CA2017211C - Methods for tagging and tracing materials with nucleic acids - Google Patents
Methods for tagging and tracing materials with nucleic acids Download PDFInfo
- Publication number
- CA2017211C CA2017211C CA002017211A CA2017211A CA2017211C CA 2017211 C CA2017211 C CA 2017211C CA 002017211 A CA002017211 A CA 002017211A CA 2017211 A CA2017211 A CA 2017211A CA 2017211 C CA2017211 C CA 2017211C
- Authority
- CA
- Canada
- Prior art keywords
- substance
- nucleic acid
- taggant
- tagging
- nucleic acids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- G—PHYSICS
- G09—EDUCATION; CRYPTOGRAPHY; DISPLAY; ADVERTISING; SEALS
- G09F—DISPLAYING; ADVERTISING; SIGNS; LABELS OR NAME-PLATES; SEALS
- G09F3/00—Labels, tag tickets, or similar identification or indication means; Seals; Postage or like stamps
-
- C—CHEMISTRY; METALLURGY
- C06—EXPLOSIVES; MATCHES
- C06B—EXPLOSIVES OR THERMIC COMPOSITIONS; MANUFACTURE THEREOF; USE OF SINGLE SUBSTANCES AS EXPLOSIVES
- C06B23/00—Compositions characterised by non-explosive or non-thermic constituents
- C06B23/008—Tagging additives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
- D21H21/00—Non-fibrous material added to the pulp, characterised by its function, form or properties; Paper-impregnating or coating material, characterised by its function, form or properties
- D21H21/14—Non-fibrous material added to the pulp, characterised by its function, form or properties; Paper-impregnating or coating material, characterised by its function, form or properties characterised by function or properties in or on the paper
- D21H21/40—Agents facilitating proof of genuineness or preventing fraudulent alteration, e.g. for security paper
- D21H21/44—Latent security elements, i.e. detectable or becoming apparent only by use of special verification or tampering devices or methods
- D21H21/46—Elements suited for chemical verification or impeding chemical tampering, e.g. by use of eradicators
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/13—Tracers or tags
Abstract
Methods for tagging and tracing materials using nucleic acids as taggants allow for the identification of diverse materials. The process of tagging involves altering a substance in a manner that allows for the subsequent identification of the substance by detecting the alteration. The alteration disclosed herein involves nucleic acids. The methods are especially useful when the nucleic acid taggant is amplified prior to the indentification step.
Description
METHODS FOR TAGGING AND
TRACING MATERIALS WITH NUCLEIC ACIDS
The present invention provides methods for tagging and tracing materials using nucleic acids as taggants. The process of tagging involves altering a substance in a manner that allows for the subsequent identification of the substance by detecting the alteration. The alteration disclosed herein involves nucleic acids.
Society currently attempts to track the manufacture and distribution of a large number of diverse substances, including (1) natural resources such as animals, plants, oil, minerals, and water; (2) chemicals such as drugs, solvents, petroleum products, and explosives; (3) commercial by-products including pollutants such as radioactive or other hazardous waste; and (4) articles of manufacture such as guns, typewriters, automobiles and automobile parts. Tagging aids in the determination of product identity and so provides information useful to manufacturers and consumers.
Some of the diverse uses of tagging methods and reagents include the identification of the manufacturer of an explosive, even after detonation, and the determination of flow patterns, so as to measure the spread of pollutants. The present invention provides a significant advance in the field, because the taggants can encode substantial amounts of information to aid subsequent identification.
Moreover, by using recently available amplification technology, one can detect far less taggant than ever before. In fact, the present tagging methods work with such vanishingly small levels of taggant that drugs tagged by the present method can still pass the FDA standards (10 pg/dose) for amount of DNA, in this case, taggant DNA, in any product.
The use of tagging substances with polypeptides is known. U.S. Patent Nos.
4,359,353 and 4,441,943. As with the nucleic acid taggants of the subject invention, the polypeptide taggants use the order of amino acids in the polypeptide to encode information.
The present invention provides a method for tagging a material (any substance) by treating the material with a nucleic acid taggant so that said nucleic acid attaches to said material in an amount sufficient for subsequent detection. The nucleic acid taggant comprises a specific nucleotide sequence or has a distinct composition of specific nucleotides to facilitate tracing. The present invention also provides a method for tracing a material tagged with a nucleic acid taggant that comprises determining the presence of a nucleic acid sequence specific for said .'i taggant in the material. In a preferred embodiment, the tracing method also comprises treating the material under conditions that would result in the amplification of a nucleic acid sequence of a taggant, if present, to determine if the specific nucleic acid sequence is present.
More particularly, this invention provides for a method of monitoring the presence of a substance which comprises tagging the substance with a nucleic acid, collecting said substance and detecting said nucleic acid. An additional step of amplification of the nucleic acid is also described herein. This amplification is typically done prior to detection and is preferably achieved using polymerase chain reaction technology. The nucleic acids can be either naturally occurring or 1 '.i synthetically derived. Preferred synthetic nucleic acids are comprised of inosine bases or 7-deaza-2'-deoxyguanosine nucleotides.
The materials or substances of this invention include those selected from the group consisting of air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products. The nucleic acids can be optionally bound to a component of the tagged substance through a covalent bond. "Covalently bound to a component of the substance," means that the nucleic acids are covalently bound to the tagged material or component thereof. Where the material is comprised of different components such as different chemical compounds, the nucleic acid may be covalently bound to any one or all of the components.
2.'i The nucleic acids used as taggants may be free or they may be covalently bound to a solid support (such as latex beads, dextran or magnetic beads) which is then mixed with the material being tagged. Alternatively the nucleic acids may be encapsulated by polymeric substances (such as proteins) or by lipophilic compositions (such as liposomes).
TRACING MATERIALS WITH NUCLEIC ACIDS
The present invention provides methods for tagging and tracing materials using nucleic acids as taggants. The process of tagging involves altering a substance in a manner that allows for the subsequent identification of the substance by detecting the alteration. The alteration disclosed herein involves nucleic acids.
Society currently attempts to track the manufacture and distribution of a large number of diverse substances, including (1) natural resources such as animals, plants, oil, minerals, and water; (2) chemicals such as drugs, solvents, petroleum products, and explosives; (3) commercial by-products including pollutants such as radioactive or other hazardous waste; and (4) articles of manufacture such as guns, typewriters, automobiles and automobile parts. Tagging aids in the determination of product identity and so provides information useful to manufacturers and consumers.
Some of the diverse uses of tagging methods and reagents include the identification of the manufacturer of an explosive, even after detonation, and the determination of flow patterns, so as to measure the spread of pollutants. The present invention provides a significant advance in the field, because the taggants can encode substantial amounts of information to aid subsequent identification.
Moreover, by using recently available amplification technology, one can detect far less taggant than ever before. In fact, the present tagging methods work with such vanishingly small levels of taggant that drugs tagged by the present method can still pass the FDA standards (10 pg/dose) for amount of DNA, in this case, taggant DNA, in any product.
The use of tagging substances with polypeptides is known. U.S. Patent Nos.
4,359,353 and 4,441,943. As with the nucleic acid taggants of the subject invention, the polypeptide taggants use the order of amino acids in the polypeptide to encode information.
