000 1.0 1 HC CV N~3120.000035.0000 1.0 1 HC CW NA120.000035.0000 1.0 1 HO OH HO104.500047.0000 1.0 1 HO OH P108.500045.0000 1.0 1 HS SH HS92.100035.0000 1.0 3 HS SH LP96.7000150.0000 1.0 3 LP S LP160.0000150.0000 1.0 3 LP S S96.7000150.0000 1.0 3 LP SH LP160.0000150.0000 1.0 1 N C O122.900080.0000 1.0 1 N* C NA115.400070.0000 1.0 1 N* C NC118.600070.0000 1.0 1 N* C O120.900080.0000 1.0 1 N* CB NC126.200070.0000 1.0 1 N* CE N~3113.900070.0000 1.0 1 N* CH OS109.500080.0000 1.0 1 N* CK NB113.900070.0000 CA 022l6994 l997-09-30 WOg~'3C~15 PCT/U~ 229 1.0 1 N* CT OS 109.500050.0000 1.0 1 N2 CA N2 120.000070.0000 1.0 1 N2 CA NA 116.000070.0000 1.0 1 N2 CA NC 119.300070.0000 1.0 1 NA C O 120.600080.0000 1.0 1 NA CA NC 123.300070.0000 1.0 1 NA CP NA 110.700070.0000 1.0 1 NA CP NB 111.600070.0000 1.0 1 NA CR NA 110.700070.0000 1.0 1 NA CR NB 111.600070.0000 1.0 1 NC C O 122.500080.0000 1.0 1 NC CI NC 129.100070.0000 1.0 1 NC CQ NC 129.100070.0000 1.0 1 O C 02 126.000080.0000 1.0 1 O C OH 126.000080.0000 1.0 1 02 C 02 126.000080.0000 1.0 1 02 P 02 119.9000140.0000 1.0 1 02 P OH 108.200045.0000 1.0 1 02 P OS 108.2000100.0000 1.0 1 OH P OS 102.600045.0000 1.0 1 OS P OS 102.600045.0000 1.1 4 HO OH HO 104.500047.0000 1.1 4 CS OT HY 109.350053.6000 1.1 4 AC OA HY 109.350053.6000 1.1 4 BC OB HY 109.350053.6000 1.1 4 CS OT CS 117.000060.0000 l.l 4 AC OA CS 115.000062.0000 l.l 4 BC OB CS 116.400062.0000 1.1 4 CS OE AC 113.800090.7000 1.1 4 CS OE BC 111.900090.7000 1.1 4 HT CS HT 107.850033.6000 1.1 4 AH AC HT 107.850033.6000 1.1 4 BH BC HT 107.850033.6000 1.1 4 HT CS CS 108.720043.0000 1.1 4 HC CT CS 108.720043.0000 1.1 4 HT CS CT 108.720043.0000 1.1 4 AH AC CS 108.720043.0000 1.1 4 BH BC CS 108.720043.0000 1.1 4 HT CS AC 108.720043.0000 CA 022l6994 l997-09-30 w096130849 PCT~S96/042:~9 1.1 4 HT CS 8C 108.7200 43.0000 1.1 4 HT CS OT 109.8900 45.9000 1.1 4 AH AC OA 109.8900 45.9000 1.1 4 BH BC OB 109.8900 45.9000 1.1 4 HT AC OA 109.8900 45.9000 1.1 4 HT BC OB 109.8900 45.9000 1.1 4 HT CS OA 109.8900 45.9000 _ 1.1 4 HT CS OB 109.8900 45.9000 1.1 4 HT CS OE 107.2400 45.2000 1.1 4 HT CS C 109.5000 35.0000 1.1 4 AH AC OE 107.2400 45.2000 1.1 4 BH BC OE 107.2400 45.2000 1.1 4 HT AC OE 107.2400 45.2000 1.1 4 HT BC OE 107.2400 45.2000 1.1 4 CS CS CS 110.7000 38.0000 1.1 4 CS CS CT 110.7000 38.0000 1.1 4 CS CS AC 110.7000 38.0000 1.1 4 CS CS BC 110.7000 38.0000 1.1 4 CS CS OT 110.1000 75.7000 1.1 4 CS CT OH 110.1000 75.7000 1.1 4 CS CS OA 110.1000 75.7000 1.1 4 CS CS OB 110.1000 75.7000 1.1 4 CS C O 120.4000 80.0000 1.1 4 AC CS OT 110.1000 75.7000 1.1 4 BC CS OT 110.1000 75.7000 1.1 4 BC CS OB 110.1000 75.7000 1.1 4 BC CS OA 110.1000 75.7000 1.1 4 AC CS OB 110.1000 75.7000 1.1 4 AC CS OA 110.1000 75.7000 1.1 4 CS AC OA 110.1000 75.7000 1.1 4 CS BC OB 110.1000 75.7000 1.1 4 CS CS OE 109.4000 81.0000 1.1 4 CT CS OE 109.4000 81.0000 1.1 4 CS AC OE 109.4000 81.0000 1.1 4 CS BC OE 109.4000 81.0000 1.1 4 CS OE CS 113.8000 90.7000 1.1 4 OE CS OT 111.5500 92.6000 1.1 4 OE AC OA 111.5500 92.6000 1.1 4 OE BC OB 107.4000 92.6000 W096/30849 PCT~S96/04229 1.1 4 BC CS N109.700080.0000 1.1 4 CS CS N109.700080.0000 1.1 4 HT CS N109.500038.0000 1.1 4 CS N H118.400038.0000 1.1 4 CS N C121.900050.0000 1.1 4 C N H119.800035.0000 1.1 4 N C 0122.900080.0000 1.1 4 N C CS116.600070.0000 1.0 1 $$ C$4 $$109.500063.0000 1.0 1 $$ C$3 $$120.000085.0000 1.0 1 $$ C$2 $$180.0000200.0000 1.0 1 $$ 0$2 $$109.5000100.0000 1.0 1 $$ N$4 $$109.500060.0000 1.0 1 $$ N$3 $$114.000060.0000 1.0 1 $$ N$2 $$120.000060.0000 1.0 1 $$ S$2 $$109.500060.0000 1.0 1 $$ P$4 $$109.5000110.0000 1.0 1 C$$ S$2 H$$96.000044.0000 1.0 1 C$$ S$2 C$$99.000062.0000 1.0 1 C$$ S$2 S$$96.000044.0000 #torsion_3 amber E = SUM(n=1,3) { V(n) * [ 1 + cos(n*Phi - PhiO(n)) ] }

!Ver Ref I J K L Vl PhiO
V2 PhiO V3 PhiO
!---- --- ---- ---- ---- ---- _______ ______ _______ ______ _______ ______ 1.0 3 * CB CD * 0.0000 0 0 5.3000 180.0 0.0000 0.0 1.0 1 * C C2 * 0.0000 0,0 o,oooo 0.0 0.0000 180.0 1.0 1 * C CA * 0.0000 0.0 5.3000 180.0 0.0000 ~ ~
1.0 1 * C CB * 0.0000 0 0 4.4000 180.0 0.0000 ~.~
1.0 1 * C CD * 0.0000 0,0 5.3000 180.0 0.0000 ~ ~
1.0 1 * C CH * 0.0000 0.0 O.0000 0.O O.0000 0.O

WO 96r30849 PCI/US96/04229 1 0 1 * C CJ * 0 . 0000 0 . 1 3 . 1000 180 . 0 0 . 0000 0 . 0 1.0 1 * C CM * 0.0000 0.0 3 . 1000 180 . 0 0 . 0000 0 . 0 1.0 1 * C CT * 0.0000 0.0 O .0000 0. O O .0000 0. O
1. 0 1 * C N * o . 0000 0 . 0 10 . 0000 180 . 0 0 . 0000 0 . 0 - 1.0 1 * C N* * 0.0000 0.0 5 . 8000 lB0 . 0 0 . 0000 0 . 0 1. 0 1 * C NA * 0 . 0000 0 . 0 5 . 4000 180 . 0 0 . 0000 0 . 0 1. 0 1 * C NC * 0 . 0000 0 . 0 8 . 0000 180 . 0 0 . 0000 0 . 0 1. 0 1 * C OH * 0 . 0000 0 . 0 1 . 8000 1130 . O O . 0000 0 . O
1.0 1 * C* C2 * 0.0000 0.l~
O .0000 0. O O .0000 0. O
1.0 1 * C* CB * 0 . 0000 0 .0 4 . 8000 180 . 0 0 . 0000 0 . 0 1.0 1 * C* CG * 0.0000 0.0 23 . 6000 180 . 0 0 . 0000 0 . 0 1.0 1 * C* CT * 0.0000 0.() O .0000 0. O O .0000 0. O
1.0 1 * C* CW * 0.0000 o.o 23 . 6000 180 . 0 0 . 0000 0 . 0 1.0 1 * C2 C2 * 0.0000 o.() 0 . 0000 0 . 0 2 . 0000 0 . 0 1.0 1 * C2 CA * 0.0000 0.() O .0000 0. O O .0000 0. O
1 . 0 1 * C2 CC * 0 . 0000 0 . () O .0000 0. O O .0000 0. O
1.0 1 * C2 CH * 0.0000 0.() 0 . 0000 0 . 0 2 . 0000 0 . 0 1. 0 1 * C2 N * 0 . 0000 0 . 0 O ~ O O O O O ~ O O ~ O O O O O ~ O
1.0 1 * C2 N2 * 0.0000 0.0 O .0000 'O . O O .0000 0. O
1.0 1 * C2 N3 * 0.0000 0.() 0 . 0000 0 . 0 1 . 4000 0 . 0 1.0 1 * C2 NT * 0.0000 o o O . 0000 0 . O 1 . 0000 0 . O
1.0 1 * C2 OH * 0.0000 0.0 0.0000 0.0 0.5000 0.0 1.0 1 * C2 OS * o.oooo 0.0 0 . 0000 0 . 0 1 . 4500 0 . 0 1.0 1 * C2 S * 0.0000 0.0 O .0000 0. O 1.0000 0. O
1.0 1 * C2 SH * 0.0000 0.0 0.0000 0.0 0.7500 0.0 1.0 1 * CA CA * 0.0000 0.0 5.3000 180.0 0.0000 ~ ~
1.0 1 * CA CB * 0.0000 0.0 10.2000 180.0 0.0000 0.0 1.0 l * CA CD * 0.0000 0.0 5.3000 180.0 0.0000 0.0 1.0 l * CA CJ * 0.0000 0.0 3.7000 180.0 0.0000 0.0 l .0 1 * CA CM * 0.0000 0.0 3.7000 180.0 0 0000 ~ ~
1.0 1 * CA CN * 0.0000 0.0 10.6000 180.0 G .0000 0.0 l .0 l * CA CT * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 l * CA N2 * 0.0000 0.0 6.8000 180.0 0.0000 0.0 l .0 1 * CA NA * 0.0000 0.0 6.0000 180.0 0.0000 0.0 1.0 1 * CA NC * 0.0000 0.0 9.6000 180.0 0.0000 0. ~
l .0 1 * CB CB * 0.0000 0.0 16.3000 180.0 0.0000 0.0 l .0 l * CB CN * 0.0000 0.0 20.0000 180.0 0.0000 0.0 1.0 1 * CB N* * 0.0000 0.0 6.6000 180.0 0.0000 0.0 1.0 l * CB NB * 0.0000 0.0 5.1000 180.0 0.0000 0.0 CA 022l6994 l997-09-30 W096130849 PCT~S96/04229 1.0 3 * CB NC * 0.0000 0.0 8.3000 180.0 0.0000 0.0 1.0 1 * CC CF * 0.0000 0.0 14.3000 180.0 0.0000 0.0 1.0 1 * CC CG * 0.0000 0.0 .,~ 15 . 9000180 . O O . 0000 0 . O
1. 0 1 * CC CT * 0 . 0000 0 0 O .0000 0. O O .0000 0. O
1.0 1 * CC CV * 0,0000 o,o 14.3000 180.0 0.0000 0.0 1.0 1 * CC CW * o.oooo o,o 15 . 9000180 . 0 0 . 0000 0 . 0 1.0 1 * CC NA * 0.0000 0.0 5 . 6000 180 . 0 0 . 0000 0 . 0 1.0 1 * CC NB ~ 0.0000 0.0 4.8000 180.0 0.0000 0.0 1.0 1 * CD CD * 0.0000 0.0 5 . 3000 180.0 0.0000 0.0 1.0 1 * CD CN * 0.0000 0.0 5 . 3000 180.0 0.0000 0.0 1.0 1 * CE N* * 0.0000 0.0 6 . 7000 180.0 0.0000 0.0 1.0 1 * CE NB * 0.0000 0.0 = 20.0000 180.0 0.0000 0.0 1.0 1 t CF NB * 0.0000 0.0 4.8000 180.0 0.0000 0.0 = 1.0 1 * CG NA * 0.0000 0.0 6 . 0000 180.0 0.0000 0.0 1.0 1 * CH CH * 0.0000 0.0 0 . 0000 0 . 0 2 . 0000 0 . 0 1.0 1 * CH N * 0.0000 0.0 O .0000 0. O O .000.0 0. O
1.0 1 * CH N* * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 1 * CH NT * 0.0000 0.0 O .0000 0. O 1.0000 0. O
1.0 1 * CH OH * 0.0000 0.0 0.0000 0.0 0.5000 0.0 1.0 1 * CH OS * 0.0000 0.0 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 0.0000 0.0 1.4500 0.0 1.0 1 * CI NC * 0,0000 0,0 13.5000 180.0 0.0000 0.0 1 . 0 1 * CJ CJ * o oooo 0 . 0 24.4000 180.0 0.0000 0.0 1.0 1 * CJ CM * 0,0000 0,0 24.4000 180.0 0.0000 0. C
1.0 1 * CJ N* * 0.0000 0.0 7.4000 180.0 0.0000 0,0 1.0 1 * CK N* * 0 .0000 0 .0 6.7000 180.0 0.0000 0.0 1.0 1 * CK NB * 0 . 0000 0 .0 20.0000 180.0 0.0000 0.0 1.0 1 * CM CM * 0.0000 0.0 24.4000 180.0 0.0000 0.0 1.0 1 * CM CT * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 1 * CM N* * 0.0000 0 .0 7.4000 180.0 0.0000 ~ ~
1. 0 1 * CN NA * 0 . 0000 0 . 0 12. 2000 180.0 0.0000 0.0 1.0 1 * CP NA * 0 . 0000 0 .0 9.3000 180.0 0.0000 ~ ~
1.0 1 * CP NB * 0.0000 0.0 10.0000 180.0 0.0000 0.0 1. 0 1 * CQ NC * 0 . 0000 0 . 0 13.5000 180.0 0.0000 0 0 1. 0 1 * CR NA * 0 . 0000 0 . 0 9.3000 180.0 0.000O ~ ~
1. 0 1 * CR NB * 0 . 0000 0, 0 10.0000 180.0 0.0000 0.0 1.0 1 * CT CT * 0.0000 0,0 0.0000 0.0 1.3000 0.0 1.0 1 * CT N * 0.0000 o ,o O . 0000 0 . O O . 0000 0 . O
1. 0 1 * CT N* * 0.0000 0.0 O .0000 0. O O .0000 0. O
1. 0 1 * CT N2 * 0 . 0000 0 . 0 O .0000 0. O O .0000 0. O

