CA2141060C - Cyclic gmp-binding, cyclic gmp-specific phosphodiesterase materials and methods - Google Patents

Abstract

The present invention provides novel purified and isolated nucleotide sequences encoding the cGMP-binding, cGMP-specific phosphodiesrtrase designated cGB-PDE. Also provided by the invention are methods and materials for the recombinant production of cGB-PDE polypeptide products and methods for identifying compounds which modulate the enzymatic activity of cGB-PDE polypeptides.

Description

21410fi0 CYCLIC GMP-BINDING, CYCLIC GMP-SPECIFIC
PHOSPHODIESTERASE MATERIALS AND METHODS
Experimental work described herein was supported in part by Research Grants GM15731, DK21723, DK40029 and GM41269 and the Medical Scientist Training Program Grant GM07347 awarded by the National Institutes of Health. The United States government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates generally to a cyclic guanosine monophosphate-binding, cyclic guanosine monophosphate-specific phosphodiesterase designated cGB-PDE
and more particularly to novel purified and isolated polynucleotides encoding cGB-PDE polypeptides, to methods and materials for recombinant production of cGB-PDE polypeptides, and to methods for identifying modulators of cGB-PDE activity.
BACKGROUND
Cyclic nucleotide phosphodiesterases (PDEs) that catalyze the hydrolysis of 3'5' cyclic nucleotides such as cyclic guanosine monophosphate (cGMP) and cyclic adenosine monophosphate (CAMP) to the corresponding nucleoside 5' monophosphates constitute a complex family of enzymes. By mediating the intracellular concentration of the cyclic nucleotides, the PDE isoenzymes function in signal transduction pathways involving cyclic nucleotide second messengers.
A variety of PDEs have been isolated from different tissue sources and many of the PDEs characterized to date exhibit differences in biological properties including physicochemical properties, substrate specificity, sensitivity to inhibitors, immunological reactivity and mode of regulation. [See Beavo et al., Cyclic Nucleotide Phosphod.iesterases: Structure, Regulation and Drug Action, John Wiley & Sons, Chichester, U.K. (1990)] Comparison of the known amino acid sequences of various PDEs indicates that most PDEs are chimeric multidomain proteins that WO 94!28144 ~~~ ~ PCTIUS94I06066 have distinct catalytic and regulatory domains. [See Charbonneau, pp. 267-296 in Beavo et al., supra] All mammalian PDEs characterized to date share a sequence of approximately 250 amino acid residues in length that appears to comprise the catalytic site and is located in the carboxyl terminal region of the enzyme. PDE domains that interact with allosteric or regulatory molecules are thought to be located within the amino-terminal regions of the isoenzymes. Based on their biological properties, the PDEs may be classified into six general families: the Ca2+/calmodulin-stimulated PDEs (Type I), the cGMP-stimulated PDEs (Type II), the cGMP-inhibited PDEs (Type III), the cAMP-specfic PDEs (Type IV), the cGMP-specific phosphodiesterase cGB-PDE (Type V) which is the subject of the present invention and the cGMP-specific photoreceptor PDEs ('Type VI).
The cGMP-binding PDEs ~I~pe II, Type V and Type VI PDEs), in addition to having a homologous catalytic domain near their carboxyl terminus, have a second conserved sequence which is located closer to their amino terminus and which may comprise an allosteric cGMP-binding domain. See Charbonneau et al., Proc. Natl. Acad. Sci. USA, 87: 288-292 (1990).
The Type II cGMP-stimulated PDEs (cGs-PDEs) are widely distributed in different tissue types and are thought to exist as homodimers of 100-105 kDa subunits. The cGs-PDEs respond under physiological conditions to elevated cGMP
concentrations by increasing the rate of cAMP hydrolysis. The amino acid sequence of a bovine heart cGs-PDE and a partial cDNA sequence of a bovine adrenal cortex cGS-PDE are reported in LeTrong et al., Biochemistry, 29: 10280-10288 (1990) and full length bovine adrenal and human fetal brain cGB-PDE cDNA sequences are described in Patent Cooperation Treaty International Publication No. WO 92/

published on October 29, 1992. The full length bovine adrenal cDNA sequence is also described in Sonnenburg et al. , .1. Biol. C'hem. , 266: 17655-17661 ( 1991 ) .
The photoreceptor PDEs and the cGB-PDE have been described as cGMP-specific PDEs because they exhibit a 50-fold or greater selectivity for hydrolyzing cGMP over cAMP.
The photoreceptor PDEs are the rod outer segment PDE (ROS-PDE) and the cone PDE (COS-PDE). The holoenzyme structure of the ROS-PDE consists of two large subunits « (88 kDa) and /3 (84 kDa) which are both catalytically active and two smaller y regulatory subunits (both 11 kDa). A soluble form of the ROS-PDE has also been identified which includes a, /3, and y subunits and a 8 subunit (15 kDa) that appears to be identical to the COS-PDE 15 kDa subunit. A full-length - cDNA corresponding to the bovine membrane-associated ROS-PDE a subunit is described in Ovchinnikov et al. , FEBS Lett. , 223: 169-173 ( 1987) and a full length cDNA corresponding to the bovine rod outer segment PDE S subunit is described in Lipkin et al., J. Biol. Chem., 265: 12955-12959 (1990). Ovchinnikov et al., FEBS
Lett., 20it: 169-173 (1986) presents a full-length cDNA corresponding to the bovine ROS-PDE y subunit and the amino acid sequence of the b subunit. Expression of the ROS-PDE has also been reported in brain in Collins et al. , Genomics, 13: 698-(1992). The COS-PDE is composed of two identical a' (94 kDa) subunits and three smaller subunits of 11 kDa, 13 kDa and 15 kDa. A full-length cDNA
corresponding to the bovine COS-PDE a' subunit is reported in Li et al. , Proc. Natl. Acad.
Sci.
USA, 87: 293-297 (1990).
cGB-PDE has been purified to homogeneity from rat [Francis et al., Methods Enzymol. , 159: 722-729 ( 1988)] and bovine lung tissue ['Thomas et al. , J.
Biol. Chem., 265: 14964-14970 (1990), hereinafter "Thomas I"]. The presence of this or similar enzymes has been reported in a variety of tissues and species including rat and human platelets [Hamet et al. , Adv. Cyclic Nucleotide Protein Phosphorylation Res., 16: 119-136 (1984)], rat spleen [Coquil et al., Biochem.
Biophys. Res. Commun., 127: 226-231 (1985)], guinea pig lung [Davis et al., J.
Biol.
Chem., 252: 4078-4084 (1977)], vascular smooth muscle [Coquil et al., Biochim.
Biophys. Acta, 631: 148-165 (1980)], and sea urchin sperm [Francis et al., J.
Biol.
Chem., 255: 620-626 (1979)]. cGB-PDE may be a homodimer comprised of two 93 kDa subunits. [See Thomas I, supra] cGB-PDE has been shown to contain a single site not found in other known cGMP-binding PDEs which is phosphorylated by cGMP-dependent protein kinase (cGK) and, with a lower affinity, by CAMP-dependent protein kinase (cAK). [See Thomas et al., J. Biol. Chem., 265: 14971-14978 (1990), hereinafter "Thomas II"] The primary amino acid sequence of the phosphorylation site and of the amino-terminal end of a fragment generated by chymotryptic digestion of cGB-PDE are described in Thomas II, supra, and Thomas 21410fi0 _ I, supra, respectively. However, the majority of the amino acid sequence of cGH-PDE has not previously been described.
Various inhibitors of different types of PDEs have been described in the literature. Two inhibitors that exhibit some specificity for Type V PDEs are zaprinast and dipyridamole. See Francis et al., pp. 117-140 in Heavo et a1 . , supra.
Elucidation of the DNA and amino acid sequences encoding the cGB-PDE ad production of cGB-PDE polypeptide by recombinant methods would provide information and material to allow the identification of novel agents that selectively modulate the activity of the cGB-PDEs. The recognition that there are distinct types or families of PDE isoenzymes and that different tissues express different complements of PDEs has led to an interest in the development of PDE modulators which may have therapeutic indications for disease states that involve signal transduction pathways utilizing cyclic nucleotides as second messengers. Various selective and non-selective inhibitors of PDE activity are discussed in Murray et al., Bjochem. Soc. Trans., 20(2): 460-464 (1992).
Development of PDE modulators without the ability to produce a specific PDE by recombinant DNA techniques is difficult because all PDEs catalyze the same basic reaction, have overlapping substrate specificities and occur only in trace amount s . As a result , purif icat ion to homogeneity of many PDEs is a tedious and difficult process.
There thus continues to exist a need in the art for DNA and amino acid sequence information for the cGB-PDE, for methods and materials for the recombinant production of cGH-PDE polypeptides and for methods for identifying specific modulators of cG8-PDE activity.
SUMMARY OF THE INVENTION
The present invention provides novel purified and isolated polynucleotides (e.g., DNA sequences and RNA
transcripts, both sense and antisense strands, including splice variants thereof) encoding the cGMP-binding, cGMP-specific PDE designated cGB-PDE. Preferred DNA sequences of ....,.
2~4~oso the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. DNA
sequences encoding cGB-PDE that are set out in SEQ ID NO: 9 or 22 and DNA sequences which hybridize thereto under stringent conditions - 4a -F' 64267-798 -s-or DNA sequences which would hybridize thereto but for the redundancy of the genetic code are contemplated by the invention. Also contemplated by the invention are biological replicas (i.e., copies of isolated DNA sequences made in vivo or in vitro) of DNA sequences of the invention. Autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating cGB-PDE
sequences and especially vectors wherein DNA encoding cGB-PDE is operatively linked to an endogenous or exogenous expression control DNA sequence and a transcriptional terminator are also provided. Specifically illustrating expression plasmids of the invention is the plasmid hcgbmet156-2 6n in E. coli strain which was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, on May 4, 1993 as Accession No.
69296.
According to another aspect of the invention, host cells including procaryotic and eucaryotic cells, are stably transformed with DNA sequences of the invention in a manner allowing the desired polypeptides to be expressed therein. Host cells expressing cGB-PDE products can serve a variety of useful purposes. Such cells constitute a valuable source of immunogen for the development of antibody substances specifically imrnunoreactive with cGB-PDE. Host cells of the invention are conspicuously useful in methods for the large scale production of cGB-PDE
polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.
cGB-PDE products may be obtained as isolates from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. cGB-PDE products of the invention may be full length polypeptides, fragments or variants. Variants may comprise cGB-PDE polypeptide analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added:

21410~~
(1) without loss of one or more of the biological activities or immunological characteristics specific for cGB-PDE; or (2) with specific disablement of a particular biological activity of cGB-PDE.
Also comprehended by the present invention are antibody substances (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins specific for cGB-PDE. Specific binding proteins can be developed using isolated or recombinant cGB-PDE or cGB-PDE variants or cells expressing such products.
Binding proteins are useful, in turn, in compositions for immunization as well as for purifying cGB-PDE polypeptides and detection or quantification of cGB-PDE
polypeptides in fluid and tissue samples by known immunogical procedures. They are also manifestly useful in modulating (i.e., blocking, inhibiting or stimulating) biochemical activities of cGB-PDE, especially those activities involved in signal transduction. Anti-idiotypic antibodies specific for anti-cGB-PDE antibody substances are also contemplated.
The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest.
As one series of examples, knowledge of the sequence of a cDNA for cGB-PDE
makes possible the isolation by DNAIDNA hybridization of genomic DNA sequences encoding cGB-PDE and specifying cGB-PDE expression control regulatory sequences such as promoters, operators and the like. DNAIDNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of cGB-PDE, other structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to cGB-PDE, and non-human species proteins homologous to cGB-PDE. Polynucleotides of the invention when suitably labelled are useful in hybridization assays to detect the capacity of cells to synthesize cGB-PDE. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alterations) in the cGB-PDE locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of cGB-PDE by those cells which ordinarily express the same.

_7_ The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of cGB-PDE and definition of those molecules with which it will interact. Agents that modulate cGB-PDE activity may be identified by incubating a putative modulator with lysate from eucaryotic cells expressing recombinant cGB-PDE and determining the effect of the putative modulator on cGB-PDE phosphodiesterase activity. In a preferred embodiment the eucaryotic cell lacks endogenous cyclic nucleotide phosphodiesterase activity. Specifically illustrating such a eucaryotic cell is the yeast strain YKS45 which was deposited with the ATCC on May 19, 1993 as Accession No. 74225. The selectivity of a compound that modulates the activity of the cGB-PDE can be evaluated by comparing its activity on the cGB-PDE to its activity on other PDE isozymes. The combination of the recombinant cGB-PDE products of the invention with other recombinant PDE products in a series of independent assays provides a system for developing selective modulators of cGB-PDE.
Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to the cGB-PDE or cGB-PDE nucleic acid, oligonucleotides which specifically bind to the cGB-PDE or cG8-PDE
nucleicy acid and other non-peptide compounds (e.g., isloated or synthetic organic molecules) which specifically react with cGB-PDE or cGB-PDE nucleic acid. Mutant forms of cGB-PDE which affect the enzymatic activity or cellular localization of the wild-type cGB-PDE are also contemplated by the invention. Presently preferred targets for the development of selective modulators include, for example: (1) the regions of the cGB-PDE which contact other proteins andlor localize the cGB-PDE within a cell, (2) the regions of the cGB-PDE which bind substrate, (3) the allosteric cGMP-binding sites) of cGB-PDE, (4) the phosphorylation sites) of cGB-PDE and (S) the regions of the cGB-PDE which are involved in dimerization of cGB-PDE subunits.
Modulators of cGB-PDE activity may be therapeutically useful in treatment of a wide range of diseases and physiological conditions.