The present invention provides a method for tagging a material (any substance) by treating the material with a nucleic acid taggant so that said nucleic acid attaches to said material in an amount sufficient for subsequent detection. The nucleic acid taggant comprises a specific nucleotide sequence or has a distinct composition of specific nucleotides to facilitate tracing. The present invention also provides a method for tracing a material tagged with a nucleic acid taggant that comprises determining the presence of a nucleic acid sequence specific for said .'i taggant in the material. In a preferred embodiment, the tracing method also comprises treating the material under conditions that would result in the amplification of a nucleic acid sequence of a taggant, if present, to determine if the specific nucleic acid sequence is present.
More particularly, this invention provides for a method of monitoring the presence of a substance which comprises tagging the substance with a nucleic acid, collecting said substance and detecting said nucleic acid. An additional step of amplification of the nucleic acid is also described herein. This amplification is typically done prior to detection and is preferably achieved using polymerase chain reaction technology. The nucleic acids can be either naturally occurring or 1 '.i synthetically derived. Preferred synthetic nucleic acids are comprised of inosine bases or 7-deaza-2'-deoxyguanosine nucleotides.
The materials or substances of this invention include those selected from the group consisting of air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products. The nucleic acids can be optionally bound to a component of the tagged substance through a covalent bond. "Covalently bound to a component of the substance," means that the nucleic acids are covalently bound to the tagged material or component thereof. Where the material is comprised of different components such as different chemical compounds, the nucleic acid may be covalently bound to any one or all of the components.
2.'i The nucleic acids used as taggants may be free or they may be covalently bound to a solid support (such as latex beads, dextran or magnetic beads) which is then mixed with the material being tagged. Alternatively the nucleic acids may be encapsulated by polymeric substances (such as proteins) or by lipophilic compositions (such as liposomes).
This invention also provides methods for tagging substances wherein the method comprises the step of incorporating a nucleic acid onto the substance or into the substance. The preferred taggants and substances are as described above.
This invention also provides compositions of tagged substances where the taggant is a nucleic acid having a specific sequence of nucleotide bases for retrospective identification. Preferred compositions are those which comprise the nucleic acid and a substance selected from the group consisting of air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products. The nucleic acids can be synthetically derived, covalently bound to solid support, or encapsulated, as described above.
This invention also provides for kits for the detection of substances tagged with nucleic acids. Such kits can include nucleic acids for the detection of the taggants, for the amplification of the taggants and for use as taggants.
The following definitions are provided to aid understanding of the invention:
SUBSTANCE - a material that can be tagged and traced according to the method of the invention.
NUCLEIC ACID - a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form; modified nucleotides may comprise all or pan of the nucleic acid.
TAGGANT - a nucleic acid that comprises a specific nucleotide sequence or has a specific nucleotide composition, the specificity of said sequence or composition providing a means to store information. Taggants are typically non-biologically functioning in that they are not a part of a functional nucleic acid sequence operating in a living cell. Those of skill will recognize that living organisms contain unique nucleic acid sequences either natural or artificially introduced. this invention is not meant to embrace these naturally occurring and biologically functional forms of taggants. Taggants are generally added to substances. They are not a functioning part of the substance.
TAGGING - the process of treating a material with a composition, the taggant, for subsequent identification of the material by detection of the taggant.
TRACING - the process of determining the origin or source of a material.
This invention also provides compositions of tagged substances where the taggant is a nucleic acid having a specific sequence of nucleotide bases for retrospective identification. Preferred compositions are those which comprise the nucleic acid and a substance selected from the group consisting of air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products. The nucleic acids can be synthetically derived, covalently bound to solid support, or encapsulated, as described above.
This invention also provides for kits for the detection of substances tagged with nucleic acids. Such kits can include nucleic acids for the detection of the taggants, for the amplification of the taggants and for use as taggants.
The following definitions are provided to aid understanding of the invention:
SUBSTANCE - a material that can be tagged and traced according to the method of the invention.
NUCLEIC ACID - a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form; modified nucleotides may comprise all or pan of the nucleic acid.
TAGGANT - a nucleic acid that comprises a specific nucleotide sequence or has a specific nucleotide composition, the specificity of said sequence or composition providing a means to store information. Taggants are typically non-biologically functioning in that they are not a part of a functional nucleic acid sequence operating in a living cell. Those of skill will recognize that living organisms contain unique nucleic acid sequences either natural or artificially introduced. this invention is not meant to embrace these naturally occurring and biologically functional forms of taggants. Taggants are generally added to substances. They are not a functioning part of the substance.
TAGGING - the process of treating a material with a composition, the taggant, for subsequent identification of the material by detection of the taggant.
TRACING - the process of determining the origin or source of a material.
This invention relates to the use of nucleic acids for monitoring, detecting and tracing substances released into the environment or released into the stream of commerce. The nucleic acids are used as an additive to tag such substances.
The specifics of compounding the nucleic acid as a taggant and its subsequent recovery :i for analysis is dependent upon the specific substance into which the nucleic acid is being added. The following guidelines are offered.
Nucleic acids.
The nucleic acids for use in this invention can provide a limitless amount of information. By using combinations of universal sequences (accepted as industrial standards) and by varying levels of specific sequences, one can identify the type of generic product, the product's origin (company specific sequences), the lot or batch, and even provide an identifier for a unit of commerce.
The nucleic acids suitable for use in this invention include both natural and 1.'i non-natural nucleic acids. They can be single or double stranded. Natural nucleic acids refer to polymers of either DNA or RNA including the 5 naturally occurring bases, adenine, thymine, guanine, cytosine and uracil.
Non-natural or synthetic nucleic acids can also be used in this invention.
Synthetic nucleic acids in some instances have advantages over natural nucleic acids, e.g. in stability, solubility, etc. Some synthetic nucleotides are less likely to be degraded by nuclease activity, by chemically active substances or by environmental conditions such as heat or ultraviolet radiation. The use of non-natural nucleotides is limited only by their ability to be effectively detected by the selected detection means. For tagging methods using the preferred PCR technology, the synthetic ~5 nucleic acid must form duplexes with the primers and function as a template for the polymerases used in the procedure. Non-natural nucleic acids for use in this invention include those incorporating inosine bases, and derivatized nucleotides, such as 7-deaza-2'deoxyguanosine, methyl- (or longer alkyl-) phosphonate oligodeoxy-nucleotides, phosphorothioate oligodeoxynucleotides, and alpha-anomeric 31) oligodeoxynucleotides.
2~~v~
The nucleic acids for use in this invention can provide a limitless amount of information. By using combinations of universal sequences (accepted as industrial standards) and by varying levels of specific sequences, one can identify or authenticate the type of generic product, the product's origin (company specific 5 sequences) and the lot or batch.
Tagged Substances.
The following substances are not meant to be limiting, but will serve to offer those of skill an understanding of the versatility of this invention. For example, it is expected that this invention will find application in explosives (such as plastic explosives and gunpowder), aerosols (such as automobile or industrial pollutants from smoke stacks), organic solvents (such as from dry cleaners, chemical factories, airports, and gas stations), paper goods (such as newsprint, money, and legal documents), inks, perfumes, and pharmaceutical products (such as medicaments).
Preparation of the nucleic acids will vary in accordance with the nature of the substance and upon the expected impact of the environment in which the substance is expected to be placed. The substances can be classified as solids, liquids or gases.
The substances can be either inert or active, with liquids and aerosols being further divided as being either polar or non-polar.