CA 022l6994 l997-09-30 WO 96130849 PCT/US96/042,!9 1. 0 1 * CT N3 * 0, 0000 o o 0 . 0000 0 . 0 1 . 4000 0 . 0 1. 0 1 * CT OH * 0 . 0000 0 . D
0 . 0000 0 . 0 0 . 5000 0 . 0 1.0 1 * CT OS * 0 . 0000 0 . D
O . 0000 0 . O 1 . 1500 0 . O
1.0 1 * CT S * 0.0000 0.0 O .0000 0. O 1.0000 0. O
1. 0 1 * CT SH * 0, 0000 0, 0 0 . 0000 0 . 0 0 . 7500 0 . 0 1. 0 1 * CV NB * 0 .0000 0 .0 4 . 8000 180 . 0 0 . 0000 0 . 0 1. 0 1 * CW NA * 0 . 0000 0 . 0 6 . 0000 180 . 0 0 . 0000 0 . 0 1.0 1 * OH P * 0 . 0000 0 .0 0 . 0000 0 . 0 0 . 7500 0 . 0 1.0 1 * OS P * o.oooo o.
0 . 0000 0 . 0 0 . 7500 0 . 0 1.0 1 0 C C2 N 0,0000 0.() 0 . 0000 0 . 0 0 . 2000 180 . 0 1.0 1 O C CH C2 0.0000 0.t) 0 . 0000 0 . 0 0 . 1000 180 . 0 1. 0 1 O C CH N 0 . 0000 0 . O
0 . 0000 0 . 0 0 . 1000 180 . 0 1. 0 1 O C CH CH 0 .0000 0 .() 0 . 0000 0 . 0 0 . 1000 180 . 0 1.0 1 OS C2 C2 OH 0.0000 0.C) 0 . 5000 0 . 0 2 . 0000 0 . 0 1. 0 2 OH C2 C2 OH 0.0000 0.0 0 . 5000 0 . 0 2 . 0000 0 . 0 1 . 0 1 OS C2 C2 OS 0 . 0000 0 . C~
0 . 5000 0 . 0 2 . 0000 0 . 0 1.0 1 OS C2 CH OS 0.0000 0.C' 0 . 5000 0 . 0 1 . 0000 0 . 0 1.0 1 OS C2 CH OH 0 .0000 0 .0 0 . 5000 0 . 0 1 . 0000 0 . 0 1. 0 1 OH C2 CH OH 0 . 0000 0 . 0 0 . 5000 0 . 0 1 . 0000 0 . 0 1.0 1 C2 Q S LP 0.0000 0.0 CA 022l6994 l997-09-30 W096/30849 PCT/U~G/~1229 O . 0000 0 . O O . 0000 0 O
1.0 1 CH C2 SH LP o.oooo 0.0 O.0000 0.O O.0000 0.O
1.0 1 OS CH C2 OH 0.0000 0.0 0.5000 0.0 1.0000 0.0 1.0 1 OH CH CH OH 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 OS CH CH OH 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 OS CH CH OS 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 HC CM CM CT 0.0000 0.0 1.7100 180.0 0.0000 0.0 1.0 1 C CM CM HC 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.0 1 N* CM CM CT 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.0 1 CA CM CM HC 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.0 1 N* CM CM CA 0.0000 0.0 9.5100 180.0 0.0000 0.0 1.0 1 HC CM CM HC 0.0000 0.0 1.7100 180.0 0.0000 0.0 1.0 1 N* CM CM C 0.0000 0.0 9.5100 180.0 0.0000 0.0 1.0 1 N* CM CM HC 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.0 1 N CT C O 0.0000 0.0 0.0000 0.0 0.0670 180.0 1.0 1 HC CT C O 0.0000 0.0 0.0000 0.0 0.0670 180.0 1.0 1 CT CT C O 0.0000 0.0 0000 0.0 0.0670 180.0 1.0 1 CT OS CT CT 0.0000 0.0 0.2000 180.0 0.3830 0.0 1.0 1 OS CT CT OS 0.0000 0.0 0.5000 0.0 0.1440 0.0 1.0 1 OS CT CT OH 0.0000 0.0 0-5000 0.0 0.1440 0.0 W~ 9 ~ '3~ P~: l/U~ i.ro42~9 1. O 1 OH CT CT OH O OOOO O . O
0.5000 0.0 0.1440 0.0 1.0 1 H N C O 0 6S00 0.0 2.5000 180.0 0.0000 0.0 1.0 1 C2 OS C2 C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 C2 OS C2 C2 0.0000 0.0 0.1000 0.0 1.4500 0.0 - 1.0 1 C3 OS C2 C3 0.0000 0.0 0.1000 0.0 1.4500 0.0 1.0 1 CH OS CH C2 0.0000 0.0 0.1000 0.0 0.7250 0.0 1. O 1 CH OS CH CH 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 C2 OS CH C2 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 C3 OS CH C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 CH OS CH N* 0.0000 0.0 o oooo o 0 0.7250 0.0 1.0 1 C2 OS CH C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 OH P OS C3 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS C2 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OH P OS C2 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS CT 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS CH 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS C3 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OH P OS CH 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OH P OS CT 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 LP S S LP 0.0000 0.0 CA 022l6994 l997-09-30 W096/30849 PCT~S96104229 O .0000 0. O O .0000 0. O
1.0 1 LP S S C2 o.oooo o o O . 0000 0 . O O . 0000 0 . O
1.0 l C2 S S C2 o . oooo o o 3,5000 o,0 0.6000 0.0 1.0 1 CT S S CT o .oooo 0.0 3.5000 0.0 0.6000 0.0 1.0 1 LP S S CT 0.0000 0.0 O .0000 0. O O .0000 0. O
l . l 4 ~ CS CS * o oooo o o 0.0000 0.0 1.0210 0.0 1.1 4 t CS CT * o . oooo 0.0 o.oooo o.o 1.0210 0.0 1.1 4 * AC CS * 0.0000 0.0 0.0000 0.0 1.0210 0.0 1.1 4 * BC CS * o .0000 0.0 0.0000 0.0 1.0210 0.0 1.1 4 t CS OT * 0.0000 o, o 0.0000 0.0 0.4430 0.0 1.1 4 t CS OE * 0.0000 0.0 0 0000 0.0 0.9280 0.0 1.1 4 * AC OE * o . oooo o o 0,0000 0.0 0.9280 0.0 1.1 4 t BC OE t O . 0000 0 . O
0.0000 0.0 0.9280 0.0 1.1 4 t AC OA * 0.0000 0.0 O . 0000 0 . O O . 0000 0 . O
1.1 4 * BC OB t O, 0000 0, O
O .0000 0, O O .0000 0. O
1. l 4 * CS OA * 0.0000 o, o O .0000 0. O O .0000 0. O
l . l 4 * CS OB * o,0000 o o O .0000 0. O O .0000 0. O
l .1 4 * CS N * 0,0000 0.0 O .0000 0. O O .0000 0. O
l . l 4 * C N * 0.0000 o, o 10.0000 180.0 0 ~~~~ ~ ~
l .1 4 * C CS * 0.0000 0.0 O .0000 0. O O .0000 0. O

CA 022l6994 l997-09-30 W~ 96131~849 PCT/US96/042.29 1.1 4 OEAC OA CS2.1500 300.0 O .0000 0. O O .0000 0. O
1.1 4 AHAC OA CS0.0000 0.0 1.7500 60.0 0.0000 0.0 1.1 4 CSAC OA CS0.0000 0.0 . oooo 0.0 0.8500 0.0 1.1 4 OEAC OA HY2.1500 300.0 O .0000 0. O O .0000 0. O
1.1 4 AHAC OA HY0.0000 0.0 1.7500 60.0 0.0000 0.0 1.1 4 CSAC OA HY0.0000 0.0 0.0000 0.0 0.8500 0.0 1.1 4 OEBC OB CS-1.0500 0.0 O .0000 0. O O .0000 0. O
1.1 4 BHBC OB CS0.0000 0.0 1.2500 240.0 0.0000 0.0 1.1 4 CS BC OB CS 0.0000 0.0 0.0000 0.0 1.4000 0.0 1.1 4 OE BC OB HY -1.0500 0.0 O .0000 0. O O .0000 0. O
1.1 4 BH BC OB HY 0.0000 0.0 1.2500 240.0 C .0000 0.0 1.1 4 CS BC OB HY 0.0000 0.0 0.0000 0.0 1.4000 0.0 1.1 4 HT AC OA CS 0.0000 0.0 0.0000 0.0 0.8500 0.0 1.1 4 HT BC OB CS 0.0000 0.0 0.0000 0.0 1.4000 0.0 1.1 4 H N C O 0.6500 0.0 2.5000 180.0 0.0000 0.0 1.1 4 HT CS C O 0.0000 0.0 0.0000 0.0 0.0670 180.0 1.0 1 $$ C$1 C$1 $$ 0.0000 0.0 0.0000 0.0 1.3000 0.0 1.0 1 $$ C$2 C$2 $$ 0.0000 0.0 5.3000 180.0 0.0000 0.0 1.0 1 $$ C$3 C$3 $$ 0.0000 0.0 16.3000 180.0 0.0000 0.0 1.0 1 $$ C$5 C$5 $$ 0.0000 0.0 28~