WO 94128144 ~ ~ 4 ~ 0 6 Q PCT/US94106066 _g_ BRIEF DESCRIPTION OF THE DRAWINGS
Numerous other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description thereof, reference being made to the drawing wherein:
FIGURE lA to 1C is an alignment of the conserved catalytic domains of several PDE isoenzymes wherein residues which are identical in all PDEs listed are indicated by their one letter amino acid abbreviation in the "conserved"
line, residues which are identical in the cGB-PDE and photoreceptor PDEs only are indicated by a star in the "conserved" line and gaps introduced for optimum alignment are indicated by periods;
FIGURE 2A to 2C is an alignment of the cGMP-binding domains of several PDE isoenzymes wherein residues which are identical in all PDEs listed are indicated by their one letter amino acid abbreviation in the "conserved" line and gaps introduced for optimum alignment are indicated by periods;
FIGURE 3 is an alignment of internally homologous repeats from several PDE isoenzymes wherein residues identical in each repeat ~ and _B from all cGMP-binding PDEs listed are indicated by their one letter amino acid abbreviation in the "conserved" line and stars in the "conserved" line represent positions in which all residues are chemically conserved;
FIGURE 4 schematically depicts the domain organization of cGB-PDE;
FIGURE 5 is a bar graph representing the results of experiments in which extracts of COS cells transfected with bovine cGB-PDE sequences or extracts of untransfected COS cells were assayed for phosphodiesterase activity using either 20 ~eM cGMP or 20 ~cM cAMP as the substrate;
FIGURE 6 is a graph depicting results of assays of extracts from cells transfected with bovine cGB-PDE sequences for cGMP phosphodiesterase activity in the presence of a series of concentrations of phosphodiesterase inhibitors including dypyridamole (closed squares), zaprinast (closed circles), methoxymethylxanthine (closed triangles) and rolipram (open circles);
FIGURE 7 is a bar graph presenting results of experiments in which cell extracts from COS cells transfected with bovine cGB-PDE sequences or control 2~4 ~oso untransfected COS cells were assayed for ['H]cGMP-binding activity in the absence (-) or presence (+) of 0.2mM 3-isobutyl-1-methylaxanthine (IBMX); and Figure 8 is a graph of the results of assays in which extracts from cells transfected with bovine cGB-PDE
sequences were assayed for ['H]cGMP-binding activity in the presence of excess unlabelled cAMP (open circles) or cGMP
(closed circles) at the concentrations indicated.
DETAILED DESCRIPTION
The following examples illust rate the invention.
Example 1 describes the isolation of a bovine cGH-PDE cDNA
fragment by PCR and subsequent isolation of a full length cGH-PDE cDNA using the PCR fragment as a probe. Example 2 presents an analysis of the relationship of the bovine cGH-PDE
amino acid sequence to sequences reported for various other PDEs. Northern blot analysis of cGH-PDE mRNA in various bovine tissues is presented in Example 3. Expression of the bovine cGB-PDE cDNA in COS cells is described in Example 4.
Example 5 presents results of assays of the cGB-PDE COS cell expression product for phosphodiesterase activity, cGMP-binding activity and Zn~' hydrolase activity. Example 6 describes the isolation of human cDNAs homologous to the bovine cGB-PDE cDNA. The expression of a human cGB-PDE cDNA
in yeast cells is presented in Example 7. RNase protection assays to detect cGB-PDE in human tissues are described in Example 8. Example 9 describes the bacterial expression of human cGB-PDE cDNA and the development of antibodies reactive with the bacterial cGB-PDE expression product. Example 10 describes cGB-PDE analogs and fragments. The generation of monoclonal antibodies that recognize cGB-PDE is described in Example 11. Example 12 relates to utilizing recombinant cGH-PDE products of the invention to develop agents that selectively modulate the biological activities of cGB-PDE.
Example 1 The polymerise chain reaction (PCR) was utilized to isolate a cDNA fragment encoding a portion of cGB-PDE from bovine lung first strand cDNA. Fully degenerate sense and - g _ 2~4~oso antisense PCR primers were designed based on the partial cGB-PDE amino acid sequence described in Thomas I, supra, and novel partial amino acid sequence information.
A. Purification of cGB-PDE Protein cGB-PDE was purified as described in Thomas I, supra, or by a modification of that method as described below.
Fresh bovine lungs (5-10 kg) were obtained from a slaughterhouse and immediately placed on ice. The tissue was ground and combined with cold PEM buffer (20mM sodium phosphate, pH 6.8, containing 2mM EDTA and 25 mM p-mercaptoethanol). After homogenization and centrifugation, the resulting supernatant was incubated with 4-7 liters of DEAE-cellulose* (Whatman, UK) for 3-4 hours. The DEAE slurry was then filtered under vacuum and rinsed with multiple volumes of cold PEM. The resin was poured into a glass column and washed with three to four volumes of PEM. The protein was eluted with 100mM NaCl in PEM and twelve 1-liter fractions were collected. Fractions were assayed for IBMX-stimulated cGMP binding cGMP phosphodiesterase activities by standard procedures described in Thomas et al., supra. Appropriate fractions were pooled, diluted 2-fold with cold, deionized water and subjected to Blue Sepharose CL-6B (Pharmacia LKB
Biotechnology Inc., Piscataway, NJ) chromatography. Zinc chelate affinity adsorbent chromatography was then performed using either an agarose or Sepharose-based gel matrix. The resulting protein pool from the zinc chelation step treated as described in the Thomas I, supra, or was subjected to a modified purification procedure.
As described in Thomas I, supra, the protein pool was applied in multiple loads to an HPLC Hio-Sil TSK-545* DEAE
column (150 x 21.5 mm) (BioRad Laboratories, Hercules, CA) equilibrated in PEM at 4°C. After an equilibration period, a 120-ml wash of 50mM NaCI in PEM was followed by a 120-ml linear gradient (50-200mM NaCl in PEM) elution at a flow rate of 2 ml/minute. Appropriate fractions were pooled and concentrated in dialysis tubing against Sephadex G-200*
(Boehringer Mannheim Hiochemicals, UK) to a final volume of *Trade-mark -~ 2141060 1.5 ml. The concentrated cGH-PDE pool was applied to an HPLC
gel filtration column (Bio-Sil TSK-250*, 500 x 21.5 mm) equilibrated in 100mM sodium phosphate, pH 6.8, 2mM EDTA, 25 mM J3-mercaptoethanol and eluted with a flow rate of 2 ml/minute at 4°C.
If the modified, less cumbersome procedure was performed, the protein pool was dialyzed against PEM for 2 hours and loaded onto a 10 ml preparative DEAE Sephacel*
column (Pharmacia) equilibrated in PEM buffer. The protein was eluted batchwise with 0.5M NaCl in PEM, resulting in an approximately 10-15 fold concentration of protein. The concentrated protein sample was loaded onto an 800 ml (2.5 cm x 154 cm) Sephacryl 5400* gel filtration column (Boehringer) equilibrated in O.1M NaCl in PEM, and eluted at a flow rate of 1.7 ml/minute.
The purity of the protein was assessed by Coomassie staining after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Approximately 0.5-3.0 mg of pure cGB-PDE were obtained per 10 kg bovine lung.
Rabbit polyclonal antibodies specific for the purified bovine cG8-PDE were generated by standard procedures.
B. Amino Acid Seguencing of cGB-PDE
cGB-PDE phosphorylated with ['zP]ATP and was then digested with protease to yield '~P-labelled phosphopeptides.
Approximately 100 ~g of purified cGB-PDE was phosphorylated in a reaction mixture containing 9mM MgClz, 9~rM ['zP]ATP, lOUM
cGMP, and 4.2 ug purified bovine catalytic subunit of cAMP-dependent protein kinase (cAK) in a final volume of 900 ul.
Catalytic subunit of cAK was prepared according to the method of Flockhart et al., pp. 209-215 in Marangos et al., Hrejn Receptor Methodologies, Part A, Academic Press, Orlando, Florida (1984). The reaction was incubated for 30 minutes at 30°C, and stopped by addition of 60 ul of 200mM EDTA.
To obtain a first peptide sequence form cGB-PDE, 3.7 ul of a 1 mg/ml solution of a a-chymotrypsin in KPE buffer (lOmM potassium phosphate, pH 6.8, with 2mM EDTA) was added to 100 ug purified, phosphorylated cGB-PDE and the mixture was *Trade-mark incubated for 30 minutes at 30°C. Proteolysis was stopped by addition of 50 ul of 10~ SDS and 25 ul of /3-mercaptoethanol.
The sample was boiled until the volume was reduced to less than 400 ~1, and was loaded onto an 8$ preparative SDS-polyacrylamide gel and subjected to electrophoresis at 50mAmps. The separated digestion products were electroblotted onto Immobilon polyvinylidene difluoride (Millipore, Bedford, MA), according to the method of Matsudaira, J. Blol. Chem, 262: 10035-10038 (1987). Transferred protein was identified by Coomassie Blue - lla -staining, and a 50 kDa band was excised from the membrane for automated gas-phase amino acid sequencing. The sequence of the peptide obtained by the a-chymotryptic digestion procedure is set out below as SEQ ID NO: 1.
SEQ ID NO: 1 REXDANRINYMYAQYVKNTM
A second sequence was obtained from a cGB-PDE peptide fragment generated by V8 proteolysis. Approximately 200 ~cg of purified cGB-PDE was added to lOmM MgCl2, lO~cM [3~P]ATP, 100~cM cGMP, and 1 ~cg/ml purified catalytic subunit of cAK in a final volume of 1.4 ml. The reaction was incubated for 30 minutes at 30' C, and was terminated by the addition of 160 ~cl of 0.2M EDTA.
Next, 9 ~cl of 1 mg/ml Staphylococcal aureus V8 protease (International Chemical Nuclear Biomedicals, Costa Mesa, CA) diluted in KPE was added, followed by a minute incubation at 30' C. Proteolysis was stopped by addition of 88 gel of 10 °~ SDS
and 45 ~,1 ~B-mercaptoethanol. The digestion products were separated by electrophoresis on a preparative 10 % SDS-polyacrylamide gel run at 25 mAmps for 4.5 hours. Proteins were electroblotted and stained as described above. A 28 kDa protein band was excised from the membrane and subjected to automated gas-phase amino acid sequencing. The sequence obtained is set out below as SEQ ID NO: 2.
SEQ ID NO: 2 QSLAAA V VP
C. CR~Ampliftcation of Bovine cDNA
The partial amino acid sequences utilized to design primers (SEQ ID
NO: 3, below, and amino acids 9-20 of SEQ ID NO: 1) and the sequences of the corresponding PCR primers (in IUPAC nomenclature) are set below wherein SEQ ID
NO: 3 is the sequence reported in Thomas I, supra.
SEQ ID NO: 3 F D N D E G E Q