Inert solids such as paper, many pharmaceutical products, wood, some foodstuffs, or polymer compounds (e.g., plastics), can be processed with the taggant or the taggant can be sprayed onto the surface of the solid. Taggants can be physically mixed with inert liquids or gases.
Chemically active substances, such as foodstuffs with enzymatic activity, polymers with charged groups, or acidic pharmaceuticals may require that a protective composition be added to the nucleic acid taggants. Protective compositions would include substances which would encapsulate the nucleic acids and protect them from enzymatic or chemical degradation. Liposomes are a technology presently available for use as a protective capsule for nucleic acids. Typical liposomes are micelle bodies formed by detergents. Alternatively polymeric substances can be used to electrostatically bind to and encapsulate the nucleic acids. Polymeric substances would include proteins such as virus coat proteins.
The same approach is used for the addition of taggants to chemically active liquids except the protective composition for a liquid is preferably compatible with the liquid's polarity. The compatibility of taggant with a liquid substance is preferred for both inert and chemically active liquids. For example, oils and other non-polar liquids can be tagged effectively by the use of detergents added to the taggant prior to the addition of the taggant to the liquid. One could rely upon Brownian motion to ensure a uniform distribution in the liquid.
For gases, the taggants are simply mixed with the gas. This is because the taggant is much smaller that what is usually considered to be dust (0.2 microns) particles. Containerized gases would have the taggants placed in the container. For gases being released into the atmosphere, the taggants could be mixed before release or at the time of release. For example, to track the pattern of dispersal of gases released by industry, one could attach an aerosol delivery device to an exhaust outlet and introduce a metered amount of taggant as the gas is released.
The use of nucleic acid taggants for the tracing of radioactive products, including waste, is anticipated. The means for tracing would be as described herein for non-radioactive materials with the use of appropriate protection. It should be noted that short oligonucleotides of less than 1000 bases are preferred due to their greater stability against degradation from radiation.
Recovery and detection of tag ag nts.
The amount to add to a substance and preferred means for recovery and detection of nucleic acid taggant is dependent upon the substance being monitored.
The means for detection and the amount of available sample being collected will dictate the amount of taggant required for each application of this invention.
Therefore, in the absence of a means to amplify the taggant, the amount of taggant added would depend on the logistics of collecting enough substance to recover a detectable amount of taggant.
C .~ t~w r~, ,~
~.~ t~.
The specifics of compounding the nucleic acid as a taggant and its subsequent recovery :i for analysis is dependent upon the specific substance into which the nucleic acid is being added. The following guidelines are offered.
Nucleic acids.
The nucleic acids for use in this invention can provide a limitless amount of information. By using combinations of universal sequences (accepted as industrial standards) and by varying levels of specific sequences, one can identify the type of generic product, the product's origin (company specific sequences), the lot or batch, and even provide an identifier for a unit of commerce.
The nucleic acids suitable for use in this invention include both natural and 1.'i non-natural nucleic acids. They can be single or double stranded. Natural nucleic acids refer to polymers of either DNA or RNA including the 5 naturally occurring bases, adenine, thymine, guanine, cytosine and uracil.
Non-natural or synthetic nucleic acids can also be used in this invention.
Synthetic nucleic acids in some instances have advantages over natural nucleic acids, e.g. in stability, solubility, etc. Some synthetic nucleotides are less likely to be degraded by nuclease activity, by chemically active substances or by environmental conditions such as heat or ultraviolet radiation. The use of non-natural nucleotides is limited only by their ability to be effectively detected by the selected detection means. For tagging methods using the preferred PCR technology, the synthetic ~5 nucleic acid must form duplexes with the primers and function as a template for the polymerases used in the procedure. Non-natural nucleic acids for use in this invention include those incorporating inosine bases, and derivatized nucleotides, such as 7-deaza-2'deoxyguanosine, methyl- (or longer alkyl-) phosphonate oligodeoxy-nucleotides, phosphorothioate oligodeoxynucleotides, and alpha-anomeric 31) oligodeoxynucleotides.
2~~v~
The nucleic acids for use in this invention can provide a limitless amount of information. By using combinations of universal sequences (accepted as industrial standards) and by varying levels of specific sequences, one can identify or authenticate the type of generic product, the product's origin (company specific 5 sequences) and the lot or batch.
Tagged Substances.
The following substances are not meant to be limiting, but will serve to offer those of skill an understanding of the versatility of this invention. For example, it is expected that this invention will find application in explosives (such as plastic explosives and gunpowder), aerosols (such as automobile or industrial pollutants from smoke stacks), organic solvents (such as from dry cleaners, chemical factories, airports, and gas stations), paper goods (such as newsprint, money, and legal documents), inks, perfumes, and pharmaceutical products (such as medicaments).
Preparation of the nucleic acids will vary in accordance with the nature of the substance and upon the expected impact of the environment in which the substance is expected to be placed. The substances can be classified as solids, liquids or gases.
The substances can be either inert or active, with liquids and aerosols being further divided as being either polar or non-polar.
Inert solids such as paper, many pharmaceutical products, wood, some foodstuffs, or polymer compounds (e.g., plastics), can be processed with the taggant or the taggant can be sprayed onto the surface of the solid. Taggants can be physically mixed with inert liquids or gases.
Chemically active substances, such as foodstuffs with enzymatic activity, polymers with charged groups, or acidic pharmaceuticals may require that a protective composition be added to the nucleic acid taggants. Protective compositions would include substances which would encapsulate the nucleic acids and protect them from enzymatic or chemical degradation. Liposomes are a technology presently available for use as a protective capsule for nucleic acids. Typical liposomes are micelle bodies formed by detergents. Alternatively polymeric substances can be used to electrostatically bind to and encapsulate the nucleic acids. Polymeric substances would include proteins such as virus coat proteins.
The same approach is used for the addition of taggants to chemically active liquids except the protective composition for a liquid is preferably compatible with the liquid's polarity. The compatibility of taggant with a liquid substance is preferred for both inert and chemically active liquids. For example, oils and other non-polar liquids can be tagged effectively by the use of detergents added to the taggant prior to the addition of the taggant to the liquid. One could rely upon Brownian motion to ensure a uniform distribution in the liquid.
For gases, the taggants are simply mixed with the gas. This is because the taggant is much smaller that what is usually considered to be dust (0.2 microns) particles. Containerized gases would have the taggants placed in the container. For gases being released into the atmosphere, the taggants could be mixed before release or at the time of release. For example, to track the pattern of dispersal of gases released by industry, one could attach an aerosol delivery device to an exhaust outlet and introduce a metered amount of taggant as the gas is released.
The use of nucleic acid taggants for the tracing of radioactive products, including waste, is anticipated. The means for tracing would be as described herein for non-radioactive materials with the use of appropriate protection. It should be noted that short oligonucleotides of less than 1000 bases are preferred due to their greater stability against degradation from radiation.
Recovery and detection of tag ag nts.
The amount to add to a substance and preferred means for recovery and detection of nucleic acid taggant is dependent upon the substance being monitored.
The means for detection and the amount of available sample being collected will dictate the amount of taggant required for each application of this invention.
Therefore, in the absence of a means to amplify the taggant, the amount of taggant added would depend on the logistics of collecting enough substance to recover a detectable amount of taggant.
C .~ t~w r~, ,~
~.~ t~.