CA 022l6994 l997-09-30 W096/3~15 PCT~S96/04229 0.0000 180.0 0.0000 0.0 1.0 1 $$ C$1 0$1 $$ 0.0000 0.0 O.0000 0.O 1.1000 0.O
1.0 1 $$ C$1 N$1 $$ 0.0000 0.0 0.0000 0.0 0,3000 0.0 7 1.0 1 $$ C$2 N$2 $$ 0.0000 0.0 5.8000 180.0 0.0000 0.0 1.0 1 $$ C$3 N$3 $$ 0.0000 0.0 10.0000 180.0 0.00000.0 1.0 1 $$ C$1 S$1 $$ 0.0000 0.0 0.0000 0.0 0.7500 0.0 1.0 1 $$ S$1 S$1 $$ 0.0000 0.0 3.5000 0.0 0.6000 0.0 1.0 1 $$ 0$1 0$1 $$ 0.0000 0.0 O.0000 0.O 1.1000 0.O
1.0 1 $$ 0$1 N$1 $$ 0.0000 0.0 O.0000 0.O 1.1000 0.O
1.0 1 $$ 0$1 P$1 $$ 0.0000 0.0 0.0000 0.0 0.7500 0.0 1.0 1 $$ N$1 N$1 $$ 0.0000 0.0 0.0000 0.0 0.3000 0.0 #out_of plane amber E = Kchi * [ 1 + cos(n*Chi - ChiO) ]
!Ver Ref I J K L Kchi n ChiO
!---- --- ---- ---- ---- ---- _______ ______ _______ 1.0 3 C* NA CA CA 0.0000 2 180.0000 1.0 1 N3 C CH C2 7.0000 3 180.0000 1.0 1 C3 CA CH C3 7.0000 3 180.0000 1.0 1 C NT CH C3 14.0000 3 180.0000 1.0 1 N3 C CH CH 7.0000 3 180.0000 1.0 1 H2 N2 CH H2 0.0000 3 180.0000 CA 022l6994 l997-09-30 W096t30849 PCT~S96104229 1.0 1 * CH C2 *14.0000 3 180.0000 1.0 1 * CH CH *14.0000 3 180.0000 1 . 0 1 * CC CC *0 . 0000 2 180 . 0000 1.0 1 * CC CB *0.0000 2 180.0000 - 1.0 1 C N CH *14.0000 3 180.0000 1. 0 1 C2 N CH *1. 0000 2 180 . 0000 1. 0 1 CT N CT *1. 0000 2 180.0000 1.0 1 H2 N H2 *1.0000 2 180.0000 1. 0 1 N2 CA N2 *10 . 5000 2 180 . 0000 1.0 1 02 C 02 *10. 5000 2 180 . 0000 1.0 1 C NT CH *14.0000 3 180.0000 1. 0 1 C N3 CH *14.0000 3 180.0000 1 . 0 1 O C * *10 . 5000 2 180 . 0000 1.0 1 HC C* * * 0.0000 2 180 . 0000 1.0 1 HC CW * *0.0000 2 180.0000 1. 0 1 CB CN * *0 . 0000 2 180.0000 1. 0 1 CN CB * * 0.0000 2 180.0000 1. 0 1 C* CB * *0 . 0000 2 180.0000 1. 0 1 CA CB * *0 . 0000 2 180.0000 1. 0 1 CA CN * *0 . 0000 2 CA 022l6994 l997-09-30 WO 96/30849 PCI'IUS96tO4229 180 . 0000 1.0 1 NA CN * *0.0000 2 180.0000 1.0 1 HC CA * *2.0000 2 180.0000 1.0 1 H N * *1.0000 2 180 . 0000 1.0 1 H2 N2 * *1.0000 2 180.0000 1.0 1 H3 N2 * *1.0000 2 180.0000 1.0 1 H2 NT * *1.0000 2 180.0000 1.0 1 H NA * *1.0000 2 180.0000 1.0 1 $$ $$ $$ $$10.0000 2 ~180.0000 #nonbond(12-6) amber @type r-eps ~combination arithmetic E = EPSij * { (Rij*/Rij)~12 - 2(Rij*/Rij)-6 }
where EPSij = sqrt( EPSi t EPSj) Rij* = (Ri* I Rj*)/2 !Ver Ref I Ri* EPSi !---- --- ---- ---------__ ___________ 1.0 3 IM 5.0000 0.10000 1.0 3 CU 2.4000 0.05000 1.0 3 I 4.8000 0.40000 1.0 3 OW 3.5360 0.15200 1.0 3 MG 2.3400 0.10000 1.0 3 C0 3.2000 0.10000 1.0 3 QC 6.8000 0.00008 1.0 3 QK 5.3200 0.00033 1.0 3 QL 2.2800 0.01800 1.0 3 QN 3.7400 0.00280 1.0 3 QR 5.9200 0.00017 1.0 1 C 3.7000 0.12000 1.0 1 C* 3.7000 0.12000 1.0 1 C2 3.8400 0.12000 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 1.0 1 C3 4.0000 0.15000 1.0 1 CA 3.7000 0.12000 1.0 1 CB 3. 7000 0.12000 1.0 1 CC 3.7000 0.12000 1.0 1 CD 3. 7000 0.12000 ~- 1.0 1 CE 3.7000 0.12000 1.0 1 CF 3. 7000 0.12000 1.0 1 CG 3.7000 0.12000 1.0 1 CH 3. 7000 0.09000 1.0 1 CI 3. 7000 0.12000 1.0 1 CJ 3. 7000 0.12000 1.0 1 CK 3. 7000 0.12000 1.0 1 CM 3. 7000 0.12000 1.0 1 CN 3. 7000 0.12000 1.0 1 CP 3.7000 0.12000 1.0 1 CQ 3.7000 0.12000 1.0 1 CR 3.7000 0.12000 1.0 1 CT 3 .6000 0.06000 1.0 1 CV 3.7000 0.12000 1.0 1 CW 3. 7000 0.12000 1.0 1 H 2.0000 0.02000 1.0 1 H2 2.0000 0.02000 1.0 1 H3 2.0000 0.02000 1.0 1 HC 3.0800 0.01000 1.0 1 HO 2.0000 0.02000 1.0 1 HS 2.0000 0.02000 1.0 1 LP 2.4000 0. 01600 1.0 1 N 3.5000 0.16000 1.0 1 N* 3. 5000 0.16000 1.0 1 N2 3. 5000 0.16000 1.0 1 N3 3. 7000 0.08000 1.0 1 NA 3. 5000 0.16000 1.0 1 NB 3. 5000 0.16000 1.0 1 NC 3. 5000 0.16000 1.0 1 NP 3.5000 0.16000 1.0 1 NT 3.7000 0.12000 1.0 1 O 3.2000 0.20000 1.0 1 02 3.2000 0.20000 1.0 1 OH 3.3000 0.15000 1.0 1 OS 3.3000 0 15000 1.0 1 P 4.2000 0.20000 1.0 1 S 4.0000 0.20000 1.0 1 SH 4.0000 0.20000 1.1 4 CS 3.6000 0.09030 1.1 4 AC 3.6000 0.09030 1.1 4 BC 3.6000 0.09030 1.1 4 C 3.7000 0.12000 1.1 4 H 2.0000 0.02000 1.1 4 HY 1.6000 0.04980 1.1 4 HT 2.9360 0.00450 1.1 4 HO 2.0000 0.02000 1.1 4 AH 2.9360 0.00450 1.1 4 BH 2.9360 0.00450 1.1 4 OT 3.2000 0.15910 1.1 4 OA 3.2000 0.15910 1.1 4 OB 3.2000 0.15910 1.1 4 OE 3.2000 0.15910 1.1 4 OH 3.3000 0.15000 1.1 4 O 3.2000 0.20000 1.1 4 N 3.5000 0.16000 #hydrogen_bond(10-12) amber E = Aij/r~12 - Bij/r~10 !Ver Ref I J A B
!---- --- ---- ---- --------______________ 1.0 3 H OS7557.00002385.0000 1.0 3 H OW7557.00002385.0000 1.0 3 H2 OS7557.00002385.0000 1.0 3 H2 OW7557.00002385.0000 1.0 3 HW NB7557.00002385.0000 1.0 3 HW NC10238.00003071.0000 1.0 3 HW O7557.00002385.0000 1.0 3 HW 024019.00001409.0000 1.0 3 HW OH7557.00002385.0000 1.0 3 HW OS7557.00002385.0000 1.0 3 HW S265720.000035429.0000 1.0 3 HW SH265720.000035429.0000 1.0 1 H N}37557.00002385.0000 1.0 1 H NC10238.00003071.0000 W~ 96J30849 PCT~U~3~ 2.!9 1.0 1 H 024019.00001409.0000 1.0 1 H O7557.00002385.0000 1.0 1 H OH7557.00002385.0000 1.0 3 H S26S720.000035429.0000 1.0 3 H SH265720.000035429.0000 1.0 1 HO N~37557.00002385.0000 1.0 1 HO NC7557.00002385.0000 1.0 1 HO 024019.00001409.0000 ~ 1.0 1 HO O7557.00002385.0000 1.0 1 HO OH7557.00002385.0000 1.0 3. HO S265720.000035429.0000 1.0 3 HO SH265720.000035429.0000 1.0 1 H2 ~34019.00001409.0000 1.0 1 H2 NC4019.00001409.0000 1.0 1 H2 024019.00001409.0000 1.0 1 H2 O10238.00003071.0000 1.0 1 H2 OH4019.00001409.0000 1.0 3 H2 S265720.000035429.0000 1.0 3 H2 SH265720.000035429.0000 1.0 1 H3 N~34019.00001409.0000 1.0 1 H3 NC4019.00001409.0000 1.0 1 H3 024019.00001409.0000 1.0 1 H3 O7557.00002385.0000 1.0 1 H3 OH7557.00002385.0000 1.0 3 H3 S265720.000035429.0000 1.0 3 H3 SH265720.000035429.0000 1.0 1 HS N~314184.00003082.0000 1.0 1 HS NC14184.00003082.0000 1.0 1 HS 0214184.00003082.0000 1.0 1 HS O14184.00003082.0000 1.0 1 HS OH14184.00003082.0000 1.0 3 HS S265720.000035429.0000 1.0 3 HS SH265720.000035429.0000 #bond_increments amber !Ver Ref I JDeltaIJ DeltaJI
!---- --- -_-- ----_______ _______ 1.1 5 CM CM0.000 0.000 1.1 5 CA CA0.000 0.000 1.1 5 CB C~30.000 0.000 CA 022l6994 l997-09-30 WO 9613084g PCT~S96/04229 1.1 5 C5 C60.000 0.000 1.1 5 CT CT0.000 0.000 1.1 5 HT CT0. 066- 0.066 1.1 5 H NT0.133 -0.133 1.1 5 NT CT-0.189 0.189 1.1 5 CA OH0. 334-0,334 r 1.1 5 CT OS0.237 -0.237 1.1 5 HC CT0. 066- 0.066 1.1 6 CS CS0.000 0.000 1.1 6 AC CS0.000 0.000 1.1 6 BC CS0.000 0.000 1.1 6 CS CT0.000 0.000 1.1 6 CS OS0.200 -0.200 1.1 5 N* CS- 0.1830.183 1.1 6 OT HY-0.400 0.400 1.1 6 OA HY-O. 4000.400 1.1 6 OB HY-0.400 0.400 1.1 6 CS HT-0.100 0.100 1.1 5 AC AH-0.100 0.100 1.1 6 BC BH-0.100 0.100 1.1 6 AC HT-0.100 0.100 1.1 6 BC HT-0.100 0.100 1.1 6 AC CA0.250 -0.250 1.1 6 BC OB0.250 -0.250 1.1 6 CS OA0. 250-0.250 1.1 6 CS OB0.250 -0.250 1.1 6 CS OT0.250 -0.250 1.1 6 CS OE0.200 -0.200 1.1 6 AC OE0.200 -0.200 1.1 5 BC OE0.200 -0.200 1.1 6 OW HW-0.380 0.380 1.1 5 N* CT- 0.1830.183 1.1 5 P OS0.254 -0.254 1.1 5 CB N*0.130 -0.130 1.1 5 CK N*-0. 2530.253 1.1 5 NC CB-0.335 0.335 1.1 5 NB CB0.020 -0.020 1.1 5 CB CA0.000 -0.000 1.1 5 CK NB0.566- 0.566 W<~ 96130849 PCT/US96/042:~9 1.1 5 CK HC-0.051 0.051 1.1 5 N2 CA-0.162 0.162 1.1 5 NC CA-0.430 0.430 1.1 5 H2 N20.318 -0.318 1.1 5 CQ NC0.341 -0.341 1.1 5 CQ HC0.005 -0.005 1.1 5 02 P-0.913 0.413 1.1 5 C N~-0.044 0.044 1.1 5 CM N*0.137 -0.137 1.1 5 NA C-0.255 0.255 1.1 5 O C-0.492 0.492 1.1 5 NA H-0.282 0.282 1.1 5 CM C-0.150 0.150 1.1 5 CM CT0.055 -0.055 1.1 5 CM HC-0.101 0.101 1.1 5 H2 CT0.119 -0.119 1.1 5 C NC0.424 -0.424 1.1 5 CM CA-0.409 0.409 1.1 5 N2 HC-0.037 0.037 1.1 5 OH CT-0.263 0.263 1.1 5 HO OH0.303 -0.303 1.1 5 C CB-0.005 0.005 1.1 5 NA CA-0.215 0.215 1.1 5 CT N0.171 -0.171 1.1 5 H N0.274 -0.274 1.1 5 C CT0.095 -0.095 1.1 5 C N0.139 -0.139 1.1 5 N2 CT0.044 -0.044 1.1 5 H3 N20.551 -0.351 1.1 5 02 C-0.792 0.292 1.1 5 S CT-0.023 0.023 1.1 5 LP S-0.403 0.403 1.1 5 SH CT-0.033 0.033 1.1 5 HS SH0.127 -0.127 1.1 5 SH LP0.489 -0.489 1.1 5 CC CT0.007 -0.007 1.1 5 N~3 CC-0.256 0.256 1.1 5 CW CC0.018 -0.018 1.1 5 CR NB0.251 -0.251 W O 96130849 PCTr~ C1229 1.1 5 NA CR-0.066 0.066 1 1 5 CR HC-0.067 0.067 1.1 5 CW NA-0.057 0.057 1 1 5 CW HC-0.099 0.099 1.1 5 NA CC-0.020 0.020 1.1 5 NA PS0.423 -0.423 1.1 5 CV CC0.035 -0.035 l.1 5 CV NB0.227 -0.227 1.1 5 Cv HC-0.042 0.042 1.1 ~ N3 CT0.905 0.095 1.1 5 N3 H3-0.326 0.326 1.1 5 CA CT-0.033 0.033 1.1 5 CA HC-0.101 0.101 1.1 5 C* CT0.005 -0.005 1.1 5 C* CW-0.192 0.192 1.1 5 CB C*-0.045 0.045 1.1 5 CN NA0.176 -0.176 1.1 5 CN CA0.074 -0.074 1.1 5 CB CN0.104 -0.104 1.1 5 CA C -0.181 0.181 1.1 5 OH C -0.081 0.081 #reference 1 creation of file #reference 2 Lone pair lp had incorrect mass of 0.001097.
Angle CT-C-02 was by error included twice.
Torsion OH-C2-C2-OH was written as two separate lines.
Hence only one of the energy terms was included.
~Author Jon Hurley ~Date 13-December-90 #reference 3 parameter set modified with the addtional parameters from kollman's parm89a rev a force field file note that the HW...OW hydrogen bond parameters and the HW ~an der waals parameters are not included in the files since they are e~ual to zero in parm89a.
@Author tom thacher ~Date 11-March-92 #reference 4 W096f30849 PCT/U~3G~ 2:29 hom~n~' carbohydrate potential @Author Tom Thacher @Date 7-July-1992 #reference 5 bond increments @Author Tom Thacher @Date 7-July-1992 #end -***********~******************************************
****************************************~*~************
END OF LISTING
*********,--************************************************
********************************************************~