5' GAY AAY GAY GAR GGN GAR CA (SEQ ID NO:
TTY 3' 4) 3' CTR TTR CTR CTY CCN CTY GT (SEQ ID NO:
AAR 5' 5) SEQ ID NO: 1, Amino acids 9-20 N Y M Y A Q Y V K N T M
5' AAY TAY ATG TAY GCN CAR TAY GT 3' (SEQ ID NO: 6) 3' TTR ATR TAC ATR CGN GTY ATR CA 5' (SEQ ID NO: 7) 3' TTR ATR TAC ATR CGN GTY ATR CAN TTY TTR TGN TAC 5' (SEQ ID NO: 8) The sense and antisense primers, synthesized using an Applied Biosystems Model 380A DNA Synthesizer (Foster City, CA), were used in all possible combinations to amplify cGB-PDE-specific sequences from bovine lung first strand cDNA as described below.
After ethanol precipitation, pairs of oligonucleotides were combined (SEQ ID NO: 4 or 5 combined with SEQ ID NOs: 6, 7 or 8) at 400nM each in a PCR reaction.
The reaction was run using 50 ng first strand bovine lung cDNA
(generated using AMV reverse transcriptase and random primers on oligo dT selected bovine lung mRNA), 200uM dNTPs, and 2 units of Taq polymerase. The initial denaturation step was carried out at 94°C for 5 minutes, followed by 30 cycles of a 1 minute denaturation step at 94°C, a two minute annealing step at 50°C, and a 2 minute extension step at 72°C. PCR was performed using a Hybaid* Thermal Reactor (ENK Scientific Products, Saratoga, CA) and products were separated by gel electrophoresis on a 1% low melting point agarose gel run in 40mM Tris-acetate, 2mM EDTA. A weak band of about 800-840 by was seen with the primers set out in SEQ ID NOs: 4 and 7 and with primers set out in SEQ ID NOs: 4 and 8. None of the other primer pairs yielded visible bands. The PCR product generated by amplification with the primers set out in SEQ ID
NOs: 4 and 7 was isolated using the Gene Clean* (Bio101, La Jolla, CA) DNA purification kit according to the manufacturer's protocol. The PCR product (20 ng) was ligated into 200 ng of linearized pBluescript KS(+) (Stratagene, La Jolla, CA), and the resulting plasmid construct was used to transform E. colj XL1 Blue cells (Stratagene Cloning Systems, La Jolla, CA). Putative transformation positives were screened by sequencing. The sequences obtained were not *Trade-mark homologous to any known PDE sequence or to the known partial cGB-PDE sequences.
PCR was performed again on bovine lung first strand cDNA using the primers set out in SEQ ID NOs: 4 and 7. A
clone containing a 0.8 Kb insert with a single large open reading frame was identified. The open reading frame encoded a polypeptide that included the amino acids KNTM (amino acids 17-20 of SEQ ID NO: 1 which were not utilized to design the primer sequence which is set out in SEQ ID NO: 7) and that possessed a high degree of homology to the deduced amino acid sequences of the cGs-, ROS- and COS-PDEs. The clone identified corresponds to nucleotides 489-1312 of SEQ ID NO:
9.
D. Construction and Hybridization Screening of a Bovine cDNA Library In order to obtain a cDNA encoding a full-length cGB-PDE, a bovine lung cDNA library was screened using the '1P-labelled PCR-generated cDNA insert as a probe.
Polyadenylated RNA was prepared from bovine lung as described Sonnenburg et al., J. B~ol, Chem, 266: 17655-17661 (1991). First strand cDNA was synthesized using AMV* reverse transcriptase (Life Sciences, St. Petersburg, FL) with random hexanucleotide primers as described in Ausubel et al., Current Protocols jn Molecular Biology, John Wiley & Sons, New York (1987). Second strand cDNA was synthesized using E. colt DNA
polymerise I in the present of E. cola DNA lipase and E, cola RNAse H. Selection of cDNAs larger than 500 by was performed by Sepharose* CL-4B (Millipore) chromatography. EcoRI
adaptors (Promega, Madison, WI) were ligated to the cDNA using T4 DNA lipase. Following heat inactivation of the lipase, the cDNA was phosphorylated using T4 polynucleotide kinase.
Unligated adaptors were removed by Sepharose* CL-4B
chromatography (Pharmacia, Piscataway, NJ). The cDNA was ligated into EcoRI-digested, dephosphorylated lambda Zap* II
arms (Stratagene) and packaged with Gigapack* Gold (Stratagene) extracts according to the manufacturer's protocol. The titer of the unamplified library was 9.9 x 105 *Trade-mark 2~4~oso with 185 nonrecombinants. The library was amplified by plating 50,000 plaque forming units (pfu) on to twenty 150 mm plates, result ing in a f anal t iter of 5 . 95 x 106 pfu/ml with 21$ nonrecombinants.
The library was plated on twenty-four 150 mm plates at 50,000 pfu/plate, and screened with the " P-labelled cDNA
clone. The probe was prepared - 14a -:.'-, 64267-798 ~ WO 94/28144 21 4 1 0 6 0 PCTIUS94106066 using the method of Feinberg et al., Anal. Biochem., 137: 266-267 (1984), and the 32p-labelled DNA was purified using Elutip-D~ columns (Schleicher and Schuell Inc., Keene, NH) using the manufacturer's protocol. Plaque-lifts were performed using 15 cm nitrocellulose filters. Following denaturation and neutralization, DNA
was fixed onto the filters by baking at 80' C for 2 hours. Hybridization was carried out at 42' C overnight in a solution containing 50 % formamide, SX SSC (0.75M
NaCI, 0.75M sodium citrate, pH 7), 25mM sodium phosphate (pH 7.0), 2X Denhardt's solution, 10% dextran sulfate, 90 ~.glml yeast tRNA, and approximately 106 cpm/ml 3xp_labelled probe (SxlOg cpm/~cg). The filters were washed twice in O.1X SSC, 0.1 % SDS at room temperature for 15 minutes per wash, followed by a single 20 minute wash in O.1X SSC, 1 % SDS at 45'C. The filters were then exposed to X-ray film at -70' C for several days.
Plaques that hybridized with the labelled probe were purified by several rounds of replating and rescreening. Insert cDNAs were subcloned into the pBluescript SK(-) vector (Stratagene) by the in vivo excision method described by the manufacturer's protocol. Southern blots were performed in order to verify that the rescued cDNA hybridized to the PCR probe. Putative cGB-PDE cDNAs were sequenced using Sequenase~ Version 2.0 (United States Biochemical Corporation, Cleveland, Ohio) or TaqTrack~ kits (Promega).
Three distinct cDNA clones designated cGB-2, cGB-8 and cGB-10 were isolated. The DNA and deduced amino acid sequences of clone cGB-8 are set out in SEQ ID NOs: 9 and 10. The DNA sequence downstream of nucleotide 2686 may represent a cloning artifact. The DNA sequence of cGB-10 is identical to the sequence of cGB-8 with the exception of one nucleotide. The DNA sequence of clone cGB-2 diverges from that of clone cGB-$ 5' to nucleotide 219 of clone cgb-8 (see SEQ ID NO: 9) and could encode a protein with a different amino terminus.
The cGB-8 cDNA clone is 4474 by in length and contains a large open reading frame of 2625 bp. The triplet ATG at position 99-101 in the nucleotide sequence is predicted to be the translation initiation site of the cGB-PDE
gene because it is preceded by an in-frame stop colon and the surrounding bases are compatible with the Kozak consensus initiation site for eucaryotic mRNAs. The stop colon TAG
is located at positions 2724-2726, and is followed by 1748 by of 3' untranslated g p PCT/US94106066 sequence. The sequence of cGB-8 does not contain a transcription termination consensus sequence, therefore the clone may not represent the entire 3' untranslated region of the corresponding mRNA.
The open reading frame of the cGB-8 cDNA encodes an 875 amino acid polypeptide with a calculated molecular mass of 99.5 kD. This calculated molecular mass is only slightly larger than the reported molecular mass of purified cGB-PDE, estimated by SDS-PAGE analysis to be approximately 93 kDa. The deduced amino acid sequence of cGB-8 corresponded exactly to all peptide sequences obtained from purified bovine lung cGB-PDE providing strong evidence that cGB-encodes cGB-PDE.
Example 2 A search of the SWISS-PROT and GEnEmbl data banks (Release of February, 1992) conducted using the FASTA program supplied with the Genetics Computer Group (GCG) Software Package (Madison, Wisconsin) revealed that only DNA and amino acid sequences reported for other PDEs displayed significant similarity to the DNA and deduced amino acid of clone cGB-8.
Pairwise comparisons of the cGB-PDE deduced amino acid sequence with the sequences of eight other PDEs were conducted using the ALIGN [Dayhoff et al. , Methods Eruymol. , 92: 524-545 (1983)] and BESTFIT [Wilbur et al. , Proc.
Nail. Acad. Sci. USA, 80: 726-730 (1983)) programs. Like all mammalian phosphodiesterases sequenced to date, cGB-PDE contains a conserved catalytic domain sequence of approximately 250 amino acids in the carboxyl-terminal half of the protein that is thought to be essential for catalytic activity. This segment comprises amino acids 578-812 of SEQ ID NO: 9 and exhibits sequence conservation with the corresponding regions of other PDEs. Table 1 below sets out the specific identity values obtained in pairwise comparisons of other PDEs with amino acids 578-812 of cGB-PDE, wherein "ratdunce" is the rat cAMP-specific PDE; "61 kCaM" is the bovine 61 kDa calcium/calmodulin-dependent PDE; "63 kCaM" is the bovine 63 kDa calcium/calmodulin-dependent PDE; "drosdunce" is the drosophila cAMP-specific dunce PDE; "ROS-a" is the bovine ROS-PDE a-subunit; "ROS-~" is the WO 94128144 21 4 1 0 6 0 PCTIUS94l06066 bovine ROS-PDE ~i-subunit; "COS-a"' is the bovine COS-PDE a' subunit; and "cGs"
is the bovine cGs-PDE (612-844).
Table 1 Phos~hodiesterase Ca~l~rtic Domain Residuesa I a 't Ratdunce 77-316 31 61 kCaM 193-422 29 63 kcam 195-424 29 drosdunce 1-239 28 ROS-a 535-778 45 ROS-~ 533-776 46 COS-a' 533-776 48 cGs 612-844 40 Multiple sequence alignments were performed using the Progressive Alignment Algorithm [Feng et al., Methods Enrymol., 183: 375-387 (1990)]
implemented in the PILEUP program (GCG Software). FIGURE lA to 1C shows a multiple sequence alignment of the proposed catalytic domain of cGB-PDE with the all the corresponding regions of the PDEs of Table 1. Twenty-eight residues (see residues indicated by one letter amino acid abbreviations in the "conserved"
line on FIGURE lA to 1C) are invariant among the isoenzymes including several conserved histidine residues predicted to play a functional role in catalysis. See Charbonneau et al. , Proc. Natl. Acad. Sci. USA, supra. The catalytic domain of cGB-PDE
more closely resembles the catalytic domains of the ROS-PDEs and COS-PDEs than the corresponding regions of other PDE isoenzymes. There are several conserved regions among the photoreceptor PDEs and cGB-PDE that are not shared by other PDEs.
Amino acid positions in these regions that are invariant in the photoreceptor PDE and cGB-PDE sequences are indicated by stars in the "conserved" line of FIGURE lA
to 1 C. Regions of homology among cGB-PDE and the ROS- and COS-PDEs may serve important roles in conferring specificity for cGMP hydrolysis relative to cAMP
hydrolysis or for sensitivity to specific pharmacological agents.

WO 94128144 ~ 4 ~ 0 6 4 PCTIUS94106066 Sequence similarity between cGB-PDE, cGs-PDE and the photoreceptor PDEs, is not limited to the conserved catalytic domain but also includes the noncatalytic cGMP binding domain in the amino-terminal half of the protein.
Optimization of the alignment between cGB-PDE, cGs-PDE and the photoreceptor PDEs indicates that an amino-terminal conserved segment may exist including amino acids 142-526 of SEQ ID NO: 9. Pairwise analysis of the sequence of the proposed cGMP-binding domain of cGB-PDE with the corresponding regions of the photoreceptor PDEs and cGs-PDE revealed 26-28 % sequence identity. Multiple sequence alignment of the proposed cGMP-binding domains with the cGMP-binding PDEs is shown in FIGURE 2A to 2C wherein abbreviations are the same as indicated for Table 1. Thirty-eight positions in this non-catalytic domain appear to be invariant among all cGMP-binding PDEs (see positions indicated by one letter amino acid abbreviations in the "conserved" line of FIGURE 2A to 2C).
The cGMP-binding domain of the cGMP-binding PDEs contains internally homologous repeats which may form two similar but distinct inter-or intra-subunit cGMP-binding sites. FIGURE 3 shows a multiple sequence alignment of the repeats ~ (corresponding to amino acids 228-311 of cGB-PDE) and ~
(corresponding to amino acids 410-S00 of cGB-PDE) of the cGMP-binding PDEs. Seven residues are invariant in each _A and B regions (see residues indicated by one letter amino acid abbreviations in the "conserved" line of FIGURE 3). Residues that are chemically conserved in the A and B regions are indicated by stars in the "conserved"
line of FIGURE 3. cGMP analog studies of cGB-PDE support the existence of a hydrogen bond between the cyclic nucleotide binding site on cGB-PDE and the 2'OH of cGMP.
Three regions of cGB-PDE have no significant sequence similarity to other PDE isoenzymes. These regions include the sequence flanking the carboxyl-terminal end of the catalytic domain (amino acids 812-875), the sequence separating the cGMP-binding and catalytic domains (amino acids 527-577) and the amino-terminal sequence spanning amino acids 1-141. The site (the serine at position 92 of SEQ ID NO: 10) of phosphorylation of cGB-PDE by cGK is located in this amino-terminal region of sequence. Binding of cGMP to the allosteric site on cGB-PDE
is required for its phosphorylation.

A proposed domain structure of cGB-PDE based on the foregoing comparisons with other PDE isoenzymes is presented in FIGURE 4. This domain structure is supported by the biochemical studies of cGB-PDE purified from bovine lung.
Example 3 The presence of cGB-PDE mRNA in various bovine tissues was examined by Northern blot hybridization.
Polyadenylated RNA was purified from total RNA preparations using the Poly(A) Quiclc~ mRNA purification kit (Stratagene) according to the manufacturer's protocol. RNA samples (5 ~cg) were loaded onto a 1.2 % agarose, 6.7 % formaldehyde gel. Electrophoresis and RNA transfer were performed as previously described in Sonnenburg et al., supra. Prehybridization of the RNA
blot was carried out for 4 hours at 45' C in a solution containing 50 % formamide, SX
SSC, 25mM sodium phosphate, pH 7, 2X Denhardt's solution, 10% dextran sulfate, and 0.1 mg/ml yeast tRNA. A random hexanucleotide-primer-labelled probe (5 X
10a cpm/~cg) was prepared as described in Feinberg et al. , supra, using the 4.7 kb cGB-8 cDNA clone of Example 2 excised by digestion with AccI and SacII. The probe was heat denatured and injected into a blotting bag (6 X 105 cpmlml) following prehybridization. The Northern blot was hybridized overnight at 45' C, followed by one 15 minute wash with 2X SSC, 0.1 % SDS at room temperature, and three 20 minute washes with O.1X SSC, 0.1 % SDS at 45' C. The blot was exposed to X-ray film for 24 hours at -70' C. The size of the RNA that hybridized with the cGB-PDE
probe was estimated using a 0.24-9.5 kb RNA ladder that was stained with ethidium bromide and visualized with UV light.
The 32P-labelled cGB-PDE cDNA hybridized to a single 6.8 kb bovine lung RNA species. A mRNA band of the identical size was also detected in polyadenylated RNA isolated from bovine trachea, aorta, kidney and spleen.
Example 4 The cGB-PDE cDNA in clone cGB-8 of Example 2 was expressed in COS-7 cells (ATCC CRL1651).

,...

A portion of the cGB-8 cDNA was isolated following digestion with the rest riction enzyme XbaI. XbaI cut at a position in the pBluescript polylinker sequence located 30 by upstream of the 5' end of the cGB-8 insert and at position 3359 within the cG8-8 insert. The resulting 3389 by fragment, which contains the entire coding region of cGB-8, was then ligated into the unique XbaI cloning site of the expression vector pCDMB (Invitrogen, San Diego, CA). The pCDM8 plasmid is a 4.5 kb eucaryotic expression vector containing a cytomegalovirus promoter and enhancer, an SV40-derived origin of replication, a polyandenylation signal, a procaryotic origin of replication (derived from pBR322) and a procaryotic genetic marker (supF). E. colj MC1061/P3 cells (Invitrogen) were transformed with the resulting ligation products, and transformation positive colonies were screened for proper orientation of the cGB-8 insert using PCR and restriction enzyme analysis. The resulting expression construct containing the cGB-8 insert in the proper orientation is referred to a pCDMB-cGH-PDE.
The pCDMB-cGB-PDE DNA was purified from large-scale plasmid preparations using Qiagen pack-500* columns (Chatsworth, CA) according to the manufacturer's protocol.
COS-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10~ fetal bovine serum, 50 ug/ml penicillin and 50 ~g/ml streptomycin at 37°C in a humidified 5~ CO~ atmosphere. Approximately 24 hours prior to transfection, confluent 100 mm dishes of cells were replated at one-fourth or one-fifth the original density. In a typical transfection experiment, cells were washed with buffer containing 137mM NaCl, 2.7mM KC1, l.lmM potassium phosphate, and 8.lmM sodium phosphate, pH 7.2 (PBS). The 4-5 ml of DMEM
containing 10~ NuSerum* (Collaborative Biomedical Products, Bedford, MA) was added to each plate. Transfection with 10 ug pCDM8-cGB-PDE DNA or pCDM8 vector DNA mixed with 400 ug DEAE-dextran* (Pharmacia) in 60 ~1 TBS [Tris-buffered salines 25mM
Tris-HC1 (pH 7.4), 137mM NaCl, 5mM KC1, 0.6mM NaZHPO,, 0.7mM

*Trade-mark 21410fi0 CaClt, and 0.5mM MgClz] was carried out by dropwise addition of the mixture to each plate. The cells were incubated at 37°C, 5~ CO~ for 4 hours, and then treated with 10~ dimethyl sulfoxide in PBS for 1 minute. After 2 minutes, the dimethyl sulfoxide was removed, the cells were washed with PHS and incubated in complete medium. After 48 hours, cells were suspended in 0.5-1 ml of cold - 20a -WO 94/28144 21 4 1 0 6 0 PCTlUS94106066 ,...

homogenization buffer [40mM Tris-HCl (pH 7.5), lSmM benzamidine, lSmM (3-mercaptoethanol, 0.7 ~cg/ml pepstatin A, 0.5 ~.g/ml leupeptin, and 5~M EDTA]
per plate of cells, and disrupted using a Dounce homogenizer. The resulting whole-cell extracts were assayed for phosphodiesterase activity, cGMP-binding activity, and total protein concentration as described below in Example 5.
Example 5 Phosphodiesterase activity in extracts of the transfected COS cells of Example 4 or in extracts of mock transfected COS cells was measured using a modification of the assay procedure described for the cGs-PDE in Martins et al., J.
Biol. Chem., 257: 1973-1979 (1982). Cells were harvested and extracts prepared hours after transfection. Incubation mixtures contained 40mM MOPS buffer (pH

7), 0.8mM EDTA, lSmM magnesium acetate, 2 mg/ml bovine serum albumin, 20~M
[3H]cGMP or [3H]cAMP (100,000-200,000 cprn/assay) and COS-7 cell extract in a total volume of 250 ~.1. The reaction mixture was incubated for 10 minutes at 30' C, and then stopped by boiling. Next, 10 ~cl of lOmg/ml Crotalus atrox venom (Sigma) was added followed by a 10 minute incubation at 30' C. Nucleoside products were separated from unreacted nucleotides as described in Martins et al. , supra.
In all studies, less than 15 % of the total [~H]cyclic nucleotide was hydrolyzed during the reaction.
The results of the assays are presented in FIGURE 5 wherein the results shown are averages of three separate transfections. Transfection of cells with pCDMB-cGB-PDE DNA resulted in the expression of approximately 15-fold higher levels of cGMP phosphodiesterase activity than in mock-transfected cells or in cells transfected with pCDM8 vector alone. No increase in cAMP
phosphodiesterase activity over mock or vector-only transfected cells was detected in extracts from cells transfected with pCDM8-cGB-PDE DNA. These results confirm that the cGB-PDE bovine cDNA encodes a cGMP-specific phosphodiesterase.
Extracts from the transfected COS cells of Example 4 were also assayed for cGMP PDE activity in the presence of a series of concentrations of the PDE inhibitors zaprinast, dipyridamole (Sigma), isobutyl-1-methyl-8-methoxymethylxanthine (MeOxMeMIX) and rolipram.