The preferred molecular structure of the nucleic acid taggant will vary with the means used to detect the nucleic acid. Typically at least 20 bases are necessary to ensure adequate specificity for any taggant so that accidental contamination will not lead to false results. Preferably, the sequence should comprise multiple regions of specificity. The longer the sequence, the more information may be carried.
However, it will be recognized that the higher the information content of the taggant the more likely that degradation will be become a problem. Typically, fragments under 1 kilobase are preferred.
Recovery of the taggant can be achieved by the use of standard techniques.
Typically, the sample is washed or extracted with either distilled water or a buffered solution. Physiological pH is preferred as pH extremes may degrade nucleic acid.
Charged substances might require washing in high molarity salt buffers to act as ion exchangers with the electrostatically bound nucleic acids. Detergents, either ionic or non-ionic, are helpful to remove nucleic acids from surfaces or from complex biological mixtures. Using phenol based extractions or phenol/chloroform extractions, one can recover nucleic acid from complex biological substances or from oil based substances.
The recovered nucleic acid can be concentrated by standard techniques such as precipitation with alcohol, evaporation, or microfiltration.
Because of the limits of sensitivity for the detection of nucleic acid, there is an obvious advantage to using methods for amplifying the recovered taggant.
For example, using the polymerase chain reaction procedure [PCR] disclosed in U.S.
Pat.
Nos. 4,683,202 and 4,683,195 and European Patent Applications Nos. 258,017 and 237,362, one can amplify and detect nucleic acid molecule. The PCR method can be used with modification to amplify single stranded taggants, double stranded taggants and DNA or RNA taggants.
Those of skill in the art recognize that the PCR amplification can be carried out in a variety of ways. For instance, inverse PCR and asymetric PCR are well known variations of the technique. In another variation, promoters for RNA
transcription can be incoroporated into primers, which, when extended and replicated by PCR, can then be used to create RNA copies of the target sequence. These RNA
__ __ _n _ _ __. . _. _ _ . .. ~....: ~~_.~,...~.._.. _. _r s copies can, in turn, be several reverse transcribed into DNA, which can then be amplified by PCR. As with all PCR processes, reaction cycles can be repeated as often as desired.
For PCR, the preferred means for amplification, a double stranded taggant is preferred, although a single stranded taggant becomes a double stranded after the first cycle of amplification. The taggant is preferably a minimum of 60 bases long.
This permits the hybridization of two primers which are preferably each 20 bases long, and which, when hybridized to the taggant, are separated by an internal region between the primer specific regions of the taggant of about an additional 20 bases.
When detecting nucleic acid by PCR, prior knowledge of the target sequence is necessary to provide appropriate primers. This necessary knowledge offers a valuable degree of security for those who desire it. For without the primers which can remain proprietary, the taggant can be virtually undetectable.
For detection of taggants, one can use standard nucleic acid hybridization assays or nucleic acid sequencing. The standard nucleic acid hybridization assays include single phase and mixed phase assays such as sandwich assays.
The specific detection procedure used is not critical to this invention.
Nucleic acid hybridization technology is not a static art. New developments are anticipated and this invention is applicable to any new improvements. An overview of the state of the art can be found in Nucleic Acid Hybridization A Practical Approach, Eds.
Hames, B.D. and Higgins, S.J., IRL Press, Wash. D.C., 1987.
The use of nucleic acid hybridization assays requires prior knowledge of the sequence being detected. Knowledge of the taggant's sequence permits the use of appropriate complementary oligonucleotides for capture or signal purposes.
Alternatively, the nucleic acids recovered from the samples can be sequenced using conventional sequencing technology. Commercially available kits are suitable for this purpose. The basic sequencing technology is derived from seminal references such as the Maxam and Gilbert procedure for DNA sequencing described in Methods in Enzymology 65:(part 1) 497-559. Sequencing is a more difficult procedure to conduct, but offers greater reliability than nucleic acid hybridization assays. This is due to the possibility of contamination by extraneous nucleic acid with sufficient complementarity to hybridize to the selected probes and offer false positives.
Kits.
This invention also provides for a manufactured product such as a kit designed to tag and monitor substances. Such a kit would include nucleic acid taggants and polynucleotides which are complementary to the taggants. The complementary polynucleotides could be designed for use as signal probes, capture probes or as primers in the PCR method. The kits might also contain signal means such as enzymes, radio-isotopes, fluorescent labels and the like.
All cited references are provided for the convenience of the readers. The knowledge contained therein is well known to those of skill in the art.
The following examples are provided for illustrative purposes only and they are not to be interpreted as limitations of the invention.
Examples The following examples all used a double stranded taggant of a sequence complementary to the DQa allele 1.3. This sequence is derived from a rare DQa type and has a reduced likelihood of being accidently present as a contaminant in the materials described below. The taggant was also labelled with ~P to follow experimentally the tag during the entire procedure. The unique sequence of one strand of this taggant has been provided in Table 1.
The taggant was recovered as described below. All amplifications were done With 40 cycles on a Perkins-Elmer Cetus Instruments thermal cycler using the protocols and reagents provided by the manufacturer. Biotinylated primers GH26 and GH27 having the sequence provided in Table 1 were used to initiate the PCR
process.
~0~.'~r~.
to Table 1. Nucleic acid sequences for DHa, related primers and probes.
GH26 - 5' GTGCTGCAGGTGTAAACTTGTACCAG 3' GH27 - 5' CACGGATCCGGTAGCAGCGGTAGAGTTG 3' Taggant sequence DQa -5' TTTTACGGTCCCTCTGGCCAGTTCACCCATGAATTTGATGGAGATGAG
CAGTTCTACGTGGACCTGGAGAAGAAGGAGACTGCCTGGCGGTGGCCTGAGT
TCAGCAAATTTGGAGGTITI'GACCCGCAGGGTGCACTGAGAAACATGGCTGT
GGCAAAACACAACTTGAACATCATGATTAAACGCTA 3' Capture probe GH89 5' - CTGGAGAAGAAGGAGAC - 3' The Standard PCR procedure.
The following PCR procedure was used to amplify DQa in each of the different substances illustrated below.
The basic PCR mixture consists of:
lOx TAQ buffer 10 p1 100mM Tris HCl pH 8.3 SOOmM KCl lS.OmM MgClz lOpM GH26 1.5 ~l IO~tM GH27 1.5 p.1 100mM dNTPs 0.75 p1 SU/itl TAQ 0.5 p.1 distilled water 35 ~1 SO~tI of the basic PCR mixture is mixed with an equal amount of sample.
Each cycle consists of 30 second incubations at 94°C followed by 30 sec at 55°C
and 30 sec at 72°C. After the final (fortieth) cycle, the sample mixture is incubated at 72°C for ten minutes.
Detection of the PCR amplified taggant is achieved by standard nucleic acid hybridization assays using the capture probe provided in Table 1. The protocol for the hybridization assay is not critical. The means used have been detailed in PCT
Publication No. 89/11548, published November 30, 1989 Briefly, the taggant was captured by hybridization to an immobilized probe, GH89 (table 1). The probe was immobilized using ultraviolet irradiation on a positively charged nylon membrane.
A. Gun wder Preparation: (a) Add l6ng of taggant to 1 ml of distilled water, (b) mix solution with 1 g of nitrocellulose based gunpowder, and (c) dry in air or under vacuum a 85°C.