********~**********************************t***********

DATA FILE FOR H BOND FORCES - HBOND.DAT
*******************~************************************

47 !data items !BIOSYM forcefield 2 !version amber.frc 1.0 19-Oct-9O
!version amber.frc 1.1 8-Aug-92 !define amber ! This is the new format version of the amber forcefield !hbond_definition amber !1.0 1 distance 2.5000 !1.0 1 angle 90.0000 !1.0 1 donors H HO H2 H3 HS
!1.0 1 acceptors NB NC 02 0 OH S SH
!hydrogen_bond(10-12) amber ! E = Aij/rA12 - Bij/r~10 !Ver Ref I J A B
!---- --- ---- ---- _-_________ ___________ 1.0 3 H OS 7557.0000 2385.0000 1.0 3 H OW 7557.0000 2385.0000 1.0 3 H2 OS 7557.0000 2385.0000 1.0 3 H2 OW 7557.0000 2385.0000 1.0 3 HW NB 7557.0000 2385.0000 CA 022l6994 l997-09-30 W09~1'3C~15 PCT~S96/04229 1.0 3 HW NC10238.0000 3071.0000 1.0 3 HW O7557.0000 2385.0000 1.0 3 HW 024019.0000 1409.0000 1.0 3 HW OH7557.0000 2385.0000 1.0 3 HW OS7557.0000 2385.0000 1.0 3 HW S265720.0000 35429.0000 1.0 3 HW SH265720.0000 35429.0000 1.O 1 H N~37557.0000 2385.0000 1.0 1 H NC10238.0000 3071.0000 1.0 1 H 024019.0000 1409.0000 1.0 1 H O7557.0000 2385.0000 1.0 1 H OH7557.0000 2385.0000 1.0 3 H S265720.0000 35429.0000 1.0 3 H SH265720.0000 35429.0000 1.0 1 HO NB7557.0000 2385.0000 1.0 1 HO NC7557.0000 2385.0000 1.0 1 HO 024019.0000 1409.0000 1.0 1 HO O7557.0000 2385.0000 1.0 1 HO OH7557.0000 2385.0000 1.0 3 HO S265720.0000 35429.0000 1.0 3 HO SH265720.0000 35429.0000 1.0 1 H2 NB4019.0000 1409.0000 1.0 1 H2 NC4019.0000 1409.0000 1.0 1 H2 024019.0000 1409.0000 1.0 1 H2 O10238.0000 3071.0000 1.0 1 H2 OH4019.0000 1409.0000 1.0 3 H2 S265720.0000 35429.0000 1.0 3 H2 SH265720.0000 35429.0000 1.0 1 H3 N~34019.0000 1409.0000 1.0 1 H3 NC4019.0000 1409.0000 1.0 1 H3 024019.0000 1409.0000 1.0 1 H3 O7557.0000 2385.0000 1.0 1 H3 OH7557.0000 2385.0000 1.0 3 H3 S265720.0000 35429.0000 1.0 3 H3 SH265720.0000 35429.0000 1.O 1 HS NB14184.0000 3082.0000 1.0 1 HS NC14184.0000 3082.0000 1.0 1 HS 0214184.0000 3082.0000 1.0 1 HS O14184.0000 3082.0000 WO96130849 1 ._l/U'',G,'~229 1.0 1 HS OH14184.00003082.0000 1.0 3 HS S265720.000035429.0000 1.0 3 HS SH265720.000035429.0000 ***********************************t**~****************~*~.
DATA FILE FOR LENNARD JONES FORCES - LJ_PARAM.DAT
,, *******",**********************************"**

74 !total atoms !BIOSYM forcefield 2 !version amber.frc 1.0 19-Oct-90 !version amber.frc 1.1 8-Aug-92 !define amber ! This is the new format version of the amber forcefield !nonbond(12-6) amber !type r-eps !combination arithmetic ! E = EPSij * { (Rij*/Rij)~12 - 2(Rij~/Rij)~6 }
! where EPSi; = sqrt( EPSi * EPSj) ! Rij* = (Ri* + Rj*)/2 !Ver Ref I Ri* EPSi !---- --- ---- ------_____ ___________ 1.0 3 IM 5.0000 0.10000 1.0 3 CU 2.4000 0.05000 1.0 3 I 4.8000 0.40000 1.0 3 OW 3.5360 0.15200 1.0 3 MG 2.3400 0.10000 1.0 3 C0 3.2000 0.10000 1.0 3 QC 6.8000 0.00008 1.0 3 QK 5.3200 0.00033 1.0 3 QL 2.2800 0.01800 1.0 3 QN 3.7400 0.00280 1.0 3 QR 5.9200 0.00017 1.0 1 C 3.7000 0.12000 1.0 1 C* 3.7000 0.12000 1.0 1 C2 3.8400 0.12000 1.0 1 C3 4.0000 0.15000 - 1.0 1 CA 3.7000 0.12000 1.0 1 CB 3.7000 0.12000 2~7 CA022l6994l997-09-30 WO9~1~- e 19 PCT/u~ 1229 1.0 1 CC 3.7000 0 12000 1.0 1 CD 3.7000 0.12000 1.0 1 CE 3.7000 0.12000 1.0 1 CF 3.7000 0.12000 1.0 1 CG 3.7000 0.12000 1.0 1 CH 3.7000 0.09000 1.0 1 CI 3.7000 0.12000 1.0 1 CJ 3.7000 0.12000 1.0 1 CK 3.7000 0.12000 1.0 1 CM 3.7000 0.12000 1.0 1 CN 3.7000 0.12000 1.0 1 CP 3.7000 0.12000 1.0 1 CQ 3.7000 0.12000 1.0 1 CR 3.7000 0.12000 1.0 1 CT 3.6000 0.06000 1.0 1 CV 3.7000 0.12000 1.0 1 CW 3.7000 0.12000 1.0 1 H 2.0000 0.02000 1.0 1 H2 2.0000 0.02000 1.0 1 H3 2.0000 0.02000 1.0 1 HC 3.0800 0.01000 1.0 1 HO 2.0000 0.02000 1.0 1 HS 2.0000 0.02000 l.C 1 LP 2.4000 0.01600 1.0 1 N 3.5000 0.16000 1.0 1 N* 3.5000 0.16000 1.0 1 N2 3.5000 0.16000 1.0 1 N3 3.7000 0.08000 1.0 1 NA 3.5000 0.16000 1.0 1 N~33.5000 0.16000 1.0 1 NC 3.5000 0.16000 1.0 1 NP 3.5000 0.16000 1.0 1 NT 3.7000 0.12000 1.0 1 O 3.2000 0.20000 1.0 1 02 3.2000 0.20000 1.0 1 OH 3.3000 0.15000 1.0 1 OS 3.3000 0.15000 1.0 1 P 4.2000 0.20000 1.0 1 S 4.0000 0.20000 ~o 96!30849 Pcr/u~ .9 1.0 1 SH 4.0000 0.20000 1.1 4 CS 3.6000 0.09030 1.1 4 AC 3.6000 0.09030 1.1 4 BC 3.6000 0.09030 1.1 4 C 3.7000 0.12000 1.1 4 H 2.0000 0.02000 1.1 4 HY 1.6000 0.04980 1.1 4 HT 2.9360 0.00450 1.1 4 HO 2.0000 0.02000 1.1 4 AH 2.9360 0.00450 1.1 4 BH 2.9360 0.00450 1.1 4 OT 3.2000 0.15910 1.1 4 OA 3.2000 0.15910 1.1 4 OB 3.2000 0.15910 1.1 4 OE 3.2000 0.15910 1.1 4 OH 3.3000 0.15000 ~ 1.1 4 O 3.2000 0.20000 1.1 4 N 3.5000 0.16000 *******************************************************
DATA FILE FOR TORSION FORCES - TORSION.DAT
*******************************************************