The results of the assays are presented in FIGURE 6 wherein PDE activity in the absence of inhibitor is taken as 100 and each data point represents the average of two separate determinations. The relative potencies of PDE
inhibitors for inhibition of cGMP hydrolysis by the expressed cGB-PDE cDNA protein product were identical to those relative potencies reported for native cGB-PDE purified from bovine lung (Thomas I, supra). ICSO values calculated from the curves in FIGURE 6 are as follows: zaprinast (closed circles), 2 uMi dipyridamole (closed squares), 3.5 uMi MeOxMeMIX (closed triangles), 30 uM; and rolipram (open circles), >300 uM. The ICSp value of zaprinast, a relatively specific inhibitor of cGMP-specific phasphodiesterases, was at least two orders of magnitude lower than that reported for inhibition of phosphodiesterase activity of the cGs-PDE or of the cGMP-inhibited phosphodiesterase (cGi-PDEs) (Reeves et al., pp.
300-316 in Beavo et al., supra). Dipyrimadole, an effective inhibitor of selected CAMP-and cGMP-specific phosphodiesterases, was also a potent inhibitor of the expressed cGH-PDE. The relatively selective inhibitor of calcium/calmodulin-stimulated phosphodiesterase (CaM-PDEs), MeOxMeMiX, was approximately 10-fold less potent than zaprinast and dipyridamole, in agreement with results using cGH-PDE activity purified from bovine lung. Rolipram, a potent inhibitor of low K, CAMP phosphodiesterases, was a poor inhibitor of expressed cGH-PDE cDNA protein product. These results show that the cGH-PDE cDNA encodes a phosphodiesterase that possesses catalytic activity characteristic of cGB-PDE
isolated from bovine tissue, thus verifying the ldentity of the cGH-8 cDNA clone as a cGB-PDE.
It is of interest to note that although the relative potencies of the PDE inhibitors for inhibition of cGMP
hydrolysis were ldentical for the recombinant and bovine isolate cGB-PDE, the absolute ICSp values for all inhibitors tested were 2-7 fold higher for the recombinant cGH-PDE. This difference could not be attributed to the effects of any factors present in COS-7 cell extracts on cGMP hydrolytic 2141~fi0 activity, since cGB-PDE isolated from bovine tissue exhibited identical kinetics of inhibition as a pure enzyme, or when added back to extracts of mock-transfected COS-7 cells. This apparent difference in pharmacological sensitivity may be due to a subtle difference in the structure of the recombinant cGB-PDE cDNA protein product and bovine lung cGB-PDE, such as a difference in post-translational - 22a -~"~ _ .. _.

modification at or near the catalytic site. Alternatively, this difference may be due to an alteration of the catalytic activity of bovine lung cGB-PDE over several purification steps.
Cell extracts were assayed for [3H]cGMP-binding activity in the absence or presence of 0.2mM 3-isobutyl-1-methylaxanthine (IBMX) (Sigma), a competitive inhibitor of cGMP hydrolysis. The cGMP binding assay, modified from the assay described in Thomas I, supra, was conducted in a total volume of 80 ~cl.
Sixty ~cl of cell extract was combined with 20 ~cl of a binding cocktail such that the final concentration of components of the mixture were 1~,M ~H]cGMP, S~,M cAMP, and 10~M 8-bromo-cGMP. The cAMP and 8-bromo-cGMP were added to block [3H]cGMP binding to cAK and cGK, respectively. Assays were carried out in the absence and presence of 0.2mM IBMX. The reaction was initiated by the addition of the cell extract, and was incubated for 60 minutes at 0' C. Filtration of the reaction mixtures was carried out as described in Thomas I, supra. Blanks were determined by parallel incubations with homogenization buffer replacing cell extracts, or with a 100-fold excess of unlabelled cGMP. Similar results were obtained with both methods. Total protein concentration of the cell extracts was determined by the method of Bradford, Anal. Biochem., 72:248-254 (1976) using bovine serum albumin as the standard.
Results of the assay are set out in FIGURE 7. When measured at l~cM
[3H]cGMP in the presence of 0.2mM IBMX, extracts from COS-7 cells transfected with pCDMB-cGB-PDE exhibited 8-fold higher cGMP-binding activity than extracts from mock-transfected cells. No IBMX stimulation of background cGMP binding was observed suggesting that little or no endogenous cGB-PDE was present in the COS-7 cell extracts. In extracts of pCDMB-cGB-PDE transfected calls cGMP-specific activity was stimulated approximately 1.8-fold by the addition of 0.2mM
IBMX. The ability of IBMX to stimulate cGMP binding 2-5 fold is a distinctive property of the cGMP-binding phosphodisterases.
Cell extracts were assayed as described above for [~H]cGMP-binding activity (wherein concentration of [3H]cGMP was 2.S~cM) in the presence of excess unlabelled cAMP or cGMP. Results are presented in FIGURE 8 wherein cGMP
binding in the absence of unlabelled competitor was taken as 100 and each data WO 94128144 ~ 4 ~ ~ ~ ~ PCT/US94/06066 point represents the average of three separate determinations. The binding activity of the protein product encoded by the cGB-PDE cDNA was specific for cGMP
relative to cAMP. Less than 10-fold higher concentrations of unlabelled cGMP
were required to inhibit [3H]cGMP binding activity by 50% whereas approximately 100-fold higher concentrations of cAMP were required for the same degree of inhibition.
The results presented in this example show that the cGB-PDE cDNA
encodes a phosphodiesterase which possesses biochemical activities characteristic of native cGB-PDE.
The catalytic domains of mammalian PDEs and a Drosophila PDE
contain two tandem conserved sequences (HX3HX~,-Z6E) that are typical Zn2+-binding motifs in Zn2+ hydrolases such as thermolysin [Valley and Auld, Biocltem. , 29: 5647-5659 (1990)]. cGB-PDE binds Zn2+ in the presence of large excesses of Mgz+, Mn2+, Fe2+, Fe3+, Ca2+ or Cd2+. In the absence of added metal, cGB-PDE has a PDE activity that is approximately 20 % of the maximum activity that occurs in the presence of 40 mM Mg2+, and this basal activity is inhibited by 1,10-phenanthroline or EDTA. This suggests that a trace metals) accounts for the basal PDE
activity despite exhaustive treatments to remove metals. PDE activity is stimulated by addition of Zn2+ (0.02-1 ~cM) or Coz+ (1-20 ~cM), but not by Fe2+, Fe3+, Ca2+, Cdz+, or Cuz+. Zn2+ increases the basal PDE activity up to 70% of the maximum stimulation produced by 40mM Mg2+. The stimulatory effect of Zn2+ in these assays may be compromised by an inhibitory effect that is caused by Zn2+
concentrations > 1 ~,M. The Zn2+-supported PDE activity and Zn2+ binding by cGB-PDE occur at similar concentrations of Zn2+. cGB-PDE thus appears to be a Zn2+ hydrolase and Zn2+ appears to play a critical role in the activity of the enzyme. See, Colbran et al. , The FASEB J. , 8: Abstract 2148 (March 15, 1994).
Example 6 Several human cDNA clones, homologous to the bovine cDNA clone encoding cGB-PDE, were isolated by hybridization under stringent conditions using a nucleic acid probe corresponding to a portion of the bovine cGB-8 clone (nucleotides 489-1312 of SEQ ID NO: 9).

2~4~oso Isolation of cDNA Fragments Encoding Human cGB-PDE
Three human cDNA libraries (two glioblastoma and one lung) in the vector lambda Zap were probed with the bovine cGB-PDE sequence. The PCR-generated clone corresponding to nucleotides 484-1312 of SEQ ID NO: 9 which is described in Example 1 was digested with EcoRI and SalI and the resulting 0.8 kb cDNA insert was isolated and purified by agarose gel electrophoresis. The fragment was labelled with radioactive nucleotides using a-random primed DNA labelling kit (Boehringer).
The cDNA libraries were plated on 150 mm petri plates at a density of approximately 50,000 plaques per plate.
Duplicate mitrocellulose filter replicas were prepared. The prehybridization buffer was 3X SSC, 0.1~ sarkosyl*, lOX
Denhardt's, 20mM sodium phosphate (pH 6.8) and 50 ~g/ml salmon testes DNA. Prehybridization was carried out at 65°C for a minimum of 30 minutes. Hybridization was carried out at 65°C
overnight in buffer of the same composition with the addition of 1-5x105 cpm/ml of probe. The filters were washed at 65°C in 2X SSC, 0.1% SDS. Hybridizing plaques were detected by autoradiography. The number of cDNAs that hybridized to the bovine probe and the number of cDNAs screened are indicated in Table 2 below.
Table 2 cDNA Library Type Positive Plagues Plagues Screened Human SW 1088 dT-primed 1 1.5x106 glioblastoma Human lung dT-primed 2 1.5x106 Human SW 1088 dT-primed 4 1.5x106 glioblastoma Plasmids designated cgbS2.l, cgbS3.l, cgbL23.1, cgbL27.1 and cgbS27.1 were excised in vjvo from the lambda Zap clones and sequenced.
Clone cgbS3.1 contains 2060 by of a PDE open reading frame followed by a putative intron. Analysis of clone cgbS2.1 reveals that it corresponds to clone *Trade-mark A , WO 94!28144 21 4 1 ~ 6 o PCTlUS94106066 cgbS3.1 positions 664 to 2060 and extends the PDE open reading frame an additional 585 by before reading into a putative intron. The sequences of the putative 5' untranslated region and the protein encoding portions of the cgbS2.1 and cgbS3.1 clones are set out in SEQ ID NOs: 11 and 12, respectively. Combining the two cDNAs yields a sequence containing approximately 2.7 kb of an open reading encoding a PDE. The three other cDNAs did not extend any further 5' or 3' than cDNA cgbS3.1 or cDNA cgbS2.l.
To isolate additional cDNAs, probes specific for the 5' end of clone cgbS3.1 and the 3' end of clone cgbS2.1 were prepared and used to screen a glioblastoma cDNA library and a human aorta cDNA library. A 5' probe was derived from clone cgbS3.1 by PCR using the primers cgbS3.1S311 and cgbL23.1A1286 whose sequences are set out in SEQ ID NOs: 8 and 9, respectively, and below.
Primer cgbS3.1S311 (SEQ ID NO: 13) 5' GCCACCAGAGAAATGGTC 3' Primer cgbL23.1A1286 (SEQ ID NO: 14) 5' ACAATGGGTCTAAGAGGC 3' The PCR reaction was carried out in a 50 ul reaction volume containing 50 pg cgbS3.1 cDNA, 0.2mM dNTP, 10 ug/ml each primer, 50 mM KCI, lOmM Tris-HCl pH 8.2, 1.SmM MgCl2 and Taq polymerase. After an initial four minute denaturation at 94' C, 30 cycles of one minute at 94' C, two minutes at 50' C and four minutes at 72' C were carried out. An approximately 0.2 kb fragment was generated by the PCR reaction which corresponded to nucleotides 300-496 of clone cgbS3.l.
A 3' probe was derived from cDNA cgbS2.1 by PCR using the oligos cgbL23.1S1190 and cgbS2.1A231 whose sequences are set out below.
Primer cgbL23.1 S 1190 (SEQ ID NO: 15) 5' TCAGTGCATGTTTGCTGC 3' Primer cgbS2.1A231 (SEQ ID NO: 16) 5' TACAAACATGTTCATCAG 3' The PCR reaction as carried out similarly to that described above for generating the 5' probe, and yielded a fragment of approximately 0.8kb corresponding to nucleotides WO 94128144 21 4 1 0 fi 0 . ~. ~ _ _ .