Recovery: (a) Wash gunpowder with distilled water (1 ml); (b) add 50 p.1 of this solution to PCR reaction mix or place gunpowder flakes directly in 100 p.1 PCR
reaction mix; and (c) amplify.
B. Oil 1 S Preparation: (a) Mix together 40 p,g of taggant, 10 ltl "Tween 80*"
(detergent), 10 ~tl"Span 80*" (detergent), and 100 ~tl distilled water; and (b) add mixture to 1.7 ml oil. The combination is then thoroughly mixed.
Recovery: Add oil directly to PCR mix, vortex and amplify; or use a standard phenol-chloroform extraction. After treatment with phenol, the taggant was detected in the boundary layer between the oil and water phases.
C. Medicines (water soluble tablets) Preparation: (a) Add 48 ~tg of taggant to 325 N.l of distilled water; (b) add ltl of this mix to a tablet; and (c) allow to dry.
Recovery: (a) dissolve the tablet in 5 ml of H20; (b) place 50 p1 of this solution in PCR mix; and (c) amplify.
*Trade-mark ~~'~;~y D. Ink Preparation: If water insoluble, mix with detergents as for tagging oil. If water soluble, add a dilute concentration of taggant directly to the ink.
Recovery: As described for oils and medicines.
E. Paper goods Preparation: (a) Add dilute solution of taggant 2-3 ng/cmZ to paper; and (b) allow to air dry or dry under vacuum.
Recovery: (a) Soak paper in distilled water with or without detergents to aid in solubilization; (b) optionally concentrate taggant; and (c) amplify by standard PCR procedure.
F. Food Stuffs Preparation: Add 20 ng taggant to each gram of food by physical mixing or spray application.
Recovery: (a) Food material is washed with distilled water; (b) the rinse is optionally concentrated; and (c) the rinse material is subjected to the standard PCR
procedure.
However, it will be recognized that the higher the information content of the taggant the more likely that degradation will be become a problem. Typically, fragments under 1 kilobase are preferred.
Recovery of the taggant can be achieved by the use of standard techniques.
Typically, the sample is washed or extracted with either distilled water or a buffered solution. Physiological pH is preferred as pH extremes may degrade nucleic acid.
Charged substances might require washing in high molarity salt buffers to act as ion exchangers with the electrostatically bound nucleic acids. Detergents, either ionic or non-ionic, are helpful to remove nucleic acids from surfaces or from complex biological mixtures. Using phenol based extractions or phenol/chloroform extractions, one can recover nucleic acid from complex biological substances or from oil based substances.
The recovered nucleic acid can be concentrated by standard techniques such as precipitation with alcohol, evaporation, or microfiltration.
Because of the limits of sensitivity for the detection of nucleic acid, there is an obvious advantage to using methods for amplifying the recovered taggant.
For example, using the polymerase chain reaction procedure [PCR] disclosed in U.S.
Pat.
Nos. 4,683,202 and 4,683,195 and European Patent Applications Nos. 258,017 and 237,362, one can amplify and detect nucleic acid molecule. The PCR method can be used with modification to amplify single stranded taggants, double stranded taggants and DNA or RNA taggants.
Those of skill in the art recognize that the PCR amplification can be carried out in a variety of ways. For instance, inverse PCR and asymetric PCR are well known variations of the technique. In another variation, promoters for RNA
transcription can be incoroporated into primers, which, when extended and replicated by PCR, can then be used to create RNA copies of the target sequence. These RNA
__ __ _n _ _ __. . _. _ _ . .. ~....: ~~_.~,...~.._.. _. _r s copies can, in turn, be several reverse transcribed into DNA, which can then be amplified by PCR. As with all PCR processes, reaction cycles can be repeated as often as desired.
For PCR, the preferred means for amplification, a double stranded taggant is preferred, although a single stranded taggant becomes a double stranded after the first cycle of amplification. The taggant is preferably a minimum of 60 bases long.
This permits the hybridization of two primers which are preferably each 20 bases long, and which, when hybridized to the taggant, are separated by an internal region between the primer specific regions of the taggant of about an additional 20 bases.
When detecting nucleic acid by PCR, prior knowledge of the target sequence is necessary to provide appropriate primers. This necessary knowledge offers a valuable degree of security for those who desire it. For without the primers which can remain proprietary, the taggant can be virtually undetectable.
For detection of taggants, one can use standard nucleic acid hybridization assays or nucleic acid sequencing. The standard nucleic acid hybridization assays include single phase and mixed phase assays such as sandwich assays.
The specific detection procedure used is not critical to this invention.
Nucleic acid hybridization technology is not a static art. New developments are anticipated and this invention is applicable to any new improvements. An overview of the state of the art can be found in Nucleic Acid Hybridization A Practical Approach, Eds.
Hames, B.D. and Higgins, S.J., IRL Press, Wash. D.C., 1987.
The use of nucleic acid hybridization assays requires prior knowledge of the sequence being detected. Knowledge of the taggant's sequence permits the use of appropriate complementary oligonucleotides for capture or signal purposes.
Alternatively, the nucleic acids recovered from the samples can be sequenced using conventional sequencing technology. Commercially available kits are suitable for this purpose. The basic sequencing technology is derived from seminal references such as the Maxam and Gilbert procedure for DNA sequencing described in Methods in Enzymology 65:(part 1) 497-559. Sequencing is a more difficult procedure to conduct, but offers greater reliability than nucleic acid hybridization assays. This is due to the possibility of contamination by extraneous nucleic acid with sufficient complementarity to hybridize to the selected probes and offer false positives.
Kits.
This invention also provides for a manufactured product such as a kit designed to tag and monitor substances. Such a kit would include nucleic acid taggants and polynucleotides which are complementary to the taggants. The complementary polynucleotides could be designed for use as signal probes, capture probes or as primers in the PCR method. The kits might also contain signal means such as enzymes, radio-isotopes, fluorescent labels and the like.
All cited references are provided for the convenience of the readers. The knowledge contained therein is well known to those of skill in the art.
The following examples are provided for illustrative purposes only and they are not to be interpreted as limitations of the invention.
Examples The following examples all used a double stranded taggant of a sequence complementary to the DQa allele 1.3. This sequence is derived from a rare DQa type and has a reduced likelihood of being accidently present as a contaminant in the materials described below. The taggant was also labelled with ~P to follow experimentally the tag during the entire procedure. The unique sequence of one strand of this taggant has been provided in Table 1.
The taggant was recovered as described below. All amplifications were done With 40 cycles on a Perkins-Elmer Cetus Instruments thermal cycler using the protocols and reagents provided by the manufacturer. Biotinylated primers GH26 and GH27 having the sequence provided in Table 1 were used to initiate the PCR
process.
~0~.'~r~.
to Table 1. Nucleic acid sequences for DHa, related primers and probes.
GH26 - 5' GTGCTGCAGGTGTAAACTTGTACCAG 3' GH27 - 5' CACGGATCCGGTAGCAGCGGTAGAGTTG 3' Taggant sequence DQa -5' TTTTACGGTCCCTCTGGCCAGTTCACCCATGAATTTGATGGAGATGAG
CAGTTCTACGTGGACCTGGAGAAGAAGGAGACTGCCTGGCGGTGGCCTGAGT
TCAGCAAATTTGGAGGTITI'GACCCGCAGGGTGCACTGAGAAACATGGCTGT
GGCAAAACACAACTTGAACATCATGATTAAACGCTA 3' Capture probe GH89 5' - CTGGAGAAGAAGGAGAC - 3' The Standard PCR procedure.