179 ! total entries in this data file !BIOSYM forcefield 2 !version amber.frc 1.O l9-Oct-90 !version amber.frc 1.1 8-Aug-92 !define amber ! This is the new format version of the amber forcefield !torsion_3 amber ! E = SUM(n=1,3) { V(n) * [ 1 + cos(n*Phi - PhiO(n)) ] }
!Ver Ref I J K L V1 PhiO
V2 Phi0 V3 Phi0 !---- --- ---- ---- ---- ---- _______ ______ _______ ______ _______ _____ ~ 1.0 1 O C C2 N 0.0000 0.0 0.0000 0.0 0.2000 180.0 ~ 1.0 1 O C CH C2 0.0000 0.0 0.0000 0.0 0.1000 180.0 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 1.0 1 O C CH N 0.0000 0.0 0.0000 0.0 0.1000 180.0 1.0 1 O C CH CH 0.0000 0.0 0.0000 0.0 0.1000 180.0 1.0 1 OS C2 C2 OH 0.0000 0.0 0.5000 0.0 2.0000 0.0 1.0 2 OH C2 C2 OH 0.0000 0.0 0.5000 0.0 2.0000 0.0 1.0 1 OS C2 C2 OS 0.0000 0.0 0.5000 0.0 2.0000 0.0 1.0 1 OS C2 CH OS 0.0000 0.0 0.5000 0.0 1.0000 0.0 1.0 1 OS C2 CH OH 0.0000 0.0 0.5000 0.0 1.0000 0.0 1.0 1 OH C2 CH OH 0.0000 0.0 0.5000 0.0 1.0000 0.0 1.0 1 C2 C2 S LP 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 CH C2 SH LP 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 OS CH C2 OH 0.0000 0.0 0.5000 0.0 1.0000 0.0 1.0 1 OH CH CH OH 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 OS CH CH OH 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 OS CH CH OS 0.0000 0.0 0.5000 0.0 0.5000 0.0 1.0 1 HC CM CM CT 0.0000 0.0 1.7100 180.0 0.0000 0.0 1.0 1 C CM CM HC 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.0 1 N* CM CM CT 0.0000 0.0 6.5900 180.0 0.0000 0.0 1.O 1 CA CM CM HC 0.0000 0.O
6.5900 180.0 0.0000 0.0 1.0 1 N* CM CM CA 0. 0000 0.0 9.5100 180.0 0.0000 0.0 1.0 1 HC CM CM HC 0.0000 0.0 CA 022l6994 l997-09-30 W096130849 PCT/U~9~'V12;'9 1.7100 180.0 0.0000 0.0 1.0 1 N* CM CM C 0.0000 0,0 9.5100 180.0 0.0000 0.0 1.0 1 N* CM CM HC 0.0000 0,0 6.5900 180.0 0.0000 0.0 1.0 1 N CT C 0 0 . 0000 0 .0 0.0000 0.0 0.0670 180.0 1.0 1 HC CT C O 0.0000 0.0 0.0000 0.0 0.0670 180.0 1.0 1 CT CT C O 0.0000 0.0 0.0000 0.0 0.0670 180.0 1. 0 1 CT OS CT CT 0 . 0000 0 . 0 0.2000 180.0 0.3830 0.0 1.0 1 OS CT CT OS 0.0000 0.0 0.5000 0.0 0 1440 0.0 1.0 1 OS CT CT OH 0.0000 0,0 0.5000 0.0 0.1440 0.0 1.0 1 OH CT CT OH 0 . 0000 0 .0 o 5000 o . 0 0 . 1440 0 . 0 1.0 1 H N C O 0.6500 O.C
2.5000 180.0 0.0000 0.0 1.0 1 C2 OS C2 C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 C2 OS C2 C2 0.0000 0.0 0 . 1000 0 . 0 1 . 4500 0 . 0 1.0 1 C3 OS C2 C3 0.0000 0.0 0 . 1000 0 . 0 1 . 4500 0 . 0 1.0 1 CH OS CH C2 0.0000 0.0 0.1000 0.0 0.7250 0.0 1. 0 1 CH OS CH CH 0 . 0000 0 . 0 0.1000 0.0 0.7250 0.0 1.0 1 C2 OS CH C2 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 C3 OS CH C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 1.0 1 CH OS CH N* 0.0000 0.0 0.0000 0.0 0.7250 0.0 1.0 1 C2 OS CH C3 0.0000 0.0 0.1000 0.0 0.7250 0.0 CA 022l6994 l997-09-30 W096/30849 PCT~S96/04229 1.0 1 OH P OS C3 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS C2 0 0000 0.0 o 7500 0.0 0.2500 0.0 1.0 1 OH P OS C2 0.0000 0.0 o 7500 0.0 0.2500 0.0 1.0 1 OS P OS CT 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS CH 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OS P OS C3 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OH P OS CH 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 OH P OS CT 0.0000 0.0 0.7500 0.0 0.2500 0.0 1.0 1 LP S S LP 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 1 LP S S C2 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 1 C2 S S C2 0.0000 0.0 3.5000 0.0 0.6000 0.0 1.0 1 CT S S CT 0.0000 0.0 3.5000 0.0 0.6000 0.0 1.0 1 LP S S CT 0.0000 0.0 O .0000 0. O O .0000 0. O
1.1 4 OE AC OA CS 2.1500 300.0 O .0000 0. O O .0000 0. O
1.1 4 AH AC OA CS 0.0000 0.0 1.7500 60.0 0.0000 0.0 1.1 4 CS AC OA CS 0.0000 0.0 ~ - ~~~~ 0.0 0.8500 0.0 1.1 4 OE AC OA HY 2.1500 300.0 O .0000 0. O O .0000 0. O
1.1 4 AH AC OA HY 0.0000 0. O
1.7500 60.0 0.0000 0.0 1.1 4 CS AC OA HY 0.0000 0.0 0.0000 0.0 0.8500 0.0 1.1 4 OE BC OB CS -1.0500 0.0 CA 022l6994 l997-09-30 W096130849 PCT/U~jG/0~229 O .00000. O O .0000 0. O
1.1 4 BH BC OB CS0.0000 0.0 1.2500 240.0 0.0000 0.0 1.1 4 CS BC OB CS0.0000 0.3 0.0000 0.0 1.4000 0.0 1.1 4 OE BC OB HY-1.0500 0. D
O .0000 0. O O .0000 0. O
1.1 4 BH BC OB HY0.00 o0 0.0 1.2500 240.0 0.0000 0.0 1.1 4 CS BC OB HY0.0000 0.0 0.0000 0.0 1.4000 0.0 1.1 4 HT AC OA CS0.0000 0.0 0.0000 0.0 0.8500 0.0 1.1 4 HT BC OB CS0.0000 0.0 0.0000 0.0 1.4000 0.0 1.1 4 H N C O 0.6500 0.0 2.5000 180.0 0.0000 0.0 1.1 4 HT CS C OO .0000 0. l~
0.0000 0.0 0.0670 180.0 1.0 3 * CB CD * 0.0000 0.0 5.3000 180.0 0.0000 0.0 1.0 1 * C C2 * 0.0000 0.l) o . oo00 0.0 0.0000 180.0 1.0 1 * C CA * 0.0000 0.() 5.3000 180.0 0.0000 0.0 1.0 1 * C CB * 0.0000 0.t) 4.4000 180.0 0.0000 0.0 1.0 1 * C CD * 0.0000 0.() 5.3000 180.0 0.0000 ~ - ~
1.0 1 * C CH * 0.0000 0.() O .0000 0. O O .0000 0. O
1.0 1 * C CJ * 0.0000 0.() 3.1000 180.0 0.0000 0.0 1.0 1 * C CM * 0.0000 0.() 3.1000 180.0 0.0000 0.0 1.0 1 * C CT * 0.0000 0.() O .0000 0. O O .0000 0. O
1.0 1 * C N *0.0000 0.0 10.0000 180.0 0.0000 0.0 CA 022l6994 l997-09-30 W096t30849 PCT~S96/04229 1.0 1 * C N* * o,oooo o.o 5.8000 180.0 0.0000 0.0 1.0 1 * C NA * 0,0000 0.0 5.4000 180.0 0.0000 0.0 1.0 l t C NC * 0.0000 0,0 8.0000 180.0 0.0000 0.0 1.0 1 * C OH * 0.0000 0.0 1.8000 180.0 0.0000 0.0 1.0 1 * C* C2 * 0,0000 0,0 O.0000 0.O O.0000 0.O
1.0 1 * C* CB * 0,0000 0,0 4.8000 180.0 0.0000 0.0 1.0 1 * C* CG * 0.0000 0.0 23.6000180.0 0.0000 0.0 1.0 1 * C* CT * 0.0000 0 0 O.0000 0.O O.0000 0.O
1.0 1 * C* CW * o,oooo o,o 23.6000 180.0 0.0000 0.0 l.0 l * C2 C2 * 0,0000 0,0 0.0000 0.0 2.0000 0.0 1.0 1 * C2 CA * 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 * C2 CC * 0.0000 0.0 O . 0000 0 . O O . 0000 0 . O
l.0 1 * C2 CH * 0,0000 0.0 0.0000 0.0 2.0000 0.0 1.0 l * C2 N * 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 * C2 N2 * 0,0000 0,0 O.0000 0.O O.0000 0.O
1.0 l * C2 N3 * 0.0000 0.0 0.0000 0.0 1.4000 0.0 1.0 l * C2 NT * 0.0000 0.0 O.0000 0.O 1.0000 0.O
1.0 1 * C2 OH * 0.0000 0.0 0 . 0000 0 . 0 0 . 5000 0 . 0 1.0 1 * C2 OS * 0.0000 0.0 0 . 0000 0 . 0 1 . 4~00 0 . 0 1.0 1 * C2 S * 0.0000 0.0 CA 022l6994 l997-09-30 W~6J3~849 PCT~S96~04229 O.0000 0.O 1.0000 0.O
1.0 1 * C2 SH * 0.0000 0.0 0.0000 0.0 0.7500 0.0 1.0 1 * CA CA * 0.0000 0.0 5.3000 180.0 0.0000 0.0 1. O 1 * CA CB * O . 0000 O . O
10.2000 180.0 0.0000 O.C
1.0 1 * CA CD * 0.0000 0,0 5.3000 180.0 0.0000 0.0 1. O 1 t CA CJ * 0.0000 0,0 3.7000 180.0 0.0000 0.0 1. O 1 * CA CM * O . 0000 0 . O
3.7000 180.0 0.0000 0.0 1.0 1 * CA CN * 0.0000 0.0 10.6000 180.0 0.0000 0.0 1.0 1 * CA CT * 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 * CA N2 * 0.0000 0.0 6.8000 180.0 0.0000 0.0 1.0 1 * CA NA * 0.0000 0.0 6.0000 180.0 0.0000 0.0 1.0 1 * CA NC * O .0000 0 .0 9.6000 180.0 0.0000 0.0 1.0 1 * CB CB * 0.0000 0.0 16.3000180.0 0.0000 0.0 1.0 1 * CB CN * 0.0000 0.0 20.0000180.0 0.0000 0.0 1. 0 1 * CB N* * O . 0000 0 . O
6.6000 180.0 0.0000 0-0 1.0 1 * CB NB * 0.0000 0.0 5.1000 180.0 0.0000 0.0 1.0 3 * CB NC * O . 0000 0 . O
8.3000 180.0 0.0000 0.0 1.0 1 * CC CF * 0.0000 0,0 14.3000180.0 0.0000 0.0 1.0 1 * CC CG * 0.0000 0.0 15.9000180.0 0.0000 0.0 1.0 1 * CC CT * 0.0000 0.0 O.0000 0.O O.0000 0.O

CA 022l6994 l997-09-30 W096/30819 PCT~S96/04229 1.0 1 * CC CV * o,oooo o.o 14.3000 180.0 0.0000 0.0 1.0 1 * CC CW * o,oooo o.o 15.9000 180.0 0.0000 0.0 1.0 1 * CC NA * 0.0000 0.0 5.6000 180.0 1.0 1 * CC NB * 0.0000 0.0 4.8000 180.0 0.0000 0.0 1.0 1 * CD CD * 0.0000 0.0 5.3000 180.0 0.0000 0.0 1.0 1 * CD CN * 0.0000 0.0 5.3000 180.0 0.0000 0.0 1.0 1 * CE N* * o . oooo o. o 6.7000 180.0 0.0000 0.0 1.0 1 * CE NB * 0.0000 0.0 20.0000 180.0 0.0000 0.0 1.0 1 * CF NB ~ 0.0000 0.0 4.8000 180.0 0.0000 0.0 1.0 1 * CG NA * 0.0000 0.0 6.0000 180.0 0.0000 0.0 1.0 1 * CH CH ~ 0.0000 0.0 0.0000 0.0 2.0000 0.0 1.0 1 * CH N * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.0 1 * CH N* * 0.0000 0.0 O .0000 0. O O .0000 C . O
1.0 1 * CH NT * 0.0000 0.0 O .0000 0. O 1.0000 0. O
1.0 1 * CH OH * 0.0000 0.0 0.0000 0.0 0.5000 0.0 1.0 1 * CH OS * 0.0000 0.0 0.0000 0.0 1.4500 0.0 1.0 1 * CI NC * 0.0000 0.0 13.5000 180.0 0.0000 0.0 1.0 1 * CJ CJ * 0.0000 0.0 24.4000 180.0 0.0000 0.0 1.0 1 * CJ CM * 0.0000 0.0 24.4000 180.0 0.0000 0.0 1.0 1 * CJ N* * 0.0000 0.0 CA 022l6994 l997-09-30 W096130849 PCT/U~GI'~'12:29 7,4000 180.0 0.0000 ~ ~
1.0 1 * CK N* * 0 0000 o 0 6.7000 180.0 0.0000 0.0 1.0 1 * CK NB * 0 0000 o o 20.0000 180.0 0.0000 0.0 1.0 1 * CM CM * 0,0000 0 0 24.4000 180.0 0.0000 0.Q
1.0 1 * CM CT ~ 0.0000 0 t) O.0000 0.O O.0000 0.O
1.0 1 * CM N* * 0 0000 o 0 7.4000 180 0 0.0000 0.0 1.0 1 * CN NA * 0,0000 0.0 12.2000 180.0 0.0000 0.0 1.0 1 * CP NA * 0,0000 0.C) 9.3000 1~0.0 0.0000 0.0 1.0 1 * CP NB * 0 0000 0 0 10.0000 180.0 0.0000 0.0 1.0 1 * CQ NC * 0.0000 0.0 13.5000 180.0 0.0000 0.0 1.0 1 * CR NA * 0,0000 0.0 9.3000 180.0 0.0000 0.0 1.0 1 * CR NB * 0,0000 0,0 10.0000 180.0 G.0000 0.0 1.0 1 * CT CT * 0 0000 0,0 0.0000 0.0 1.3000 0.0 1.0 1 * CT N * 0 0000 0,0 O.0000 0.O O.0000 0.O
1.0 1 * CT N* * 0.0000 0.0 O.0000 0.O O.0000 0.O
1.0 1 * CT N2 * 0 0000 0 0 O.0000 0.O O.0000 0.O
1.0 1 * CT N3 * 0.0000 0.0 0.0000 0.0 1.4000 0.0 1.0 1 * CT OH * 0,0000 0,0 0.0000 0.0 0.5000 0.0 - 1.0 1 * CT OS * 0.0000 0.0 0 . 0000 0 . 0 1 . 1500 0 . 0 1.0 1 * CT S * 0.0000 0.0 O.0000 0.O 1.0000 0.O