1358-2139 of cDNA cgbS2.l. The 3' 157 nucleotides of the PCR fragment (not shown in SEQ ID NO: 12) are within the presumptive intron.
The two PCR fragments were purified and isolated by agarose gel electrophoresis, and were labelled with radioactive nucleotides by random priming.
A random-primed SW1088 glioblastorna cDNA library (1.5x106 plaques) was screened with the labelled fragments as described above, and 19 hybridizing plaques were isolated. An additional 50 hybridizing plaques were isolated from a human aorta cDNA library (dT and random primed, Clontech, Palo Alto, CA).
Plasmids were excised in vivo from some of the positive lambda Zap clones and sequenced. A clone designated cgbS53.2, the sequence of which is set out in SEQ ID NO: 17, contains an approximately 1.1 kb insert whose sequence overlaps the last 61 by of cgbS3.1 and extends the open reading frame an additional 135 by beyond that found in cgbS2.l. The clone contains a termination colon and approximately 0.3 kB of putative 3' untranslated sequence.
Generation of a Composite cDNA Encoding Human cGB-PDE
Clones cgbS3.l, cgbS2.1 and cgbS53.2 were used as described in the following paragraphs to build a composite cDNA that contained a complete human cGB-PDE opening reading frame. The composite cDNA is designated cgbmet156-2 and was inserted in the yeast ADH1 expression vector pBNY6N.
First, a plasmid designated cgb stop-2 was generated that contained the 3' end of the cGB-PDE open reading frame. A portion of the insert of the plasmid was generated by PCR using clone cgbS53.2 as a template. The PCR primers utilized were cgbS2.1S1700 and cgbstop-2.
Primer cgbS2.1S1700 (SEQ ID NO: 18) 5' TTTGGAAGATCCTCATCA 3' Primer cgbstop-2 (SEQ ID NO: 19) 5' ATGTCTCGAGTCAGTTCCGCTTGGCCTG 3' The PCR reaction was carried out in SO ul containing 50 pg template DNA, 0.2mM
dNTPs, 20mM Tris-HCl pH 8.2, lOmM KC1, 6mM (NH,)2S04, l.SmM MgCl2, 0.1 % Triton-X-100, 500ng each primer and 0.5 units of Pfu polymerase (Stratagene).
The reaction was heated to 94' C for 4 minutes and then 30 cycles of 1 minute at 94' C, 2 minutes at 50' C and four minutes at 72' C were performed. The polymerase WO 94/28144 ~ ~~ (t 1 O ~ o i PCTIUS94106066 was added during the first cycle at 50' C. The resulting PCR product was phenol/chloroform extracted, chloroform extracted, ethanol precipitated and cut with the restriction enzymes BcII and XhoI. The restriction fragment was purified on an agarose gel and eluted.
This fragment was ligated to the cDNA cgbS2.1 that had been grown in dam' E. coli, cut with the restriction enzymes BcII and JfOwI, and gel-purified using the Promega magic PCR kit. The resulting plasmid was sequenced to verify that cgbstop-2 contains the 3' portion of the cGB-PDE open reading frame.
Second, a plasmid carrying the 5' end of the human cGB-PDE open reading frame was generated. Its insert was generated by PCR using clone cgbS3.1 as a template. PCR was performed as described above using primers cgbmet156 and cgbS2.1A2150.
Primer cgbmet156 (SEQ ID NO: 20) 5' TACAGAATTCTGACCATGGAGCGGGCCGGC 3' Primer cgbS2.1A2150 (SEQ ID NO: 21) 5' CATTCTAAGCGGATACAG 3' The resulting PCR fragment was phenollcholoform extracted, choloform extracted, ethanol precipitated and purified on a Sepharose CL-6B column. The fragment was cut with the restriction enzymes EcoRV and EcoRI, run on an agarose gel and purified by spinning through glass wool. Following phenol/chloroform extraction, chloroform extraction and ethanol precipitation, the fragment was ligated into EcoRIlEcoRV digested BluescriptII SK(+) to generate plasmid cgbmet156. The DNA sequence of the insert and junctions was determined. The insert contains a new EcoRI site and an additional 5 nucleotides that together replace the original nucleotides 5' of the initiation codon. The insert extends to an EcoRV site beginning 531 nucleotides from the initiation codon.
The 5' and 3' portions of the cGB-PDE open reading frame were then assembled in vector pBNY6a. The vector pBNY6a was cut with EcoRI and XycoI, isolated from a gel and combined with the agarose gel purified EcoRIIEcoRV
fragment from cgbmet156 and the agarose gel purified EcoRVlXhoI fragment from cgbstop-2. The junctions of the insert were sequenced and the construct was named hcbgmet156-2 6a.

V~ WO 94/28144 21 4 1 0 6 0 PCTIUS94106066 The cGB-PDE insert from hcbgmet156-2 6a was then moved into the expression vector pBNY6n. Expression of DNA inserted in this vector is directed from the yeast ADH1 promoter and terminator. The vector contains the yeast 2 micron origin of replication, the pUC 19 origin of replication and an ampicillan resistance gene. Vector pBNY6n was cut with EcoRI and XhoI and gel-purified.
The EcoRI/XhoI insert from hcgbmet156-2 6a was gel purified using Promega magic PCR
columns and ligated into the cut pBNY6n. All new junctions in the resulting construct, hcgbmet156-2 6n, were sequenced. The DNA and deduced amino acid sequences of the insert of hcgbmet156-2 6n which encodes a composite human cGB-PDE is set out in SEQ ID NOs: 22 and 23. The insert extends from the first methionine in clone cgbS3.1 (nucleotide 156) to the stop codon (nucleotide 2781) in the composite cDNA. Because the methionine is the most 5' methionine in clone cgbS3.1 and because there are no stop codons in frame with the methionine and upstream of it, the insert in pBNY6n may represent a truncated form of the open reading frame.
Variant cDNAs Four human cGB-PDE cDNAs that are different from the hcgbmet156-2 6n composite cDNA have been isolated. One cDNA, cgbL23.1, is missing an internal region of hcgbmet156-2 6n (nucleotides 997-1000 to 1444-1447). The exact end points of the deletion cannot be determined from the cDNA sequence at those positions. Three of the four variant cDNAs have 5' end sequences that diverge from the hcgbmet156-2 6n sequence upstream of nucleotide 151 (cDNAs cgbA7f, cgbASC, cgbI2). These cDNAs presumably represent alteratively spliced or unspliced mRNAs.
Example 7 The composite human cGB-PDE cDNA construct, hcgbmet156-2 6n, was transformed into the yeast strain YKS45 (ATCC 74225) (MATa his3 trpl ura3 leu3 pdel::HIS3 pde2::TRP1) in which two endogenous PDE genes are deleted.
Transformants complementing the leu deficiency of the YKS45 strain were selected and assayed for cGB-PDE activity. Extracts from cells bearing the plasmid hcgbmet156-2 6n were determined to display cyclic GMP-specific phosphodiesterase activity by the assay described below.

One liter of YKS45 cells transformed with the plasmid cgbmet156-2 6n and grown in SC-leu medium to a density of 1-2x10' cells/ml was harvested by centrifugation, washed once with deionized water, frozen in dry ice/ethanol and stored at -70°C. Cell pellets (1-1.5 ml) were thawed on ice in the presence of an equal volume of 25mM Tris-C1 (pH

8.0)/5mM EDTA/5mM EGTA/1mM o-phenanthroline/0.5mM 4-(2-aminoethyl) benzenesulfonylfluoride (AEBSF) (Calbiochem)/0.1~
(3-mercaptoethanol and 10 ug/ml each of aprotinin, leupeptin, and pepstatin A. The thawed cells were added to 2 ml of acid-washed glass beads (425-600uM, Sigma) in 15 ml Corex tube.
Cells were broken with 4 cycles consisting of a 30 second vortexing on setting 1 followed by a 60 second incubation on ice. The cell lysate was centrifuged at 12,000 x g for 10 minutes and the supernatant was passed through a 0.8 a filter. The supernatant was assayed for cGMP
PDE activity as follows. Samples were incubated for 20 minutes at 30°C in the presence of 45mM Tris-C1 (pH 8.0), 2mM
EGTA, 1mM EDTA, 0.2mg/ml BSA, 5mM MgCl~, 0.2mM o-phenanthroline, 2ug/ml each of pepstatin A, leupeptin, and aprotinin, O.lmM AEBSF, 0.02$ (3-mercaptoethanol and O.lmM
('H]cGMP as substrate. ["C]-AMP (0.5 nCi/assay) was added as a recovery standard. The reaction was terminated with stop buffer (0.1M ethanolamine pH 9.0, 0.5M ammonium sulfate, lOmM
EDTA, 0.055 SDS final concentration). The product was separated from the cyclic nucleotide substrate by chromatography on BioRad Affi-Gel 601*. The sample was applied to a column containing approximately 0.25 ml of Affi-Gel 601 equilibrated in column buffer (O.1M ethanolamine pH

9.0 containing 0.5M ammonium sulfate). The column was washed five times with 0.5 ml of column buffer. The product was eluted with four 0.5 ml aliquots of 0.25 acetic acid and mixed with 5 ml Ecolume* (ICN Biochemicals). The radioactive product was measured by scintillation counting.
Example 8 Analysis of expression of cGB-PDE mRNA in human tissues was carried out by RNase protection assay.

*Trade-mark 2~4~oso A probe corresponding to a portion of the putative cGMP binding domain of cGB-PDE (402 by corresponding to nucleotides 1450 through 1851 of SEQ ID NO: 13) was generated by PCR. The PCR fragment was inserted into the EcoRI site of the plasmid pBSII SK(-) to generate the plasmid RP3. RP3 plasmid DNA was linearized with XbeI and antisense probes were generated by a modification of the Stratagene T7 RNA
polymerase kit. Twenty-five ng of linearized plasmid was combined with 20 microcuries of alpha 'zP rUTP (800 Ci/mmol, 10 mCi/ml), 1X transcription buffer (40mM TrisCl, pH 8, 8mM
MgCl2, 2mM spermidine, 50mM NaCl), 0.25mM each rATP, rGTP and rCTP, 0.1 units of RNase Hlock II, 5mM DTT, 8uM rUTP and 5 units of T7 RNA Polymerase in a total volume of 5 ul. The reaction was allowed to proceed 1 hour at room temperature and then the DNA template was removed by digestion with RNase free DNase. The reaction was diluted into 100 ul of 40mM TrisCl, pH 8, 6mM MgCl2 and lOmM NaCl. Five units of RNase-free DNase were added and the reaction was allowed to continue another minutes at 37°C. The reaction was stopped by a phenol extraction followed by a phenol chloroform extraction. One half volume of 7.5M NH,OAc was added and the probe was ethanol precipitated.
The RNase protection assays were carried out using the Ambion RNase Protection* kit (Austin, TX) and 10 ug RNA
isolated from human tissues by an acid guanidinium extraction method. Expression of cGB-PDE mRNA was easily detected in RNA
extracted from skeletal muscle, uterus, bronchus, skin, right saphenous vein, aorta and SW1088 glioblastoma cells. Barely detectable expression was found in RNA extracted from right atrium, right ventricle, kidney cortex, and kidney medulla.
Only complete protection of the RP3 probe was seen. The lack of partial protection argues against the cDNA cgbL23.1 (a variant cDNA described in Example 7) representing a major transcript, at least in these RNA samples.
Example 9 Polyclonal antisera was raised E. col.i-produced fragments of the human cGB-PDE.

*Trade-mark . s_ i 2141060_ A portion of the human cGB-PDE cDNA (nucleotides 1668-2612 of SEQ ID NO: 22, amino acids 515-819 of SEQ ID NO:
23) was amplified by PCR and inserted into the E. colt expression vector pGEX2T (Pharmacia) as a BamHIlEcoRI
fragment. The pGEX2T plasmid carries an ampicillin resistance gene, an E. cola laq I° gene and a port ion of the Sch.istosoma jeponlcum glutathione-S-- 31a -2~4~p60 transferase (GST) gene. DNA inserted in the plasmid can be expressed as a fusion protein with GST and can then be cleaved from the GST portion of the protein with thrombin. The resulting plasmid, designated cgbPE3, was transformed into E.
coli strain LE392 (Stratagene). Transformed cells were grown at 37' C to an OD600 of 0.6. IPTG (isopropylthioalactopyranoside) was added to O.lmM and the cells were grown at 37' C for an additional 2 hours. The cells were collected by centrifugation and lysed by sonication. Cell debris was removed by centrifugation and the supernatant was fractionated by SDS-PAGE. The gel was stained with cold 0.4M
KCl and the GST-cgb fusion protein band was excised and electroeluted. The PDE
portion of the protein was separated from the GST portion by digestion with thrombin. The digest was fractionated by SDS-PAGE, the PDE protein was electroeluted and injected subcutaneously into a rabbit. The resultant antisera recognizes both the bovine cGB-PDE fragment that was utilized as antigen and the full length human cGB-PDE protein expressed in yeast (see Example 8).
ample 10 Polynucleotides encoding various cGB-PDE analogs and cGB-PDE
fragments were generated by standard methods.
A. cGB-PDE Analogs All known cGMP-binding PDEs contain two internally homologous tandem repeats within their putative cGMP-binding domains. In the bovine cGB-PDE
of the invention, the repeats span at least residues 228-311 (repeat A~ and (repeat ~ of SEQ ID NO: 10. Site-directed mutagenesis of an aspartic acid that is conserved in repeats A and B of all known cGMP-binding PDEs was used to create analogs of cGB-PDE having either Asp-289 replaced with Ala (D289A) or Asp-478 replaced with Ala (D478A). Recombinant wild type (WT) bovine and mutant bovine cGB-PDEs were expressed in COS-7 cells. cGB-PDE purified from bovine lung (native cGB-PDE) and WT cGB-PDE displayed identical cGMP-binding kinetics with a ICa of approximately 2 ~,M and a curvilinear dissociation profile (t,,~ =
1.3 hours at 4'C). This curvilinearity may have been due to the presence of distinct high affinity (slow) and low affinity (fast) sites of cGMP binding. The D289A mutant had significantly decreased affinity for cGMP (Kd > 20~cM) and a single rate of cGMP-WO 94128144 PCTlUS94106066 -- 21410fi0 association (t,h = 0.5 hours), that was similar to that calculated for the fast site of WT and native cGB-PDE. This suggested the loss of a slow cGMP-binding site in repeat A of this mutant. Conversely, the D478A mutant showed higher affinity for cGMP (Kd of approximately 0.5 ~cM) and a single cGMP-dissociation rate (t,~ =
2.8 hours) that was similar to the calculated rate of the slow site of WT and native cGB-PDE. This suggested the loss of a fast site when repeat B was modified. These results indicate that dimeric cGB-PDE possesses two homologous but kinetically distinct cGMP-binding sites, with the conserved aspartic acid being critical for interaction with cGMP at each site. See, Colbran et al., FASEB J., 8: Abstract (May 15, 1994).
B. Amino-Terminak Truncated cGB-PDE Polyp t~_s A truncated human cGB-PDE polypeptide including amino acids 516-875 of SEQ ID NO: 23 was expressed in yeast. A cDNA insert extending from the NcoI site at nuckeotide 1555 of SEQ ID NO: 22 through the XhoI site at the 3' end of SEQ ID NO: 22 was inserted into the ADH2 yeast expression vector YEpC-PADH2d [Price et al. , Meth. Enzymol. , 185: 308-318 ( 1990)] that had been digested with NcoI and SaII to generate pkasmid YEpC-PADH2d HcGB. The plasmid was transformed into spheropkasts of the yeast strain yBJ2-54 (prcl-407 prbl-1122 pep4-3 keu2 trpl ura3-52 ~pdel::UktA3, HIS3 Opde2::TktP1 cir'). The endogenous PDE
genes are deleted in this strain. Cells were grown in SC-leu media with 2 ~
glucose to 10' celks/ml, collected by filtration and grown 24 hours in YEP media containing 3 % glycerol. Celks were pelketed by centrifugation and stored frozen. Cells were disrupted with glass beads and the cell homogenate was assayed for phosphodiesterase activity essentially as described in Prpic et al., Anal. Biochem., 208: 155-160 (1993).
The truncated human cGB-PDE pokypeptide exhibited phosphodiesterase activity.
C. Carboxy_Terminal Truncated cGB-PDE Polyp~ptides Two different pkasmids encoding carboxy-terminak truncated human cGB-PDE polypeptides were constructed.
Pkasmid pBJ6-84Hin contains a cDNA encoding amino acids 1-494 of SEQ ID NO: 23 inserted into the NcoI and SaII sites of vector YEpC-PADH2d. The cDNA insert extends from the NcoI site at nucleotide position 10 of SEQ ID NO:

2~ 41060 through the HindIII site at nucleotide position 1494 of SEQ ID
NO: 22 followed by a linker and the SalI site of YEpC-PADH2d.
Plasmid pHJ6-84Ban contains a cDNA encoding amino acids 1-549 of SEQ ID NO: 23 inserted into the NcoI and SalI
sites of vector YEpC-PADH2d. The cDNA insert extends from the NcoI site a nucleotide position 10 of SEQ ID NO: 22 through the HanI site at nucleotide position 1657 of SEQ ID NO: 22 followed by a linker and the SalI site of YEpC-PADH2d.
The trucated cGB-PDE polypeptides are useful for screening for modulators of cGH-PDE activity.
Example 11 Monoclonal antibodies reactive with human cGB-PDE
were generated.
Yeast yBJ2-54 containing the plasmid YEpADH2 HIGH
(Example 10B) were fermented in a New Brunswick Scientific 10 liter Microferm*. The cGB-PDE cDNA insert in plasmid YEpADH2 HcGB extends from the NcoI site at nucleotide 12 of SEQ ID NO:
22 to the XhoI site at the 3' end of SEQ ID NO: 22. An inoculum of 4 x 10' cells was added to 8 liters of media containing SC-leu, 5~ glucose, trace metals, and trace vitamins. Fermentation was maintained at 26°C, agitated at 600 rpm with the standard microbial impeller, and aerated with compressed air at 10 volumes per minute. When glucose decreased to 0.3~ at 24 hours post-inoculation the culture was infused with 2 liters of 5X YEP media containing 155 glycerol.
At 66 hours post-inoculation the yeast from the ferment was harvested by centrifugation at 4,000 x g for 30 minutes at 4°C. Total yield of biomass from this fermentation approached 350 g wet weight.
Human cGH-PDE enzyme was purified from the yeast cell pellet. Assays for PDE activity using 1 mM cGMP as substrate was employed to follow the chromatography of the enzyme. AlI chromatographic manipulations were performed at 4°C.
Yeast (29g wet weight) were resuspended in 70m1 of buffer A (25mM Tris pH 8.0, 0.25mM DTT, 5mM MgClz, lOUM ZnSO', 1mM benzamidine) and lysed by passing through a microfluidizer *Trade-mark A.

at 22-24,000 psi. The lysate was centrifuged at 10,000 x g for 30 minutes and the supernatant was applied to a 2.6 x - 34a -28 cm column containing Pharmacia Fast Flow Q* anion exchange resin equilibrated with buffer H containing 20mM BisTris-propane pH 6.8, 0.25mM DTT, 1mM MgCl2, and lOUM ZnSO,. The column was washed with 5 column volumes of buffer B containing 0.125M NaCl and then developed with a linear gradient from 0.125 to 1.OM NaCl. Fractions containing the enzyme were pooled and applied directly to a 5 x 20 cm column of ceramic hydroxyapatite (BioRad) equilibrated in buffer C containing 20mM BisTris-propane pH 6.8, 0.25mM DTT, 0.25 MKCl, 1mM MgCl2, and lOUM ZnSO,. The column was washed with 5 column volumes of buffer C and eluted with a linear gradient from 0 to 250mM
potassium phosphate in buffer C. The pooled enzyme was concent rated 8-fold by ult raf i It rat ion ( YM30* membrane, Amicon). The concent rated enzyme was chromatographed on a 2.6 x 90 cm column of Pharmacia Sephacryl S300* (Piscataway, NJ) equilibrated in 25mM HisTris-propane pH 6.8, 0.25mM DTT, 0.25M NaCl, 1mM MgCI2, and 20uM ZnSO,. Approximately 4 mg of protein was obtained. The recombinant human cGB-PDE enzyme accounted for approximately 90$ of protein obtained as judged by SDS polyacrylamide gel electrophoresis followed by Coomassie blue staining.
The purified protein was used as an antigen to raise monoclonal antibodies. Each of 19 week old Balb/c mice (Charles River Biotechnical Services, Inc., Wilmington, Mass.) was immunized sub-cutaneously with 50 ug purified human cGH-PDE enzyme in a 200 ul emulsion consisting of 50~ Freund's complete adjuvant (Sigma Chemical Co.). Subsequent boots on day 20 and day 43 were administered in incomplete Freund's adjuvant. A pre-fusion boost was done on day 86 using 50 erg enzyme in PBS. The fusion was performed on day 90.
The spleen from mouse #1817 was removed sterilely and placed in lOml serum free RPMI 1640. A single-cell suspension was formed and filtered through sterile 70-mesh Nitex cell stainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI. Thymocytes taken from 3 naive Halb/c mice were prepared in a similar *Trade-mark y 64267-798 ,~ ':~

21410fi0 manner.
NS-1 myeloma cells, kept in log phase in RPMI with 11% Fetalclone* (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in - 35a -*Trade-mark WO 94128144 21 4 1 0 fi d pCTIUS94106066 the foregoing paragraph. After washing, each cell suspension was brought to a final volume of 10 ml in serum free RPMI, and 20 ~1 was diluted 1:50 in 1 ml serum free RPMI. 20 ~.l of each dilution was removed, mixed with 20 x,10.4 % trypan blue stain in 0. 85 % saline (Gibco), loaded onto a hemocytometer (Baxter Healthcare Corp. , Deerfield, Illinois ) and counted.
Two x 10a spleen cells were combined with 4.0 x 10' NS-1 cells, centrifuged and the supernatant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37' C PEG 1500 (50 % in 75 mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI
containing % FBS, 100 ~M sodium hypoxanthine, 0.4 ~eM aminopterin, 16 ~M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5 x 106 15 thymocyteslml. The suspension was first placed in a T225 flask (Corning, United Kingdom) at 37' C for two hours before being dispensed into ten 96-well flat bottom tissue culture plates (Corning, United Kingdom) at 200 ~cl/well. Cells in plates were fed on days 3, 4, 5 post fusion day by aspirating approximately 100 ~,1 from each well with an 20 G needle (Becton Dickinson), and adding 100 ~cl/well plating medium described above except containing 10 units/ml IL-6 and lacking thymocytes.
The fusion was screened initially by ELISA. Immulon 4 plates (Dynatech) were coated at 4' C overnight with purified recombinant human cGB-PDE
enzyme (100ng/well in SOmM carbonate buffer pH9.6). The plates were washed 3X
with PBS containing 0.05 % Tween 20 (PBST). The supernatants from the individual hybridoma wells were added to the enzyme coated wells (50 ~,l/well). After incubation at 37' C for 30 minutes, and washing as above, 50 ~cl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pennsylvania) diluted 1:3500 in PBST was added. Plates were incubated as above, washed 4X with PBST and 100 ~cl substrate consisting of 1 mg/ml o-phenylene diamine (Sigma) and 0.1 ~cll ml 30 % H20z in 100 mM citrate, pH 4.5, was added.
The color reaction was stopped in 5 minutes with the addition of 50 gel of 15 %
HZSO4. A4~ was read on a plate reader (Dynatech).

WO 94128144 21 4 10 fi 0 _ PCTILTS9410G066 Wells CSG, E4D, F1G, F9H, F11G, J4A, and JSD were picked and renamed 102A, 102B, 102C, 102D, 102E, 102F, and 1026 respectively, cloned two or three times, successively, by doubling dilution in RPMI, 15 ~'o FBS, 100~M
sodium hypoxanathine, l6~cM thymidine, and 10 units/ml IL-6. Wells of clone plates were scored visually after 4 days and the number of colonies in the least dense wells were recorded. Selected wells of the each cloning were tested by ELISA.
The monoclonal antibodies produced by above hybridomas were isotyped in an ELISA assay. Results showed that monoclonal antibodies 102A to 102E were IgGl, 102F was IgG2b and 1026 was IgG2a.
All seven monoclonal antibodies reacted with human cGS-PDE as determined by Western analysis.
Developing modulators of the biological activities of specific PDEs requires differentiating PDE isozymes present in a particular assay preparation. The classical enzymological approach of isolating PDEs from natural tissue sources and studying each new isozyme is hampered by the limits of purification techniques and the inability to definitively assess whether complete resolution of a isozyme has been achieved. Another approach has been to identify assay conditions which might favor the contribution of one isozyme and minimize the contribution of others in a preparation. Still another approach has been the separation of PDEs by immunological means. Each of the foregoing approaches for differentiating PDE
isozymes is time consuming and technically difficult. As a result many attempts to develop selective PDE modulators have been performed with preparations containing more than one isozyme. Moreover, PDE preparations from natural tissue sources are susceptible to limited proteolysis and may contain mixtures of active proteolytic products that have different kinetic, regulatory and physiological properties than the full length PDEs.
Recombinant cGB-PDE polypeptide products of the invention greatly facilitate the development of new and specific cGB-PDE modulators. The use of human recombinant enzymes for screening for modulators has many inherent advantages. The need for purification of an isozyme can be avoided by expressing WO 94128144 ~ 4 ~ ~ ~ ~ PCTIUS94106066 it recombinantly in a host cell that lacks endogenous phosphodiesterase activity (e.g., yeast strain YKS45 deposited as ATCC 74225). Screening compounds against human protein avoids complications that often arise from screening against non-human protein where a compound optimized on a non-human protein may fail to be specific for or react with the human protein. For example, a single amino acid difference between the human and rodent SHT,H serotonin receptors accounts for the difference in binding of a compound to the receptors. [See Oskenberg et al., Nancre, 360:

163 (1992)]. Once a compound that modulates the activity of the cGB-PDE is discovered, its selectivity can be evaluated by comparing its activity on the cGB-PDE
to its activity on other PDE isozymes. Thus, the combination of the recombinant cGB-PDE products of the invention with other recombinant PDE products in a series of independent assays provides a system for developing selective modulators of cGB-PDE. Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to the cGB-PDE or cGB-PDE nucleic acid, oligonucleotides which specifically bind to the cGB-PDE (see Patent Cooperation Treaty International Publication No. W093/05182 published March 18, 1993 which describes methods for selecting oligonucleotides which selectively bind to target biomolecules) or cGB-PDE nucleic acid (e.g., antisense oligonucleotides) and other non-peptide natural or synthetic compounds which specifically bind to the cGB-PDE
or cGB-PDE nucleic acid. Mutant forms of the cGB-PDE which alter the enzymatic activity of the cGB-PDE or its localization in a cell are also contemplated.
Crystallization of recombinant cGB-PDE alone and bound to a modulator, analysis of atomic structure by X-ray crystallography, and computer modelling of those structures are methods useful for designing and optimizing non-peptide selective modulators. See, for example, Erickson et al. , Ann. Rep. Med. Chem. , 27.' (1992) for a general review of structure-based drug design.
Targets for the development of selective modulators include, for example: (1) the regions of the cGB-PDE which contact other proteins and/or localize the cGB-PDE within a cell, (2) the regions of the cGB-PDE which bind substrate, (3) the allosteric cGMP-binding sites) of cGB-PDE, (4) the metal-binding regions of the cGB-PDE, (5) the phosphorylation sites) of cGB-PDE and (6) the regions of the cGB-PDE which are involved in dimerization of cGB-PDE subunits.

'i 0 6 0 _._ While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

WO 94/28144 2 ~ 4 10 6 ~ -PCT/US94106066 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: The Board of Regents of the University of Washington (ii) TITLE OF INVENTION: Cyclic GMP-Binding, Cyclic GMP-Specific Phosphodiesterase Materials and Methods (iii) NUMBER OF SEQUENCES: 23 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Marshall, O'Toole, Gerstein, Murray &
Borun (B) STREET: 6300 Sears Tower, 233 S. blacker Drive (C) CITY: Chicago (D) STATE: Illinois (E) COUNTRY: USA
(F) ZIP: 60606 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/068,051 (B) FILING DATE: 27-MAY-1993 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Noland, Greta E.
(8) REGISTRATION NUMBER: 35,302 (C) REFERENCE/DOCRET NUMBER: 32083 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (312) 474-6300 (B) TELEFAX: (312) 474-0448 (C) TELEX: 25-3856 (2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 2141060 __ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Arg Glu Xaa Asp Ala Asn Arg Ile Asn Tyr Met Tyr Ala Gln Tyr Val Lye Asn Thr Met (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (8) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Gln Ser Leu Ala Ala Ala Val Val Pro (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Phe Asp Asn Asp Glu Gly Glu Gln (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(iv) ANTI-SENSE: YES

WO 94/28144 21 4 1 ~ 6 ~ PCT/US94/06066 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

(2) INFORMATION FOR SEQ ID N0:6 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6 (2) INFORMATION FOR SEQ ID N0:7 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7 (2) INFORMATION FOR SEQ ID N0:8 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8 (2) INFORMATION FOR SEQ ID N0:9 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4474 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

' CA 02141060 2001-03-29 (ix)FEATURE:

(A) CDS
NAME/KEY:

(B) 99..2723 LOCATION:

(xi)SEQUENCE EQ
DESCRIPTION: ID
S N0:9 CGAGGCGAGT GAGTGGAAAA
TCTGCTCCTC

CTGACCGCAG ATG
AGACACGCCG GAG
AGG
GCC
GGC

Met Glu Arg Ala Gly ProGly CysArgAla AlaAla ThrAlaMetGly ProGlyLeu GlyArg SerVal AlaGlyArg SerLeu GlyLeuTyrLeu LeuTyrPhe ValArg LysGly ThrArgGlu MetVal AsnAlaTrpPhe AlaGluArg ValHis ThrIle ProValCys LysGlu GlyIleLysGly HisThrGlu SerCys SerCys ProLeuGln ProSer ProArgAlaGlu SerSerVal ProGly ThrPro ThrArgLys IleSer AlaSerGluPhe AspArgPro LeuArg ProIle ValIleLys AspSer GluGlyThrVal SerPheLeu SerAsp SerAsp LysLysGlu GlnMet ProLeuThrSer ProArgPhe AspAsn AspGlu GlyAspGln CysSer ArgLeuLeuGlu LeuValLys AspIle SerSer HisLeuAsp ValThr AlaLeuCysHis LysIlePhe LeuHis IleHis GlyLeuIle SerAla AspArgTyrSer LeuPheLeu ValCys GluAsp SerSerAsn AspLys PheLeuIleSer ArgLeuPhe AspVal AlaGlu GlySerThr LeuGlu GluAlaSerAsn AsnCysIle ArgLeu GluTrpAsnLys GlyIleVal GlyHisVal AlaAlaPheGly GluPro LeuAsnIleLys AspAlaTyr GluAspPro ArgPheAsnAla GluVal AspGlnIleThr GlyTyrLys ThrGlnSer IleLeuCysMet ProIle LysAsnHisArg GluGluVal ValGlyVal AlaGlnAlaIle AsnLys AAATCAGGAAAT GGTGGGACA TTCACTGAA AP.AGACGAAAAG GACTTT 977 LysSerGlyAsn GlyGlyThr PheThrGlu LysAspGluLys AspPhe GCTGCTTACTTG GCA TGT GvAATTGTTCTT CATAATGCT CAACTC 1025 TTT