The following PCR procedure was used to amplify DQa in each of the different substances illustrated below.
The basic PCR mixture consists of:
lOx TAQ buffer 10 p1 100mM Tris HCl pH 8.3 SOOmM KCl lS.OmM MgClz lOpM GH26 1.5 ~l IO~tM GH27 1.5 p.1 100mM dNTPs 0.75 p1 SU/itl TAQ 0.5 p.1 distilled water 35 ~1 SO~tI of the basic PCR mixture is mixed with an equal amount of sample.
Each cycle consists of 30 second incubations at 94°C followed by 30 sec at 55°C
and 30 sec at 72°C. After the final (fortieth) cycle, the sample mixture is incubated at 72°C for ten minutes.
Detection of the PCR amplified taggant is achieved by standard nucleic acid hybridization assays using the capture probe provided in Table 1. The protocol for the hybridization assay is not critical. The means used have been detailed in PCT
Publication No. 89/11548, published November 30, 1989 Briefly, the taggant was captured by hybridization to an immobilized probe, GH89 (table 1). The probe was immobilized using ultraviolet irradiation on a positively charged nylon membrane.
A. Gun wder Preparation: (a) Add l6ng of taggant to 1 ml of distilled water, (b) mix solution with 1 g of nitrocellulose based gunpowder, and (c) dry in air or under vacuum a 85°C.
Recovery: (a) Wash gunpowder with distilled water (1 ml); (b) add 50 p.1 of this solution to PCR reaction mix or place gunpowder flakes directly in 100 p.1 PCR
reaction mix; and (c) amplify.
B. Oil 1 S Preparation: (a) Mix together 40 p,g of taggant, 10 ltl "Tween 80*"
(detergent), 10 ~tl"Span 80*" (detergent), and 100 ~tl distilled water; and (b) add mixture to 1.7 ml oil. The combination is then thoroughly mixed.
Recovery: Add oil directly to PCR mix, vortex and amplify; or use a standard phenol-chloroform extraction. After treatment with phenol, the taggant was detected in the boundary layer between the oil and water phases.
C. Medicines (water soluble tablets) Preparation: (a) Add 48 ~tg of taggant to 325 N.l of distilled water; (b) add ltl of this mix to a tablet; and (c) allow to dry.
Recovery: (a) dissolve the tablet in 5 ml of H20; (b) place 50 p1 of this solution in PCR mix; and (c) amplify.
*Trade-mark ~~'~;~y D. Ink Preparation: If water insoluble, mix with detergents as for tagging oil. If water soluble, add a dilute concentration of taggant directly to the ink.
Recovery: As described for oils and medicines.
E. Paper goods Preparation: (a) Add dilute solution of taggant 2-3 ng/cmZ to paper; and (b) allow to air dry or dry under vacuum.
Recovery: (a) Soak paper in distilled water with or without detergents to aid in solubilization; (b) optionally concentrate taggant; and (c) amplify by standard PCR procedure.
F. Food Stuffs Preparation: Add 20 ng taggant to each gram of food by physical mixing or spray application.
Recovery: (a) Food material is washed with distilled water; (b) the rinse is optionally concentrated; and (c) the rinse material is subjected to the standard PCR
procedure.
Claims (13)
1. A method of monitoring the presence of a substance released into the environment or the stream of commerce, which comprises tagging the substance for its subsequent identification by detection of the taggant with a nucleic acid of at least 30 and less than 1,000 nucleotides in length which is not a functioning part of the substance, releasing the tagged substance in a manner exposing said substance to naturally occurring radiation, amplifying said nucleic acid using the polymerase chain reaction and detecting the amplified product of said nucleic acid.
2. A method of monitoring the presence of a substance released into the environment or the stream of commerce, which comprises tagging the substance for its subsequent identification by detection of the taggant, with a nucleic acid of at least 20 and less than 1,000 nucleotides in length which is not a functioning part of the substance, collecting the substance, amplifying said nucleic acid, and detecting said nucleic acid.
3. The method of claim 1 or 2, wherein the step of amplifying is achieved using polymerase chain reaction technology.
4. The method of any one of claims 1 to 3, wherein the nucleic acid is a chemically synthesized nucleic acid.
5. A method of claim 4, wherein the chemically synthesized nucleic acid comprises inosine bases or nucleotides selected from the group consisting of 7-deaza-2'-deoxyguanosine, alkyl-phosphonate oligodeoxynucleotides, phosphorothioate oligodeoxynucleotides, and alpha-anomeric oligodeoxynucleotides.
6. The method of any one of claims 1 to 5, wherein the substance is selected from the group consisting of air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products.
7. A method of any one of claims 1 to 5, wherein the nucleic acid is covalently linked to a component of the substance or to a solid support mixed with the substance.
8. A method of any one of claims 1 to 5, wherein the nucleic acid is encapsulated by a polymeric substance or a lipophilic composition.
9. A method of tagging a substance to be released into the environment or the stream of commerce for its subsequent identification by detection of the taggant, comprising the step of incorporating into or onto the substance a nucleic acid having a specific sequence of at least 20 and less than 1,000 nucleotide bases in length which is not a functioning part of the substance , wherein the nucleic acid is a chemically synthesized nucleic acid comprising inosine bases or nucleotides selected from the group consisting of 7-deaza-2'-deoxyguanosine, alkyl-phosphonate oligodeoxynuclesotides, phosphorothioate oligodeoxynucleotides, and alpha-anomeric oligodeoxynucleotides.
10. A method of tagging a substance to be released into the environment or the stream of commerce for its subsequent identification by detection of the taggant, comprising the step of incorporating into or onto the substance a nucleic acid encapsulated by a polymeric substance or a lipophilic composition, wherein the nucleic acid has a specific sequence of at least 20 and less than 1,000 nucleotide bases in length which is not a functioning part of the substance.
11. A method of claim 9 or 10, wherein the substance is selected from air pollutants, oils, aromatic compounds, explosive compositions, food stuffs, medicaments, inks, paper goods, and paint products.
12. A method of any one of claims 9 to 11, wherein the nucleic acid is covalently linked to a component of the substance or to solid support mixed with the substance.