1. 0 1 * CT SH * 0 . 0000 0, 0 0 . 0000 0 . 0 0 . 7500 0 . 0 1. 0 1 * CV NB * 0 . 0000 0 . 0 4.8000 180.0 0.0000 0.0 1. 0 1 * CW NA * 0 . 0000 0 . 0 6.0000 180.0 0.0000 0.0 1.0 1 * OH P * 0.0000 0.0 0 . 0000 0 . 0 ~ 7500 ~ ~
1.0 1 * OS P * 0.0000 0.0 0 . 0000 0 . 0 0 . 7500 0 . 0 1.1 4 * CS CS * 0.0000 0.0 0.0000 0.0 1.0210 0.0 1.1 4 * CS CT * 0.0000 0.0 o oooo 0.0 1.0210 0.0 1.1 4 * AC CS * 0.0000 0.0 0.0000 0.0 1.0210 0.0 1.1 4 * BC CS * 0.0000 0.0 0.0000 0.0 1.0210 0.0 1.1 4 * CS OT * 0.0000 0.0 0.0000 0.0 0.4430 0.0 1.1 4 * CS OE * 0.0000 0.0 0.0000 0.0 0. ~280 0.0 1.1 4 * AC OE * 0.0000 0.0 0.0000 0.0 0.9280 0.0 1.1 4 * BC OE * 0.0000 0.0 o oooo o o 0.9280 0.0 1.1 4 * AC OA * 0.0000 0.0 O . 0000 0 . O O . 0000 0 . O
1.1 4 * BC OB * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.1 4 * CS OA * 0 . 0000 0 . 0 O .0000 0. O O .0000 0. O
1.1 4 * CS OB * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.1 4 * CS N * 0.0000 0.0 O .0000 0. O O .0000 0. O
1.1 4 * C N * 0.0000 0.0 10.0000 180.0 0.0000 0.0 1.1 4 * C CS * 0.0000 0.0 W<~ 96130849 PCI'/US96/042:29 O.0000 0.O O.0000 0.O
1.0 1 * CT NT * o.oooo 0.0 o.oo00 0.0 1.8000 0.0 *****************************************************~*
DATA FILE - CX6C.CAR
.. ****************,~.**************************~****

!BIOSYM archive 3 PBC=OFF
!DATE Thu Mar 2 10:02:29 1995 SG 0.051616628 8.775964550 2.653307337 CYSn 1 S S 0.824 LGl -0.116704460 8.906803991 3.732450018 CYSn LP L -0.405 LG2 -0.816371929 8.216369655 2 274560255 CYSn 1 LP L -0.405 CB 1.625257994 7.970290997 2.280061368 CYSn 1 CT C -0.098 B 1 1.743097230 7.117856362 2.972980432 CYSn HC H 0.050 B2 2.457560406 8.667686711 2.506611212 CYSn HC H 0.050 CA 1.664891168 7.503978115 0 811322158 CYSn 1 CT C 0.035 HA 2.715618613 7.453348875 0.469159517 CYSn 1 HC H 0.032 N 0.954382540 8.512673633 0.003030230 CYSn 1 NT N -0.463 C 1.063568189 6.132700222 0.616111991 CYSn 1 C C 0.616 O 0.248707622 5.654726837 1.414398016 CYSn 1 O O -0.504 N 1.449902196 5.479885680 -0.464156147 GLY 2 N N -0.463 HN 2.157106102 5.992384244 -1.099457509 GLY 2 H H 0.252 CA O.868490592 4.154014497 -0.652902307 GLY 2 CT C 0.035 W096/30849 PCTlu~;G/~1229 HAl 1.550908149 3.403064022 -0.212395307 GLY 2 HC H 0.032 HA2 -0.097660558 4.132736815 -0.116611463 GLY 2 HC H 0.032 C 0.730531165 3.827591429 -2.120728786 GLY 2 C C 0.616 O 1.559375145 4.206208097 -2.957020570 GLY 2 O 0 -0.504 N -0.320742949 3.103195380 -2.456098946 GLY 3 N N -0.463 HN -0.976177839 2.817016114 -1.646836012 GLY 3 H H 0.252 CA -0.454134161 2.787581074 -3.875321662 GLY 3 CT C 0.035 HAl -0.907422830 1.783240810 -3.972773051 GLY 3 HC H 0.032 HA2 -1.127648566 3.540414569 -4.323795441 GLY 3 HC H 0.032 C 0.896974016 2.736484179 -4.547627543 GLY 3 C C 0.616 O 1.315189212 1.712629073 -5.101282348 GLY 3 O 0 -0.504 N 1.599575272 3.853622667 -4.520184621 GLY 4 N N -0.463 HN 1.137216234 4.691535216 -4.019658253 GLY 4 H H 0.252 Q 2.905944550 3.804217731 -5.170228610 GLY 4 CT C 0.035 HAl 3.056204584 2.789614618 -5.584558431 GLY 4 HC H 0.032 HA2 2.897891721 4.540755026 -5.994216851 GLY 4 HC H 0.032 C 4.014980067 4.050747291 -4.175561433 GLY 4 C C 0.616 O 4.978871195 4.780583329 -4.436272241 GLY 4 O 0 -0.504 N 3.887759074 3.450944950 -3.006608050 GLY 5 N N -0.463 HN 3.003276191 2.844372268 -2.879487738 GLY 5 H H 0.252 CA 4.960071382 3.689311240-2.044877031 GLY 5 CT C 0.035 HAl 5.709592998 2.881830301-2.144167698 GLY !i HC H 0.032 HA2 5.427393718 4.658369322-2.297948016 GLY !i HC H 0.032 C 4.437174470 3.643619035-0.629041435 GLY 5 C C 0.616 0 3.798322352 2.676595378-0.197242766 GLY 5 O O -0.504 N 4.713663113 4.6918711850.124033264 GLY 6 N N -0.463 HN 5.286002166 5.476492875-0.348403798 GLY 6 H H 0.252 CA 4.208080753 4.6476919751.492986659 GLY 6 CT C 0.035 HAl 3.303800182 4.0109430921.515218779 GLY 6 HC H 0.032 HA2 4.993057374 4.1943232212.125265975 GLY 6 HC H 0.032 C 3.799265981 6.0230382581.963510280 GLY 6 C C 0.6il6 O 4.006824522 7.0362832451.285298717 GLY 6 O O -0.504 N 3.195690211 6.0777508633.136158080 GLY 7 N N -0.463 HN 3.055107813 5.1333075103.640799839 GLY 7 H H 0.252 CA 2.800412417 7.4075556563.591101372 GLY 7 CT C 0.035 HAl 1.946687677 7.3036195094.286815466 GLY 7 HC H 0.032 HA2 3.660862081 7.8473168764.127520148 GLY 7 HC H 0.032 - C 2.334578164 8.2589599962.434291753 GLY 7 C C 0.616 O 2.337411236 9.4946437832.487154063 GLY 7 O O -0.504 CA 022l6994 lgg7-o9-3o W096/30~9 PCT/U~G~1229 N 1.936206121 7.605756209 1.358640986 CYSN 8 N N -0.463 HN 1.983632457 6.528240768 1.414418956 CYSN 8 H H 0.252 CA 1.485796919 8.428968216 0.240136508 CYSN 8 CT C 0.035 HA 0.399931102 8.271042216 0.100059529 CYSN 8 HC H 0.032 C 2.167493478 8.018162291 -1.043072620 CYSN 8 C C 0.616 CB 1.746659419 9.902481747 0.610166221 CYSN 8 CT C -0.098 HBl 2.709270705 10.016688002 1.140264476 CYSN 8 HC H 0.050 HB2 1.816139488 10.541353385 -0.2939S1287 CYSN 8 HC H 0.050 SG 0.440719361 10.532225816 1.688457720 CYSN 8 S S 0.824 LGl -0.40423909710.9571459371.126774557 CYSN 8 LP L -0.405 LG2 0.793091788 11.329491558 2.359427872 CYSN 8 LP L -0.405 end W 096l30S49 PCT/U~ 29 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Deem, Michael W.
Rothberg, Jonathan Y..
Went, Gregory T.
(ii) TITLE OF INVENTION: CONSENSUS CONFIGURATIONAL BIAS MONTE
CARLO METHOD AND SYSTEM FOR PHARMACOPHORE STRUCTURE
DETERMINATION
(iii) NUMBER OF S~-~u~-~S: 10 (iv) CORRESPONDENCE ADDRESS:
~A'l ADDRESSEE: Pennie & Edmond~
~BI STREET: 1155 Avenue of the AmeriCas ~C, CITY: New York D STATE: New York E COUNTRY: USA
~F,l ZIP: 10036-2711 (v) COMPUTER READABLE FORM:
'A) MEDIVM TYPE: Fioppy di~k l'B) COMPUTER: IBM PC compatible ,C) OPERATING SYSTEM: PC-DOS/MS-DOS
~D) SOFTWARE: Patentln Relea~e ~1.0, Version ~1.30 (vi) CURRENT APPLICATION DATA:
(A) APPL~CATION NUMBER: To Be As~igned (B) FILING DATE: On Even Date Herewith (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Misrock, S. Leslie (B) ~'EGTSTRATION.NUMBER: 18,872 (C) REFERENCE/DOCKE~ NUMBER: 7934-007 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (212) 790-9090 (B) TELEFAX: (212) 869-9741/8864 (C) TELEX: 66141 PENNIE

(2) INFORMATION FOR SEQ ID NO:l:
(i) S~Q~ ~-N CE CHARACTERISTICS:
(A) LENGTH: 8 amino acid~
(8) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) N~ME/K'EY: Disulfide-bond (B) LOCATION: 1..8 (D) OTHER INFORMATION: ~note= ~A di~ulfide bond i~ formed between the CyQteine re~idue~.~

(xi) Sk~u~:NCE DESCRIPTION: SEQ ID NO:1:
Cy~ Xaa Xaa Xaa Xaa Xaa Xaa Cy~
-_ 3~3 --W 096/30849 PCTrUS96/04229 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
,A) LENGTH: 102 base pairs B) TYPE: nucleic acid C) STRANDEDNESS: qingle D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID No:2:

YlAAC TTTAACTTTA AGAAGGAGAT ATACATATGC AT 102 (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A LENGTH: 83 base pair~
(Bl TYPE: nucleic acid (C, STRANDEDNESS: 6ingle (D TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CCCAGACCCG CCCCCAGCAT TGTGGGTTCC AACGCCCTCT AGACAM~NMN NMNNMNNMNN 60 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
,A) LENGTH: 48 base pairq B) TYPE: nucleic acid C) STRANDED~ESS: ~ingle ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
~CG~CTGACC TGCCTCAACC TCCCCACAAT GCTGGCGGCG GCTCTGGT 48 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CH~RACTERISTICS:
~A LENGTH: 42 base pairE
~8, TYPE: nucleic acid ,C STRANDEDNESS: qingle ~D) TOPOLOGY: linear ~ (ii) MOLECULE TYPE: DNA

- 31~ -CA 022l6994 l997-09-30 W 096130~49 PCTIU~ 1229 ~xi) SEQUENCE DESCRIPTIoN: SEQ ID No:5:
ATCAAGTTTG CCTTTACCAG CATTGTGGAG CGC~ CA TC ~2 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICs:
(A) LENGTH lO amino acids (B) TYPE amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 Met Hi~ Cy~ Xaa Xaa Xaa Xaa Xaa Xaa Cys l 5 lO
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH 8 amino acids (B) TYPE: amino acid (D) TOPOLO~Y unknown (ii) ~OLECULE TYPE peptide (xi) SEQUENCE DESCRIPTION SEQ ID No 7 Cy~ Gly Gly Gly Gly Gly Gly Cys l 5 (2) INFORMATION FOR SEQ ID NO:8 (i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 30 ba~e pairs B) TYPE nucleic acid ,C) STRANDEDNESS: single D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
~N~NKNNKr~ hKNNK~N~CNN KNNKl~NKNNK 30 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
A'I LENGTH: 47 base pairs Bl TYPE: nucleic acid ,C, STRANDEDNESS: single ~D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
-PCT~US96/04229 ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

(2) INFORMATION FOR SEQ ID NO:lO:
(i) SEQUENCE CHARACTERlSTICS:
(A) LENGTH: 9 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOT.ECUTT' TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:lO:
Cy~ A~n Thr Leu Ly~ Gly Asp Cy~ Gly l 5 ~ - 316 -

Claims (115)

1. A method of determining a consensus pharmacophore structure comprising the steps of:
(a) identifying from one or more diversity libraries a plurality of compounds that bind to a target molecule, (b) measuring one or more distances in one or more of the compounds, and (c) determining a consensus pharmacophore structure for the compounds.

2. The method of claim 1 wherein said compounds are peptides, peptide derivatives, or peptide analogs.

3. The method of claim 2 wherein said compounds are peptides containing one or more cystines.

4. The method of claim 3 wherein the peptides comprise the sequence CX6C (SEQ ID NO:1).

5. The method of claim 1 further comprising a step of selecting a plurality of candidate pharmacophores based on chemical structures of said compounds, the selected plurality of candidate pharmacophores being used in step (c) to determine the consensus pharmacophore structure.

6. The method of claim 5 wherein said selecting is further according to rules of homology that determine that two candidate pharmacophores are homologous if they have chemically similar side chains.