AlaAlaTyrLeu AlaPheCys GlyI1_ValLeu HisAsnAla GlnLeu TyrGluThrSer LeuLeuGlu AsnLysArgAsn GlnValLeu LeuAsp LeuAlaSerLeu IlePheGlu GluGlnGlnSer LeuGluVal IleLeu ArgLysIleAla AlaThrIle IleSerProMet GlnValGln LysCys ThrIlePheIle ValAspGlu AspCysSerAsp SerPheSer SerVal TTTCACATGGAG TGTGAGGAA TTAGAAAAP.TCG TCAGATACT TTAACA 1265 PheHisMetGlu CysGluGlu LeuGluLysSer SerAspThr LeuThr ArgGluArgAsp AlaThrArg IleAsnTyrMet TyrAlaGln TyrVal LysAsnThrMet GluProLeu AsnIl~aProAsp ValSerLys AspLys ArgPheProTrp ThzAsnGlu AsnMetGlyAsn IleAsnGln GlnCys IleArgSerLeu LeuCysThr ProIleLysAsn GlyLysLys AsnLys ValIleGlyVal CysGlnLeu ValAsnLysMet GluGluThr ThrGly ",,~ WO 94128144 21 4 1 0 6 ~ ''~ PCT/US94106066 LysVal LysAlaPhe AenArg AanAspGlu GlnPhe LeuGluAla Phe ValIle PheCyeGly LeuGly IleGlnAen ThrGln MetTyrGlu Ala ValGlu ArgAlaMet AlaLys GlnMetVal ThrLeu GluValLeu Ser TyrHis AlaSerAla AlaGlu GluGluThr ArgGlu LeuGlnSer Leu AlaAla AlaValVal ProSer AlaGlnThr LeuLye IleThrAsp Phe SerPhe SerAspPhe GluLeu SerAspLeu GluThr AlaLeuCye Thr IleArg MetPheThr AspLeu AenLeuVal GlnAen PheGlnMet Lye HisGlu ValLeuCys LysTrp IleLeuSer ValLys LyeAenTyr Arg LyeAen ValAlaTyr HisAen TrpArgHis AlaPhe AsnThrAla Gln CyeMet PheAlaAla LeuLys AlaGlyLys IleGln LysArgLeu Thr AepLeu GluIleLeu AlaLeu LeuIleAla AlaLeu SerHieAsp Leu AepHis ArgGlyVal AsnAen SerTyrIle GlnArg SerGluHis Pro LeuAla GlnLeuTyr CyeHis SerIleMet GluHis HieHisPhe Asp CAGTGC CTGATGATC CTTAAT AGTCCTGGC AATCAG ATTCTCAGT GGC 21?7 GlnCye LeuMetIle LeuAan SerProGly AenGln IleLeuSer Gly LeuSer IleGluGlu TyrLye ThrThrLeu LyeIle IleLysGln Ala IleLeu AlaThrAap LeuAla LeuTyrIle LyeArg ArgGlyGlu Phe PheGlu LeuIleMet LyaAsn GlnPheAsn LeuGlu AspProHis Gln ATG CTG GCT GCA

Lys Glu Leu Phe Leu Ala Met Thr Cys Asp Leu Ser Met Leu Ala Ala ATT CAA ATA GCC

Ile Thr Lys Pro Trp Pro Gln Arg Ala Glu Leu Val Ile Gln Ile Ala GGA GAT AGG ATA

Thr Glu Phe Phe Asp Gln Arg Glu Lys Glu Leu Asn Gly Asp Arg Ile AAC CGG AAA AGT

Glu Pro Ala Asp Leu Met Glu Lys Asn Lys Ile Pro Asn Arg Lys Ser GAT GCC TTG GCC

Met Gln Val Gly Phe Ile Ile Cys Gln Leu Tyr Glu Asp Ala Leu Ala GAC TGT TTG AGA

Leu Thr His Val Ser Glu Phe Pro Leu Asp Gly Cys Asp Cys Leu Arg CAG GCT GAA ACA

Lys Asn Arg Gln Lys Trp Leu Ala Gln Gln Glu Lys Gln Ala Glu Thr AGC CAG CGA TCC

Leu Ile Asn Gly Glu Ser Thr Asn Gln Gln Arg Asn Ser Gln Arg Ser TAGCCAGG GTGAGTGTGT

Val Ala Val Gly Thr Val (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 875 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Met Glu Arg Ala Gly Pro Gly Cys Arg Ala Ala Ala Thr Ala Met Gly Pro Gly Leu Gly Arg Ser Val Ala Gly Arg Ser Leu Gly Leu Tyr Leu Leu Tyr Phe Val Arg Lys Gly Thr Arg Glu Met Val Asn Ala Trp Phe Ala Glu Arg Val His Thr Ile Pro Val Cys Lys Glu Gly Ile Lys Gly His Thr Glu Ser Cys Ser Cys Pro Leu Gln Pro Ser Pro Arg Ala Glu Ser Ser Val Pro Gly Thr Pro Thr Arg Lys Ile Ser Ala Ser Glu Phe Asp Arg Pro Leu Arg Pro Ile Val Ile Lys Asp Ser Glu Gly Thr Val Ser Phe Leu Ser Asp Ser Asp Lys Lys Glu Gln Met Pro Leu Thr Ser Pro Arg Phe Asp Asn Asp Glu Gly Asp Gln Cys Ser Arg Leu Leu Glu Leu Val Lys Asp Ile Ser Ser His Leu Asp Val Thr Ala Leu Cys His WO 94/28144 21 4 '~ ~ ~ ~ PCT/US94106066 Lys Ile Phe Leu His Ile His Gly Leu Ile Ser Ala Asp Arg Tyr Ser Leu Phe Leu Val Cys Glu Asp Ser Ser Aen Asp Lye Phe Leu Ile Ser Arg Leu Phe Asp Val Ala Glu Gly Ser Thr Leu Glu Glu Ala Ser Asn Asn Cys Ile Arg Leu Glu Trp Asn Lys Gly Ile Val Gly His Val Ala Ala Phe Gly Glu Pro Leu Asn Ile Lys Aep Ala Tyr Glu Asp Pro Arg Phe Asn Ala Glu Val Asp Gln Ile Thr Gly Tyr Lys Thr Gln Ser Ile Leu Cys Met Pro Ile Lys Asn Hie Arg Glu Glu Val Val Gly Val Ala Gln Ala Ile Asn Lys Lys Ser Gly Asn Gly Gly Thr Phe Thr Glu Lys 2?5 280 285 Asp Glu Lya Asp Phe Ala Ala Tyr Leu Ala Phe Cys Gly Ile Val Leu His Asn Ala Gln Leu Tyr Glu Thr Ser Leu Leu Glu Asn Lys Arg Asn Gln Val Leu Leu Asp Leu Ala Ser Leu Ile Phe Glu Glu Gln Gln Ser Leu Glu Val Ile Leu Arg Lye Ile Ala Ala Thr Ile Ile Ser Pro Met Gln Val Gln Lye Cys Thr Ile Phe Ile Val Asp Glu Asp Cys Ser Asp Ser Phe Ser Ser Val Phe His Met Glu Cys Glu Glu Leu Glu Lye Ser Ser Asp Thr Leu Thr Arg Glu Arg Asp Ala Thr Arg Ile Asn Tyr Met Tyr Ala Gln Tyr Val Lys Asn Thr Met Glu Pro Leu Asn Ile Pro Asp Val Ser Lys Asp Lye Arg Phe Pro Trp Thr Asn Glu Asn Met Gly Asn Ile Asn Gln Gln Cys Ile Arg Ser Leu Leu Cys Thr Pro Ile Lys Asn Gly Lys Lye Asn Lys Val Ile Gly Val Cys Gln Leu Val Asn Lys Met Glu Glu Thr Thr Gly Lye Val Lys Ala Phe Asn Arg Asn Asp Glu Gln Phe Leu Glu Ala Phe Val Ile Phe Cys Gly Leu Gly Ile Gln Asn Thr Gln Met Tyr Glu Ala Val Glu Arg Ala Met Ala Lys Gln Met Val Thr Leu GluVal LeuSer His SerAlaAla GluGlu GluThrArg Tyr Ala Glu LeuGln SerLeu Ala ValValPro SerAla GlnThrLeu Ala Ala Lys IleThr AspPhe Phe AspPheGlu LeuSer AspLeuGlu Ser Ser Thr AlaLeu CysThr Arg PheThrAsp LeuAsn LeuValGln Ile Met Asn Phe Gln Met Lye His Glu Val Leu Cys Lye Trp Ile Leu Ser Val Lys Lys Asn Tyr Arg Lys Asn Val Ala Tyr Hie Asn Trp Arg His Ala Phe Aen Thr Ala Gln Cys Met Phe Ala Ala Leu Lys Ala Gly Lys Ile Gln Lys Arg Leu Thr Aap Leu Glu Ile Leu Ala Leu Leu Ile Ala Ala Leu Ser His Asp Leu Asp His Arg Gly Val Asn Asn Ser Tyr Ile Gln Arg Ser Glu Hie Pro Leu Ala Gln Leu Tyr Cye Hie Ser Ile Met Glu His His His Phe Asp Gln Cys Leu Met Ile Leu Asn Ser Pro Gly Asn Gln Ile Leu Ser Gly Leu Ser Ile Glu Glu Tyr Lye Thr Thr Leu Lys Ile Ile Lys Gln Ala Ile Leu Ala Thr Aep Leu Ala Leu Tyr Ile Lys Arg Arg Gly Glu Phe Phe Glu Leu Ile Met Lys Asn Gln Phe Asn Leu Glu Asp Pro His Gln Lys Glu Leu Phe Leu Ala Met Leu Met Thr Ala Cys Asp Leu Ser Ala Ile Thr Lye Pro Trp Pro Ile Gln Gln Arg Ile Ala Glu Leu Val Ala Thr Glu Phe Phe Asp Gln Gly Asp Arg Glu Arg Lya Glu Leu Asn Ile Glu Pro Ala Asp Leu Met Asn Arg Glu Lys Lys Asn Lys Ile Pro Ser Met Gln Val Gly Phe Ile Asp Ala Ile Cys Leu Gln Leu Tyr Glu Ala Leu Thr His Val Ser Glu Asp Cys Phe Pro Leu Leu Asp Gly Cye Arg Lya Asn Arg Gln Lys Trp Gln Ala Leu Ala Glu Gln Gln Glu Lys Thr Leu Ile Asn Gly Glu Ser Ser Gln Thr Asn Arg 2141060_ Gln Gln Arg Asn Ser Val Ala Val Gly Thr Val (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2060 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
NO:11:

WO 94128144 ~ ~ ~ ~ ~ ~ O PCTIUS94106066 (2) INFORMATION FOR SEQ ID
N0:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1982 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:12:

WO 94/28144 2 1 4 1 ~ 6 ~ PCTIUS94106066 (2) INFORMATION FOR SEQ ID N0:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID :
N0:13 (2) INFORMATION FOR SEQ ID N0:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

2~~1060 (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:

(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1107 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

WO 94/28144 21 4 1 o s 4 PCTIUS94106066 GTCAGAGGAC TGTTTCCCTT TGCTAGATGG CTGCAGAAAGAACAGGCAGA AATGGCAGGC

CCTTGCAGAA CAGCAGGAGA AGATGCTGAT TAATGGGGAAAGCGGCCAGG CCAAGCGGAA

CTGAGTGGCC TATTTCATGC AGAGTTGAAG TTTACAGAGATGGTGTGTTC TGCAATATGC

CTAGTTTCTT ACACACTGTC TGTATAGTGT CTGTATTTGGTATATACTTT GCCACTGCTG

TATTTTTATT TTTGCACAAC TTTTGAGAGT ATAGCATGAATGTTTTTAGA GGACTATTAC

ATATTTTTTG TATATTTGTT TTATGCTACT GAACTGAAAGGATCAACAAC ATCCACTGTT

AGCACATTGA TAAAAGCATT GTTTGTGATA TTTCGTGTACTGCAAAGTGT ATGCAGTATT

(2) INFORMATION FOR SEQ ID N0:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID
NOslB:

(2) INFORMATION FOR SEQ ID N0:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID
N0:19:

(2) INFORMATION FOR SEQ ID N0:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:

(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2645 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/REY: CDS
(B) LOCATION: 12..2636 (xi)SEQUENCE SEQID
DESCRIPTION: N0:22:

ATG CCC
GAG AGC
CGG TTC
GCC GGG
GG CAG
CAG
CGA
CAG

Met y Glu Pro Arg Ser Ala Phe Gl Gly Gln Gln Arg Gln GlnGln GlnProGln GlnGln LyeGlnGln GlnArgAsp GlnAsp Ser ValGlu AlaTrpLeu AspAsp HisTrpAsp PheThrPhe SerTyr Phe ValArg LysAlaThr ArgGlu MetValAsn AlaTrpPhe AlaGlu Arg ValHis ThrIlePro ValCys LysGluGly IleArgGly HieThr Glu SerCys SerCysPro LeuGln GlnSerPro ArgAlaAsp AsnSer Val ProGly ThrProThr ArgLys IleSerAla SerGluPhe AspArg Pro Leu Arg Pro Ile Val Val Lys Asp Ser Glu Gly Thr Val Ser Phe Leu WO 94128144 21 4 10 6 o y' PCTIUS94106066 ' f -56-SerAsp SerGluLys LysGlu GlnMetPro LeuThrPro ProArg Phe AspHis AepGluGly AspGln CysSerArg LeuLeuGlu LeuVal Lys AspIle SerSerHis LeuAap ValThrAla LeuCysHis LysIle Phe LeuHis IleHisGly LeuIle SerAlaAsp ArgTyrSer LeuPhe Leu ValCys GluAspSer SerAsn AspLysPhe LeuIleSer ArgLeu Phe AspVal AlaGluGly SerThr LeuGluGlu ValSerAsn AsnCys Ile ArgLeu GluTrpAsn LysGly IleValGly HisValAla AlaLeu Gly GluPro LeuAsnIle LysAap AlaTyrGlu AspProArg PheAen Ala GluVal AspGlnIle ThrGly TyrLysThr GlnSerIle LeuCys Met ProIle LysAsnHis ArgGlu GluValVal GlyValAla GlnAla Ile AsnLys LysSerGly AsnGly GlyThrPhe ThrGluLye AspGlu Lye AspPhe AlaAlaTyr LeuAla PheCysGly IleValLeu HisAsn Ala GlnLeu TyrGluThr SerLeu LeuGluAsn LysArgAsn GlnVal Leu LeuAsp LeuAlaSer LeuIle PheGluGlu GlnGlnSer LeuGlu Val IleLeu LysLysIle AlaAla ThrIleIle SerPheMet GlnVal Gln LysCys ThrIlePhe IleVal AspGluAsp CysSerAsp SerPhe Ser SerVal PheHisMet GluCys GluGluLeu GluLysSer SerAsp Thr WO 94128144 21 4 1 0 6 ~ PCTIUS94I06066 ATC