13. A kit for monitoring the presence of a substance released into the environment or the stream of commerce comprising a nucleic acid taggant with a nucleic acid of at least 30 and less than 1000 nucleotides in lengths, which is not a functioning part of the substance, and a polynucleotide complementary to the taggant, which is a primer in a PCR method.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US35544589A | 1989-05-22 | 1989-05-22 | |
US355,445 | 1989-05-22 |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2017211A1 CA2017211A1 (en) | 1990-11-22 |
CA2017211C true CA2017211C (en) | 2004-02-10 |
Family
ID=23397459
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002017211A Expired - Lifetime CA2017211C (en) | 1989-05-22 | 1990-05-18 | Methods for tagging and tracing materials with nucleic acids |
Country Status (10)
Country | Link |
---|---|
US (1) | US5451505A (en) |
EP (1) | EP0477220B1 (en) |
JP (1) | JP3082942B2 (en) |
AT (1) | ATE142274T1 (en) |
AU (1) | AU643217B2 (en) |
CA (1) | CA2017211C (en) |
DE (1) | DE69028402T2 (en) |
DK (1) | DK0477220T3 (en) |
ES (1) | ES2091243T3 (en) |
WO (1) | WO1990014441A1 (en) |
Families Citing this family (162)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5776713A (en) * | 1988-02-02 | 1998-07-07 | Biocode Ltd. | Marking of products to establish identity and source |
US5429952A (en) * | 1988-02-02 | 1995-07-04 | Biocode, Inc. | Marking of products to establish identity and source |
US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
GB9010138D0 (en) * | 1990-05-04 | 1990-06-27 | Slater James H | An ultrasensitive microtrace procedure for monitoring the origin,movement and fate of any liquid or solid material |
US6083689A (en) * | 1990-10-16 | 2000-07-04 | Bayer Corporation | Sensitive immunoassays utilizing antibody conjugates with replicable DNA templates |
DE69132843T2 (en) | 1990-12-06 | 2002-09-12 | Affymetrix Inc N D Ges D Staat | Identification of nucleic acids in samples |
US5770358A (en) * | 1991-09-18 | 1998-06-23 | Affymax Technologies N.V. | Tagged synthetic oligomer libraries |
US5639603A (en) * | 1991-09-18 | 1997-06-17 | Affymax Technologies N.V. | Synthesizing and screening molecular diversity |
ATE185378T1 (en) * | 1992-02-04 | 1999-10-15 | Nen Life Science Prod Inc | AMPLIFICATION OF TEST REPORTERS BY NUCLEIC ACID REPLICATION |
GB9218131D0 (en) * | 1992-08-26 | 1992-10-14 | Slater James H | A method of marking a liquid |
US5985548A (en) * | 1993-02-04 | 1999-11-16 | E. I. Du Pont De Nemours And Company | Amplification of assay reporters by nucleic acid replication |
GB9314394D0 (en) * | 1993-07-12 | 1993-08-25 | Slater James H | A security device using an ultrasensitive microtrace for protecting materials,articles and items |
US6165778A (en) * | 1993-11-02 | 2000-12-26 | Affymax Technologies N.V. | Reaction vessel agitation apparatus |
US5503805A (en) * | 1993-11-02 | 1996-04-02 | Affymax Technologies N.V. | Apparatus and method for parallel coupling reactions |
GB9326277D0 (en) * | 1993-12-23 | 1994-02-23 | Marconi Gec Ltd | Labelling |
EP0795029A1 (en) * | 1994-12-08 | 1997-09-17 | Pabio | Chemical labelling of objects |
US5776737A (en) * | 1994-12-22 | 1998-07-07 | Visible Genetics Inc. | Method and composition for internal identification of samples |
US6458530B1 (en) * | 1996-04-04 | 2002-10-01 | Affymetrix Inc. | Selecting tag nucleic acids |
US6110710A (en) * | 1996-10-15 | 2000-08-29 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Sequence modification of oligonucleotide primers to manipulate non-templated nucleotide addition |
WO1998046544A1 (en) * | 1997-04-17 | 1998-10-22 | The Dow Chemical Company | Encapsulated vapor-detection and identification tags |
NO972556D0 (en) * | 1997-06-05 | 1997-06-05 | Forskningsparken I Aas As | Method for labeling liquids and objects |
DE19738816A1 (en) * | 1997-09-05 | 1999-03-11 | November Ag Molekulare Medizin | Method for marking solid, liquid or gaseous substances |
WO1999042613A1 (en) * | 1998-02-20 | 1999-08-26 | Biotraces, Inc. | Methods and additives for microtagging fluids |
GB9822729D0 (en) * | 1998-10-20 | 1998-12-16 | Wrc Plc | Release system for a marker substance |
DE19860546A1 (en) * | 1998-12-23 | 2000-06-29 | Knoell Hans Forschung Ev | Process for the identification of the origin of organic liquids |
AU717638B3 (en) * | 1999-01-18 | 2000-03-30 | Legends Genuine Memorabilia Pty Ltd | Product and method |
US6153389A (en) * | 1999-02-22 | 2000-11-28 | Haarer; Brian K. | DNA additives as a mechanism for unambiguously marking biological samples |
US6806478B1 (en) * | 1999-03-16 | 2004-10-19 | Cryovac, Inc. | Authentication system and methodology |
US20030129654A1 (en) * | 1999-04-15 | 2003-07-10 | Ilya Ravkin | Coded particles for multiplexed analysis of biological samples |
CA2366093A1 (en) * | 1999-04-15 | 2000-10-26 | Ilya Ravkin | Combinatorial chemical library supports having indicia at coding positions and methods of use |
US20030166015A1 (en) * | 1999-04-15 | 2003-09-04 | Zarowitz Michael A. | Multiplexed analysis of cell-substrate interactions |
US6908737B2 (en) * | 1999-04-15 | 2005-06-21 | Vitra Bioscience, Inc. | Systems and methods of conducting multiplexed experiments |
US20030134330A1 (en) * | 1999-04-15 | 2003-07-17 | Ilya Ravkin | Chemical-library composition and method |
US7253435B2 (en) | 1999-04-15 | 2007-08-07 | Millipore Corporation | Particles with light-polarizing codes |
US20030207249A1 (en) * | 1999-04-15 | 2003-11-06 | Beske Oren E. | Connection of cells to substrates using association pairs |
US7112445B1 (en) * | 2000-05-19 | 2006-09-26 | Richard P Welle | Fragmented taggant coding system and method with application to ammunition tagging |
DE19934573C2 (en) * | 1999-07-22 | 2002-12-05 | November Ag Molekulare Medizin | Process for marking solid, liquid and gaseous substances |
GB9927292D0 (en) | 1999-11-19 | 2000-01-12 | Maxwell Paul | Security system |
US7157564B1 (en) | 2000-04-06 | 2007-01-02 | Affymetrix, Inc. | Tag nucleic acids and probe arrays |
US6560544B1 (en) * | 2000-04-28 | 2003-05-06 | Ford Motor Company | Method for monitoring a mixture |
JP2001352980A (en) * | 2000-06-07 | 2001-12-25 | Internatl Business Mach Corp <Ibm> | Method for describing information into dna, method for identifying source of genetic information, dna to which information is added, base sequence, and cell of organism |
DE10038169A1 (en) * | 2000-08-04 | 2002-03-07 | November Ag Molekulare Medizin | Synthetic particle for marking a substance |
AUPQ935700A0 (en) * | 2000-08-11 | 2000-09-07 | Starguard International Pty Ltd | Authentication system and device |
US6629038B1 (en) * | 2000-09-05 | 2003-09-30 | Yeda Research And Development Co. Ltd. | Method and system for identifying commercially distributed organisms |