7. The method of claim 1 which further comprises after said identifying step, a screening step involving a genetic selection technique.

8. The method of claim 1 wherein the step of measuring distance comprises making solid phase nuclear magnetic resonance measurements on selected nuclei in a nuclear magnetic resonance spectrometer upon a sample comprising one of the compounds.

9. The method of claim 8 wherein the step of measuring distances further comprises making rotational echo double resonance nuclear magnetic resonance measurements of internuclear dipoie-dipole interaction strength between selected nuclei in the compound in the sample.

10. The method of claim 8 wherein the sample further comprises a substrate having a surface to which the compound is attached.

11. The method of claim 8 wherein the sample is cooled below room temperature.

12. The method of claim 8 wherein the compound is bound to the target molecule.

13. The method of claim 10 wherein a plurality of the compound is attached to the surface at a surface density such that the inter-nuclear dipole-dipole interactions between different molecules is less than 10% of the inter-nuclear dipole-dipole interaction within one molecule.

14. The method of claim 10 wherein the substrate has pores of sufficient size to permit the target to diffuse and bind to the compound in the sample.

15. The method of claim 9 wherein rotational echo double resonance nuclear magnetic resonance measurements can be made on the compound bound to the target or hydrated or in a dry nitrogen atmosphere.

16. The method of claim 10 wherein the compound is a peptide, and a plurality of the peptide is attached to the substrate surface, which has a purity of the peptide of at least 95% and wherein the surface density of the peptide is no more than one peptide per 100 .ANG.2 of substrate surface.

17. The method of claim 10 wherein the substrate is selected from the group consisting of p-MethylBenzhydrilamine resin, divinylbenzyl polystyrene resin, and glass beads.

18. The method of claim 8 wherein the selected nuclei are selected from the group consisting of 13C, 15N, 19F, and 31p.

19. The method of claim 9 wherein the nuclear magnetic resonance spectrometer comprises magnetic excitation means, a sample rotor, and free induction decay observing means, and the step of making rotational echo double resonance nuclear magnetic resonance measurements further comprises the steps of:
(a) spinning the sample in the sample rotor, (b) initially exciting magnetically the selected nuclei to be observed, (c) providing subsequently one .pi. spin flip magnetic excitation during each rotor period to each of the selected nuclei, the pulses to the different nuclei having fixed phase delays, (d) observing the free induction decay signal as a function of the number of rotor periods; and (e) finding the dipole-dipole strength between the selected nuclei, whereby the internuclear distance between the selected nuclei can be obtained.

20. The method of claim 1 wherein the step of measuring distances comprises making liquid phase nuclear magnetic resonance measurements.

21. A method of determining a consensus pharmacophore structure comprising the steps of:
(a) identifying from one or more diversity libraries a plurality of compounds that bind to a target molecule, (b) determining a consensus pharmacophore structure for the compounds.

22. A method of determining a consensus pharmacophore structure comprising the steps of:
(a) measuring one or more distances in one or more compounds that bind to a target molecule, and (b) determining a consensus pharmacophore structure for the compounds that is constrained by said distances.

23. The method of claim 21 or 22 further comprising a step of selecting a plurality of candidate pharmacophores based on chemical structures of said compounds, the selected plurality of candidate pharmacophores being used in step (b) to determine the consensus pharmacophore structure.

24. The method of claim 21 or 22 wherein the compounds have limited conformational degrees of freedom at the temperature of interest, and wherein the step of determining a consensus pharmacophore structure for each compound further comprises, performing a consensus configurational bias Monte Carlo method, said Monte Carlo method comprising the steps of:
(a) generating a proposed structure for a compound identified from said one or more diversity libraries by making conformational alterations consistent with the conformational degrees of freedom, the alterations being made to a representation of the compound's current chemical and conformational structure to generate a proposed representation, the proposed structure being generated with a bias toward more acceptable configurations of lower energy, whereby the method is made more efficient, (b) accepting and storing the proposed structure according to a probability depending on an energy determined for the proposed structure, and (c) repeating these steps until sufficient structures have been stored for each compound to permit statistically significant determination of an equilibrium structure for each compound.

25. A method of determining one or more lead compounds for use as a drug that binds to a target molecule comprising the steps of:
(a) identifying from one or more diversity libraries a plurality of compounds that bind to a target molecule;
(b) determining a consensus pharmacophore structure for the compounds; and (c) determining one or more lead compounds for use as a drug which share a pharmacophore specification with the determined consensus pharmacophore structure.

26. A method of determining one or more lead compounds for use as a drug that binds to a target molecule comprising the steps of:
(a) measuring one or more distances in one or more compounds that bind to a target molecule;
(b) determining a consensus pharmacophore structure for the compounds that is constrained by said distances; and (c) determining one or more lead compounds for use as a drug which share a pharmacophore specification with the determined consensus pharmacophore structure.

27. The method according to claim 25 or 26 wherein said step of determining one or more lead compounds comprises modifying a compound identified as binding to the target molecule, said modification being done outside of the pharmacophore structure, to render the compound more attractive for use as a drug.

28. The method of claim 1 wherein the compounds have limited conformational degrees of freedom at a temperature of interest, and wherein the step of determining a consensus pharmacophore structure for the compounds further comprises performing a consensus configurational bias Monte Carlo method, said Monte Carlo method comprising the steps of:
(a) generating a proposed structure for a compound identified from said one or more diversity libraries by making conformational alterations consistent with the conformational degrees of freedom, the alterations being made to a representation of the compound's current chemical and conformational structure to generate a proposed representation, the proposed structure being generated with a bias toward more acceptable configurations of lower energy, (b) accepting and storing the proposed structure according to a probability depending on an energy determined for the proposed structure, and (c) repeating these steps until sufficient structures have been stored for each compound to permit statistically significant determination of an equilibrium structure for each compound.

29. The method of claim 28 wherein the limited conformational degrees of freedom comprise torsional rotations about mutual bonds between otherwise rigid subunits of the compound, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, the torsional rotations respecting any conformational constraints present.

30. The method of claim 28 wherein the compound is a peptide, peptide derivative, or peptide analog.

31. The method of claim 28 wherein the conformational alterations comprise constrained, concerted torsional rotations or removal of a side chain and regrowth of the side chain with a new torsional conformation.

32. The method of claim 31 wherein the constrained, concerted torsional rotations are constrained so that no more than four rigid units are spatially displaced.

33. The method of claim 28 wherein determining the energy for the proposed structure of one compound comprises including one or more constraint terms which represent knowledge of measured structure for the compound.

34. The method of claim 33 wherein the constraint terms comprise a weighted sum of squares of differences of the actual and measured structures.

35. The method of claim 28 wherein the energy is determined for the proposed structure of one compound by a method comprising including consensus terms which represent knowledge that the identified compounds all bind to the same target, the compounds being otherwise treated independently by the method.

36. The method of claim 35 wherein the consensus terms are a weighted sum of squares of differences in the atomic positions of a candidate pharmacophore from the average values of these positions in all the compounds.

37. The method of claim 35 wherein the step of determining the consensus pharmacophore structure comprises determining a candidate pharmacophore for which the consensus terms are relatively small compared to the total energy.

38. The method of claim 35 wherein the step of determining the consensus pharmacophore structure comprises determining a candidate pharmacophore for which the consensus terms are minimum compared to other selected regions.

39. The method of claim 28 wherein the equilibrium structure is determined by a method comprising averaging selected generated and accepted structures for each compound.

40. The method of claim 39 wherein the averaging of structures comprises clustering selected generated and accepted structures into sets of similar structures and averaging these sets for each member.

41. A method of identifying a compound that binds to a target molecule comprising the following steps in the order stated:
(a) contacting compounds of a phage display or polysome-based diversity library with a target molecule;
(b) identifying one or more compounds in the library that bind to the target molecule;
(c) contacting one or more first fusion proteins, each first fusion protein comprising an identified compound, with a second fusion protein comprising the target molecule or a binding portion thereof, in which binding of the first fusion protein to the second fusion protein results in an increase in activity or activation of a transcriptional promoter or an origin of replication; and (d) identifying one or more of the compounds that when present in said first fusion protein result in said increase in activity or activation.

42. A method of making solid state nuclear magnetic resonance measurements comprising measuring internuclear dipole-dipole interaction strengths between selected nuclei in a compound, said compound being covalently attached to the surface of a substrate.

43. The method of claim 42 which further comprises before said measuring step the step of synthesizing a plurality of said compound on the surface of the substrate.

44. The method of claim 43 wherein said plurality of the compound is at least 95% pure.

45. The method of claim 42 wherein a plurality of said compound is attached to the substrate surface, with at least 10 .ANG. spacing between molecules of the compound.

46. The method of claim 42 wherein the substrate has pores of sufficient size to permit a molecule to diffuse and bind to the compound.

47. The method of claim 42 wherein the substrate has a surface density of the compound such that the internuclear dipole-dipole interactions between different molecules of the compound is less than 10% of the internuclear dipole-dipole interaction within one molecule of the compound.

48. The method of claim 42 wherein the compound is a peptide, peptide derivative, or peptide analog.

49. The method of claim 42 wherein the substrate is selected from the group consisting of p-MethylBenzhydrilamine resin, divinylbenzyl polystyrene resin, and a glass bead.

50. The method of claim 42 wherein said measuring step comprises using a nuclear magnetic resonance spectrometer, said spectrometer comprising magnetic excitation means, a sample rotor, and free induction decay observing means; and said measurement of internuclear dipole-dipole interaction is done by a method comprising the steps of:
(a) spinning the sample in the sample rotor;
(b) initially exciting magnetically the selected nuclei to be observed;
(c) providing subsequently one or more .pi. spin flip magnetic excitations during each rotor period to one or both of the selected nuclei, wherein pulses to the different nuclei have fixed phase delays;
(d) observing a free induction decay signal as a function of the number of rotor periods; and (e) determining the dipole-dipole strength between the selected nuclei, whereby the internuclear distance between the selected nuclei can be obtained.

51. A method of configurational bias Monte Carlo determination of the structure of a compound having limited conformational degrees of freedom at a temperature of interest, the method comprising the steps of:
(a) generating a proposed structure for the compound by making conformational alterations consistent with the conformational degrees of freedom, the alterations being made to a representation of the compound's current chemical and conformational structure to generate a proposed representation, said proposed structure being generated with a bias toward more acceptable configurations of lower energy;

(b) accepting and storing the proposed structure according to a probability depending on an energy determined for the proposed structure; and (c) repeating these steps until sufficient structures have been stored to permit statistically significant determination of an equilibrium structure.

52. The method of claim 51 wherein the conformational degrees of freedom comprise torsional rotations about:
mutual bonds between otherwise rigid subunits of the compound, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, the torsional rotations respecting any conformational constraints present.

53. The method of claim 51 wherein the compound is a peptide, peptide derivative, or peptide analog.

54. The method of claim 51 wherein the conformational alterations comprise constrained, concerted torsional rotations.

55. The method of claim 54 wherein the constrained, concerted torsional rotations are constrained so that no more than four rigid units are spatially displaced.

56. The method of claim 51 wherein the conformational alterations comprise removal of a side chain and regrowth of the side chain with a new torsional conformation.

57. The method of claim 51 wherein the energy is determined for the proposed structure by a method comprising including constraint terms which represent knowledge of measured structure for the compound.

58. The method of claim 57 wherein the constraint terms comprise a weighted sum of squares of differences of the actual and measured structures.

59. The method of claim 51 applied to a plurality of compounds of limited conformational degrees of freedom all of which bind to the same target molecule wherein the method further comprises a step of selecting a plurality of candidate pharmacophores based on chemical structures of said compounds.

60. The method of claim 51 wherein the energy is determined for the proposed structure of one of the plurality of compounds by a method comprising including consensus terms which represent knowledge that the compounds all bind to the same target molecule.

61. The method of claim 61 wherein the consensus terms are a weighted sum of squares of differences in the atomic positions of a candidate pharmacophore of said one of the plurality of compounds from the average values of these positions in all the compounds.

62. The method of claim 61 which further comprises a step of determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are minimum compared to other candidate pharmacophores.

63. The method of claim 60 which further comprises a step of determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are relatively small compared to the total energy.

64. The method of claim 62 or 63 which further comprises a step of determining one or more lead compounds for use as a drug which share a pharmacophore specification with the determined consensus pharmacophore structure.

65. The method of claim 51 wherein the equilibrium structure is determined by a method comprising averaging selected generated and accepted structures.

66. The method of claim 66 wherein the averaging of structures comprises clustering selected generated and accepted structures into sets of similar structures and averaging these sets.