LeuThrArgGlu HisAsp AlaAsn LyeIleAsn TyrMet TyrAlaGln TyrValLysAsn ThrMet GluPro LeuAenIle ProAsp ValSerLys AspLysArgPhe ProTrp ThrThr GluAsnThr GlyAen ValAsnGln GlnCysIleArg SerLeu LeuCys ThrProIle LysAsn GlyLysLye AsnLysValIle GlyVal CyeGln LeuValAsn LysMet GluGluAsn ThrGlyLysVal LyaPro PheAsn ArgAsnAsp GluGln PheLeuGlu AlaPheValIle PheCys GlyLeu GlyIleGln AsnThr GlnMetTyr GluAlaValGlu ArgAla MetAla LysGlnMet ValThr LeuGluVal LeuSerTyrHis AlaSer AlaAla GluGluGlu ThrArg GluLeuGln SerLeuAlaAla AlaVal ValPro SerAlaGln ThrLeu LyeIleThr AspPheSerPhe SerAsp PheGlu LeuSerAsp LeuGlu ThrAlaLeu CysThrIleArg MetPhe ThrAsp LeuAsnLeu ValGln AsnPheGln MetLysHisGlu ValLeu CysArg TrpIleLeu SerVal LysLysAsn TyrArgLysAsn ValAla TyrHis AsnTrpArg HieAla PheAenThr AlaGlnCysMet PheAla AlaLeu LysAlaGly LyeIle GlnAsnLys LeuThrAspLeu GluIle LeuAla LeuLeuIle AlaAla LeuSerHis AspLeuAspHis ArgGly ValAsn AsnSerTyr IleGln ArgSerGlu WO 94/28144 2 ~ 41 o s a - PCTIUS94106066 HieProLeuAla GlnLeu TyrCys HisSerIle MetGluHie HieHie PheAspGlnCya LeuMet IleLeu AanSerPro GlyAenGln IleLeu SerGlyLeuSer IleGlu GluTyr LyaThrThr LeuLyaIle IleLya GlnAlaIleLeu AlaThr AspLeu AlaLeuTyr IleLysArg ArgGly GluPhePheGlu LeuIle ArgLya AsnGlnPhe AsnLeuGlu AspPro HisGlnLyaGlu LeuPhe LeuAla MetLeuMet ThrAlaCya AspLeu SerAlaIleThr LyePro TrpPro IleGlnGln ArgIleAla GluLeu ValAlaThrGlu PhePhe AspGln GlyAspArg GluArgLys GluLeu AanIleGluPro ThrAap LeuMet AsnArgGlu LyaLyaAan LyaIle ProSerMetGln ValGly PheIle AspAlaIle CyaLeuGln LeuTyr GluAlaLeuThr HieVal SerGlu AspCyaPhe ProLeuLeu AspGly CyaArgLyaAan ArgGln LyaTrp GlnAlaLeu AlaGluGln GlnGlu LysMetLeuIle AanGly GluSer GlyGlnAla LyeArgAsn (2)INFORMATION FORSEQ ID N0:23:

(i)SEQUENCE CHARACTERISTICS :

(A) : 5 acids LENGTH 87 amino (B) amino TYPE: acid (D) linear TOPOLOGY:

( ii)MOLECULE TYPE: rotein p ( xi)SEQUENCE DES CRIPTION: N0:23:
SEQ
ID

MetGluArgAla GlyPro SerPhe GlyGlnGln ArgGlnGln GlnGln Pro Gln Gln Gln Lys Gln Gln Gln Arg Aap Gln Asp Ser Val Glu Ala Trp Leu Asp Asp His Trp Aep Phe Thr Phe Ser Tyr Phe Val Arg Lye Ala Thr Arg Glu Met Val Aen Ala Trp Phe Ala Glu Arg Val His Thr Ile Pro Val Cye Lys Glu Gly Ile Arg Gly His Thr Glu Ser Cye Ser Cye Pro Leu Gln Gln Ser Pro Arg Ala Asp Asn Ser Val Pro Gly Thr Pro Thr Arg Lye Ile Ser Ala Ser Glu Phe Asp Arg Pro Leu Arg Pro Ile Val Val Lye Aep Ser Glu Gly Thr Val Ser Phe Leu Ser Asp Ser Glu Lye Lye Glu Gln Met Pro Leu Thr Pro Pro Arg Phe Aep His Aep Glu Gly Asp Gln Cye Ser Arg Leu Leu Glu Leu Val Lye Aep Ile Ser Ser His Leu Aep Val Thr Ala Leu Cye His Lys Ile Phe Leu His Ile His Gly Leu Ile Ser Ala Asp Arg Tyr Ser Leu Phe Leu Val Cye Glu Aep Ser Ser Aen Asp Lye Phe Leu Ile Ser Arg Leu Phe Asp Val Ala Glu Gly Ser Thr Leu Glu Glu Val Ser Asn Asn Cys Ile Arg Leu Glu Trp Asn Lye Gly Ile Val Gly His Val Ala Ala Leu Gly Glu Pro Leu Aen Ile Lye Asp Ala Tyr Glu Asp Pro Arg Phe Asn Ala Glu Val Asp Gln Ile Thr Gly Tyr Lye Thr Gln Ser Ile Leu Cye Met Pro Ile Lye Aen His Arg Glu Glu Val Val Gly Val Ala Gln Ala Ile Asn Lye Lye Ser Gly Asn Gly Gly Thr Phe Thr Glu Lys Asp Glu Lys Asp Phe Ala Ala Tyr Leu Ala Phe Cys Gly Ile Val Leu Hie Aen Ala Gln Leu Tyr Glu Thr Ser Leu Leu Glu Asn Lye Arg Asn Gln Val Leu Leu Aep Leu Ala Ser Leu Ile Phe Glu Glu Gln Gln Ser Leu Glu Val Ile Leu Lys Lye Ile Ala Ala Thr Ile Ile Ser Phe Met Gln Val Gln Lys Cye Thr WO 94128144 ~ 41 o s o -:- PCTIUS94106066 Ile Phe Ile Val Asp Glu Asp Cys Ser Asp Ser Phe Ser Ser Val Phe Hia Met Glu Cys Glu Glu Leu Glu Lys Ser Ser Asp Thr Leu Thr Arg Glu His Aep Ala Asn Lys Ile Asn Tyr Met Tyr Ala Gln Tyr Val Lys Aan Thr Met Glu Pro Leu Asn Ile Pro Asp Val Ser Lys Asp Lya Arg Phe Pro Trp Thr Thr Glu Asn Thr Gly Asn Val Aan Gln Gln Cys Ile Arg Ser Leu Leu Cys Thr Pro Ile Lys Asn Gly Lys Lys Asn Lys Val Ile Gly Val Cys Gln Leu Val Aan Lya Met Glu Glu Aan Thr Gly Lys Val Lya Pro Phe Aan Arg Asn Asp Glu Gln Phe Leu Glu Ala Phe Val Ile Phe Cye Gly Leu Gly Ile Gln Asn Thr Gln Met Tyr Glu Ala Val Glu Arg Ala Met Ala Lys Gln Met Val Thr Leu Glu Val Leu Ser Tyr His Ala Ser Ala Ala Glu Glu Glu Thr Arg Glu Leu Gln Ser Leu Ala Ala Ala Val Val Pro Ser Ala Gln Thr Leu Lys Ile Thr Asp Phe Ser Phe Ser Asp Phe Glu Leu Ser Asp Leu Glu Thr Ala Leu Cye Thr Ile Arg Met Phe Thr Asp Leu Asn Leu Val Gln Asn Phe Gln Met Lys His Glu Val Leu Cys Arg Trp Ile Leu Ser Val Lys Lye Asn Tyr Arg Lys Aan Val Ala Tyr Hie Asn Trp Arg Hie Ala Phe Asn Thr Ala Gln Cys Met Phe Ala Ala Leu Lye Ala Gly Lys Ile Gln Asn Lya Leu Thr Aep Leu Glu Ile Leu Ala Leu Leu Ile Ala Ala Leu Ser Hia Asp Leu Aep His Arg Gly Val Asn Asn Ser Tyr Ile Gln Arg Ser Glu His Pro Leu Ala Gln Leu Tyr Cys His Ser Ile Met Glu His His Hie Phe Asp Gln Cys Leu Met Ile Leu Asn Ser Pro Gly Asn Gln Ile Leu Ser Gly Leu Ser Ile Glu Glu Tyr Lys Thr Thr Leu Lys Ile Ile Lys Gln Ala Ile Leu Ala Thr Asp Leu Ala Leu Tyr Ile Lye Arg Arg Gly Glu Phe Phe Glu Leu Ile Arg Lye Asn Gln Phe Asn Leu Glu Asp Pro His Gln Lye Glu Leu Phe Leu Ala Met Leu Met Thr Ala Cys Asp Leu Ser Ala Ile Thr Lye Pro Trp Pro Ile Gln Gln Arg Ile Ala Glu Leu Val Ala Thr Glu Phe Phe Asp Gln Gly Asp Arg Glu Arg Lys Glu Leu Asn Ile Glu Pro Thr Asp Leu Met Asn Arg Glu Lys Lye Asn Lys Ile Pro Ser Met Gln Val Gly Phe Ile Asp Ala Ile Cys Leu Gln Leu Tyr Glu Ala Leu Thr His Val Ser Glu Asp Cys Phe Pro Leu Leu Asp Gly Cys Arg Lye Asn Arg Gln Lys Trp Gln Ala Leu Ala Glu Gln Gln Glu Lys Met Leu Ile Asn Gly Glu Ser Gly Gln Ala Lye Arg Asn WO 94mis1~ '~ 1 4 1 0 6 0 _62- PCTIUS94I06066 Applicant's or agent's tile 32083 Imern;m~m~i nppi ~u.' reference number INDICATIONS RIjl~1'I'ING'1'c>:1 DI:1'()SI'I'U:U vllC'It()OKCANISV1 (PC'T Rule l3~rs) A. The indicatioru made below relate to the mtcroorgamsm reierrec! to m the eiescrtpuon on page 5 , Itnes 6-9 I3. IDENTIFICATION OF DEPOSIT Funher deposes are identified on an additional sheet Name of depositary institution American Type Culture Collection Address of depositary institution (including posral code and covnrry) 12301 Parklawn Drive Rockville, Maryland 20852 US
Date of deposit r\ccesston Number 4 May 1993 ATCC 69296 C. ADDITIONAL INDICATIONS (Iravr blank /nor applicab7r) This information is continued on an additional sheet "In respect of those designations in which a European patent is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 23(4) EPC)."
D. DESIGNATED STATES FOR WNICFI INDICAT10NS ARE lItADE hjrlrr incicarions are nor jor all drsignated Srares) EP
E. SEPARATE FURMSHING OF INDICATIONS fhavr bto~k ijnor appGcabir) 'Ilteindicationslistedbelowwillbesubmittedtothe International Bureau lateyspcmjyhrgrnrrainamrrojrimindicauonsr.g., 'Accraston Number ojDrposit') For receiving Office use only For lntemattonal Bureau use only ~ This sheet was received with the international appl~catiun Q 1W s sheet Haas received by the International Bureau on .\uth~nzed otUCer Autborized ofFce~r ,~~'~~
~~~I~J In.e ~I~N~'~
,.. .-.-..~ Dj~=g~0~t 1. ,~ ...,-.:: r. t=
Form PCT/RO/134 (July 1992)

Claims (18)

CLAIMS:

1. A purified and isolated polynucleotide encoding the cyclic GMP binding phosphodiesterase (cGB-PDE) polypeptide set out in SEQ ID NO:23.

2. The polynucleotide of claim 1 which is a DNA.

3. The DNA of claim 2 which is a cDNA.

4. An RNA transcript of the DNA of claim 2.

5. A vector comprising a DNA according to claim 2.

6. The vector of claim 5, wherein said DNA is operatively linked to an expression control sequence.

7. A host cell stably transformed or transfected with a DNA according to claim 2 in a manner allowing the expression in said host cell of the cGB-PDE of SEQ ID NO:23.

8. A method of producing a cGB-PDE polypeptide, said method comprising growing a host cell according to claim 7 in a suitable nutrient medium and isolating cGB-PDE polypeptide from said cell or the medium of its growth.

9. A purified and isolated polynucleotide selected from the group consisting of a polynucleotide encoding an allelic variant of cGB-PDE polypeptide of SEQ ID NO:23 and a polynucleotide encoding a non-human species cGB-PDE homolog, wherein said polynucleotide hybridizes at about: 65°C in 3X SSC, 20 mM sodium phosphate pH 6.8, with washing at about: 65°C in 2X
SSC, to a non-coding strand of DNA of SEQ ID NO:22.

10. A purified and isolated polypeptide encoded by a DNA
sequence of SEQ ID NO:22.

11. A purified and isolated recombinant human cyclic GMP
binding phosphodiesterase (cGB-PDE) polypeptide comprising an amino acid sequence according to SEQ ID NO:23.

12. A fragment of the cGB-PDE polypeptide of claim 11 comprising amino acids 516 to 875 of SEQ ID NO:23.

13. A fragment of the cGB-PDE polypeptide of claim 11 comprising the amino acids 1-494 of SEQ ID NO:23.

14. A fragment of the cGB-PDE polypeptide of claim 11 comprising the amino acids 1-549 of SEQ ID NO:23.

15. An antibody specifically immunoreactive with the human cGB-PDE polypeptide of SEQ ID NO:23.

16. A monoclonal antibody according to claim 15.

17. A hybridoma cell line producing the antibody of claim 16.

18. A humanized antibody according to claim 15.