67. An apparatus for configurational bias Monte Carlo determination of the structure of a compound having limited conformational degrees of freedom at a temperature of interest, the apparatus comprising:
(a) memory means for storing (i) data structures representing the compound's chemical and conformational structure consistently with the compound's degrees of freedom, said data structures capable of representing substantially continuous changes in said compound's conformational structure;
(ii) similar data structures representing the compound's proposed structure and prior structures, and (iii) parameters representing atomic interactions, and (b) processor means for executing programs for (i) generating a proposed structure by making conformational alterations consistent with the conformational degrees of freedom and with a bias toward more acceptable configurations of lower energy, (ii) accepting and storing the proposed structure according to a probability depending on an energy determined for the proposed structure, and (iii) repeating these steps until sufficient structures have been stored to permit statistically significant determination of an equilibrium structure.

68. The apparatus of claim 67 wherein the conformational degrees of freedom comprise torsional rotations about mutual bonds between otherwise rigid subunits of the compound, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, the torsional rotations respecting any conformational constraints present.

69. The apparatus of claim 67 wherein the compound is a peptide, peptide derivative, or peptide analog.

70. The apparatus of claim 67 wherein the memory, processor, and control means are configured from a workstation type digital computer comprising RAM memory, disk memory, processor, and input and display devices.

71. The apparatus of claim 67 wherein the conformational alterations made by the processor means further comprise constrained, concerted torsional rotations or removal of a side chain and regrowth of the side chain with a new torsional conformation.

72. The apparatus of claim 71 wherein the constrained, concerted torsional rotations are constrained so that no more than four rigid units are spatially displaced.

73. The apparatus of claim 67 wherein the processor means determines an energy for the proposed structure by a method comprising including constraint terms which represent knowledge of measured structure for the compound.

74. The apparatus of claim 73 wherein the constraint terms comprise a weighted sum of squares of differences of the actual and measured structures.

75. The apparatus of claim 67 applied to a plurality of compounds of limited conformational degrees of freedom all of which bind to the same target molecule, and wherein the processor means further comprises programs for selecting a plurality of candidate pharmacophores based chemical structures of said compounds.

76. The apparatus of claim 67 wherein the processor means determines an energy for the proposed structure of any one compound by a method comprising including consensus terms which represent knowledge that the compounds all bind to the same target molecule.

77. The apparatus of claim 76 wherein the consensus terms are a weighted sum of squares of differences in the atomic positions of a candidate pharmacophore of said one compound from the average values of these positions in all the compounds.

78. The apparatus of claim 76 wherein the processor means further comprises programs for determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are minimum compared to other candidate pharmacophores.

79. The apparatus of claim 76 wherein the processor means further comprises programs for determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are relatively small compared to the total energy.

80. The apparatus of claim 78 or 79 wherein the processor means further comprises programs for determining one or more lead compounds for use as a drug that share a pharmacophore specification with the consensus pharmacophore structure.

81. The apparatus of claim 67 wherein the processor means determines an equilibrium structure by a method comprising averaging selected generated and accepted structures.

82. The apparatus of claim 81 wherein the averaging of structures further comprises clustering selected generated and accepted structures into sets of similar structures and averaging these sets.

83. In a digital computer, apparatus for configurational bias Monte Carlo determination of the structure of at least one compound having limited conformational degrees of freedom at a temperature of interest, said apparatus comprising:
(a) first memory means for storing data structures representing the compound's chemical and conformational structure consistently with the compound's degrees of freedom, said data structures capable of representing substantially continuous changes in said compound's conformational structure;
(b) second memory means for storing similar data structures representing the compound's proposed structure, (c) third memory means for storing similar data structures representing the compound's prior structures, (d) first processor means for generating a proposed structure by making conformational alterations consistent with the conformational degrees of freedom and with a bias toward conformations of lower energy, (e) second processor means for accepting and storing the proposed structure according to a probability depending on an energy determined for the proposed structure, and (f) third processor means for controlling and repeating the generation and acceptance until sufficient structures have been stored to permit statistically significant determination of an equilibrium structure.

84. The digital computer apparatus of claim 83 wherein the conformational degrees of freedom comprise torsional rotations about mutual bonds between otherwise rigid subunits of the compound, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, the torsional rotations respecting any conformational constraints present.

85. The digital computer apparatus of claim 83 wherein the compound is a peptide, peptide derivative, or peptide analog.

86. The digital computer apparatus of claim 83 wherein the digital computer is a workstation type digital computer comprising RAM memory, disk memory, processor, and input and display devices.

87. The digital computer apparatus of claim 83 wherein the conformational alterations generated by the first processor means comprise constrained, concerted torsional rotations or removal of a side chain and regrowth of the side chain with a new torsional conformation.

88. The digital computer apparatus of claim 87 wherein the constrained, concerted torsional rotations are constrained so that no more than four rigid units are spatially displaced.

89. The digital computer apparatus of claim 83 wherein the second processor means determines an energy for the proposed structure by a method comprising including constraint terms which represent knowledge of measured structure for the compound.

90. The digital computer apparatus of claim 89 wherein the constraint terms comprise a weighted sum of squares of differences of the actual and measured structures.

91. The digital computer apparatus of claim 83 in which said at least one compound is a plurality of compounds of limited conformational degrees of freedom all of which bind to the same target and wherein data are stored in said first memory means representing the chemical and conformational structure of said plurality of compounds and wherein the apparatus further comprises additional processor means for selecting a plurality of candidate pharmacophores based on chemical structures of said compounds.

92. The digital computer apparatus of claim 83 wherein the second processor means determines an energy for the proposed structure of one of said plurality of compounds by a method comprising including consensus terms which represent knowledge that the compounds all bind to the same target molecule.

93. The digital computer apparatus of claim 91 wherein the consensus terms are a weighted sum of squares of differences in the atomic positions of a candidate pharmacophore of said one of the plurality of compounds from the average values of these positions in all the compounds.

94. The digital computer apparatus of claim 92 wherein the apparatus further comprises processor means for determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are relatively small compared to the total energy.

95. The digital computer apparatus of claim 92 wherein the apparatus further comprises processor means for determining a consensus pharmacophore structure by determining a candidate pharmacophore for which the consensus terms are minimum compared to other candidate pharmacophores.

96. The digital computer apparatus of claims 94 or 95 wherein the apparatus further comprises processor means for determining one or more lead compounds for use as a drug that share a pharmacophore specification with the consensus pharmacophore structure.

97. The digital computer apparatus of claim 83 wherein the third processor means determines an equilibrium structure by a method comprising averaging selected generated and accepted structures.

98. The digital computer apparatus of claim 97 wherein the averaging of structures comprises clustering selected generated and accepted structures into sets of similar structures and averaging these sets.

99. In a digital computer, apparatus for configurational bias Monte Carlo determination of the structure of a plurality of compounds having limited conformational degrees of freedom, each compound having a backbone and side chains, said apparatus comprising:
(a) first memory means for storing data structures representing each compound's chemical and conformational structure consistently with that compound's degrees of freedom and constraints, said data structures capable of representing substantially continuous changes in each compound's conformational structure;
(b) second memory means for storing similar data structures representing a proposed structure for one or more of the compounds, (c) third memory means for storing similar data structures representing prior structures of the plurality of compounds, (d) first processor means for generating a proposed structure of a randomly selected compound by making conformational alterations consistent with the conformational degrees of freedom, the conformational alterations being randomly distributed between alterations that alter the structure of a randomly selected side chain of the selected compound and alterations that alter the structure of a randomly selected region of the backbone of the selected compound, the proposed.
structure being stored in the second memory means, the proposed structure being generated with a bias toward more acceptable structures of lower energy, whereby the method is made more efficient, (e) second processor means for accepting a proposed structure according to a probability depending on an energy determined for the proposed structure, the energy including terms representing physical interactions and terms representing heuristic information about the compound's structure, the heuristic information comprising knowledge about measured distances in one or more compounds of said plurality and about the plurality of the compounds binding to a same target molecule, (f) third processor means for controlling and repeating these steps until sufficient structures have been generated and accepted to permit statistically significant determination of an equilibrium structure.

100. The digital computer of claim 99 wherein the conformational degrees of freedom comprise torsional rotations about mutual bonds between otherwise rigid subunits of the compound, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, the torsional rotations respecting any conformational constraints present.

101. The digital computer of claim 99 wherein the compound is a peptide, peptide derivative, or peptide analog.

102. A method of configurational bias Monte Carlo determination of the structure of a compound selected from the group consisting of a peptide, peptide derivative, and peptide analog, the method comprising the steps of:
(a) representing the conformation of the compound by interconnected rigid units capable of torsional rotation about common bonds, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, (b) generating a proposed structure by making conformational alterations consistent with the compound's structure, the proposed structure being generated with a bias toward more acceptable configurations of lower energy;

(c) accepting a proposed structure according to a probability depending on an energy determined for the proposed structure, and (d) repeating these steps until sufficient structures have been generated and accepted to permit statistically significant determination of an equilibrium structure.

103. An apparatus for configurational bias Monte Carlo determination of the structure of a compound selected from the group consisting of a peptide, peptide derivative, and peptide analog, the apparatus comprising:
(a) memory means for storing (i) data structures representing the compound's conformation as interconnected rigid units capable of torsional rotation about common bonds, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, said data structures capable of representing substantially continuous changes in each compound's conformational;
(ii) similar data structures representing the compound's proposed structure and prior structures, and (iii) parameters representing atomic interactions, and (b) processor means for executing programs for (i) generating a proposed structure by making conformational alterations consistent with the compound's structure and with a bias toward more acceptable configurations of lower energy, (ii) accepting a proposed structure according to a probability depending on an energy determined for the proposed structure, and (iii) repeating these steps until sufficient structures have been generated and accepted to permit statistically significant determination of an equilibrium structure.

104. In a digital computer, apparatus for configurational bias Monte Carlo determination of the structure of a compound selected from the group consisting of a peptide, peptide derivative, and peptide analog, said apparatus comprising:
(a) first memory means for storing data structures representing the compound's structure as interconnected rigid units capable of torsional rotation about common bonds, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, said data structures capable of representing substantially continuous changes in said compound's structure;
(b) second memory means for storing similar data structures representing the compound's proposed structure, (c) third memory means for storing similar data structures representing the compound's prior structures, (d) first processor means for generating a proposed structure by making conformational alterations consistent with the compound's structure and constraints and with a bias toward conformations of lower energy, (e) second processor means for accepting a proposed structure according to a probability depending on an energy determined for the proposed structure, and (f) third processor means for controlling and repeating these steps until sufficient structures have been generated and accepted to permit statistically significant determination of an equilibrium structure.

105. In a digital computer, apparatus for configurational bias Monte Carlo determination of the structure of a plurality of compounds selected from the group consisting of peptides, peptide derivatives, and peptide analogs, each compound having a backbone and side chains, said apparatus comprising:
(a) first memory means for storing data structures representing each compound's structure as interconnected rigid units capable of torsional.
rotation about common bonds, each rigid unit's representation comprising its interconnections and atomic composition, each atom's representation comprising its type and position, said data structures capable of representing substantially continuous changes in conformational structure;
(b) second memory means for storing similar data structures representing a proposed structure for one or more of the compounds, (c) third memory means for storing similar data structures representing prior structures of the plurality of the compounds, (d) first processor means for generating a proposed structure of a randomly selected compound by making conformational alterations consistent with the compound's structure, the conformational alterations being randomly distributed between alterations that alter the structure of a randomly selected side chain of the selected compound and alterations that alter the structure of a randomly selected region of the backbone of the selected compound, the proposed structure being stored in the second memory means the proposed structure being generated with a bias toward more acceptable structures of lower energy, (e) second processor means for accepting a proposed structure according to a probability depending on an energy determined for the proposed structure, the energy including terms representing physical interactions and terms representing heuristic information about the compound's structure, the heuristic information comprising knowledge about measured distances in one or more compounds of said plurality and about the plurality of the compounds binding to a same target molecule, (f) third processor means for controlling and repeating these steps until sufficient structures have been generated and accepted to permit statistically significant determination of an equilibrium structure.

106. The method of claim 42 wherein the nuclear magnetic resonance is rotational echo double resonance.

107. The method of claim 1 wherein the diversity libraries are structurally constrained organic diversity libraries.

108. The method of claim 29 wherein said conformational constraints further comprise internally linked backbone structure constraints preserved by concerted rotation.

109. The method of claim 52 wherein said conformational constraints further comprise internally linked backbone structure constraints preserved by concerted rotation.

110. The apparatus of claim 68 wherein said conformational constraints further comprise internally linked backbone structure constraints preserved by concerted rotation.

111. The digital computer apparatus of claim 84 wherein said conformational constraints further comprise internally linked backbone structure constraints preserved by concerted rotation.

112. The digital computer of claim 100 wherein said conformational constraints further comprise internally linked backbone structure constraints preserved by concerted rotation.

113. The method of claim 102 wherein said step of generating a proposed structure further comprises concerted rotation which preserves internally linked backbone structure constraints.

114. The apparatus of claim 103 wherein said step of generating a proposed structure further comprises concerted rotation which preserves internally linked backbone structure constraints.

115. The digital computer of claim 104 or 105 wherein said step of generating a proposed structure further comprises concerted rotation which preserves internally linked backbone structure constraints.