JP2004537712A (en) * | 2000-10-18 | 2004-12-16 | バーチャル・アレイズ・インコーポレーテッド | Multiple cell analysis system |
DE10055368A1 (en) * | 2000-11-08 | 2002-05-29 | Agrobiogen Gmbh Biotechnologie | Method for labeling samples containing DNA using oligonucleotides |
FR2819831A1 (en) * | 2001-01-22 | 2002-07-26 | Arjo Wiggins Sa | PAPER COMPRISING BODIES CARRYING AT LEAST ONE BIOCHEMICAL MARKER |
US7115301B2 (en) | 2001-04-09 | 2006-10-03 | Rixflex Holdings Limited | Method of marking solid or liquid substances with nucleic acid for anti-counterfeiting and authentication |
CA2446206A1 (en) * | 2001-05-03 | 2002-11-14 | Warnex Research Inc. | A molecular tag code for monitoring a product and process using same |
KR100851764B1 (en) * | 2001-06-27 | 2008-08-13 | (주)바이오니아 | Oligonucleotide marker which contains phase transfer catalyst and the material differentiating or discerning method which employs the same |
GB0123278D0 (en) * | 2001-09-27 | 2001-11-21 | Ucb Sa | Labelled articles and uses thereof |
US20030219800A1 (en) * | 2001-10-18 | 2003-11-27 | Beske Oren E. | Multiplexed cell transfection using coded carriers |
US20080187949A1 (en) * | 2001-10-26 | 2008-08-07 | Millipore Corporation | Multiplexed assays of cell migration |
AU2002363076A1 (en) * | 2001-10-26 | 2003-05-06 | Virtual Arrays, Inc. | Assay systems with adjustable fluid communication |
JP2003157004A (en) * | 2001-11-21 | 2003-05-30 | Id Technica:Kk | Additive for adding identification means and identification information holding matter containing the additive |
DE10222075A1 (en) * | 2002-05-17 | 2003-12-11 | Henkel Kgaa | Identification procedure for product protection |
US20040126773A1 (en) * | 2002-05-23 | 2004-07-01 | Beske Oren E. | Assays with coded sensor particles to sense assay conditions |
AR037006A1 (en) * | 2002-06-20 | 2004-10-20 | S I G Sist S De Identificacion | OBJECT MARKER TO IDENTIFY CONSISTENTLY AT LEAST A DNA FRAGMENT. |
US20030236219A1 (en) | 2002-06-21 | 2003-12-25 | Nightingale Stephen D. | Edible product markers and methods for making and using edible product markers |
KR20050026411A (en) | 2002-06-21 | 2005-03-15 | 스티븐 디 나이팅게일 | Multi-functional product markers and methods for making and using the same |
DE10231435A1 (en) * | 2002-07-11 | 2004-02-12 | Sension, Biologische Detektions- Und Schnelltestsysteme Gmbh | Verification procedure for checking the originality of an object |
US20080073044A1 (en) * | 2002-08-13 | 2008-03-27 | Bowman David J | Apparatus for liquid-based fiber separation |
US7279073B2 (en) * | 2002-08-13 | 2007-10-09 | U.S. Greenfiber, Llc | Apparatus for liquid-based fiber separation |
AU2003268105B2 (en) * | 2002-08-16 | 2011-11-03 | John Wayne Cancer Institute | Molecular lymphatic mapping of sentinel lymph nodes |
US20040058457A1 (en) * | 2002-08-29 | 2004-03-25 | Xueying Huang | Functionalized nanoparticles |
US7361821B2 (en) | 2002-09-20 | 2008-04-22 | Intel Corporation | Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (SPM) reading |
WO2004038037A2 (en) * | 2002-09-20 | 2004-05-06 | Intel Corporation | Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (spm) reading |
KR100851765B1 (en) * | 2002-10-16 | 2008-08-13 | (주)바이오니아 | Method for Identifying Car Using Oligonucleotides and Oligonucleotide Marker Used Therein |
US20080207465A1 (en) * | 2002-10-28 | 2008-08-28 | Millipore Corporation | Assay systems with adjustable fluid communication |
US8372648B2 (en) | 2003-04-16 | 2013-02-12 | APDN (B.V.I.), Inc. | Optical reporter compositions |
US8124333B2 (en) | 2003-04-16 | 2012-02-28 | APDN, Inc. | Methods for covalent linking of optical reporters |
US8426216B2 (en) | 2003-04-16 | 2013-04-23 | APDN (B.V.I.), Inc. | Methods for authenticating articles with optical reporters |
WO2004094713A2 (en) * | 2003-04-16 | 2004-11-04 | Applied Dna Sciences, Inc. | System and method for marking textiles with nucleic acids |
US8415164B2 (en) | 2003-04-16 | 2013-04-09 | Apdn (B.V.I.) Inc. | System and method for secure document printing and detection |
US7820030B2 (en) | 2003-04-16 | 2010-10-26 | Handylab, Inc. | System and method for electrochemical detection of biological compounds |
US8415165B2 (en) | 2003-04-16 | 2013-04-09 | APDN (B.V.I.), Inc. | System and method for authenticating sports identification goods |
US8420400B2 (en) | 2003-04-16 | 2013-04-16 | APDN (B.V.I.), Inc. | System and method for authenticating tablets |
JP2004329014A (en) * | 2003-04-30 | 2004-11-25 | Id Technica:Kk | Identification additive for adding identification means having function to prevent falsifying behavior and material holding identification information and method for detecting misuse of material holding identification information |
US7488451B2 (en) * | 2003-09-15 | 2009-02-10 | Millipore Corporation | Systems for particle manipulation |
US20050084914A1 (en) * | 2003-09-15 | 2005-04-21 | Foulkes J. G. | Assays with primary cells |
DE112005000829T5 (en) * | 2004-05-12 | 2007-04-19 | Axsun Technologies, Inc., Billerica | Method and device for validating erasable tags in distribution channels |
US20060073506A1 (en) | 2004-09-17 | 2006-04-06 | Affymetrix, Inc. | Methods for identifying biological samples |
JP4674793B2 (en) * | 2004-12-15 | 2011-04-20 | 日産自動車株式会社 | Undercoat paint composition and undercoat coating film |
JP2006169332A (en) * | 2004-12-15 | 2006-06-29 | Nissan Motor Co Ltd | Colored topcoat coating composition and colored topcoat coating film |
JP4674794B2 (en) * | 2004-12-15 | 2011-04-20 | 日産自動車株式会社 | Clear coating composition and clear coating film |
JP4674796B2 (en) * | 2004-12-15 | 2011-04-20 | 日産自動車株式会社 | Non-exposed surface coating composition and non-exposed surface coating |
JP2006168084A (en) * | 2004-12-15 | 2006-06-29 | Nissan Motor Co Ltd | Laminated coating film structure |
JP4674795B2 (en) * | 2004-12-15 | 2011-04-20 | 日産自動車株式会社 | Matte paint composition and matte paint film |
US7393665B2 (en) | 2005-02-10 | 2008-07-01 | Population Genetics Technologies Ltd | Methods and compositions for tagging and identifying polynucleotides |
EP1717321A1 (en) * | 2005-04-29 | 2006-11-02 | Avvocato Alberto Franchi | System for surface identification of commercial products using DNA tracer |
US20150141264A1 (en) * | 2005-05-20 | 2015-05-21 | Apdn (B.V.I.) Inc. | In-field dna extraction, detection and authentication methods and systems therefor |
US8247018B2 (en) * | 2005-06-20 | 2012-08-21 | Authentiform Technologies, Llc | Methods for quality control |
US7874489B2 (en) * | 2005-06-20 | 2011-01-25 | Authentiform Technologies, Llc | Product authentication |
WO2007002016A2 (en) * | 2005-06-20 | 2007-01-04 | Johnson & Johnson | Systems and methods for product authentication |
US8785130B2 (en) * | 2005-07-07 | 2014-07-22 | Bio-Id Diagnostic Inc. | Use of markers including nucleotide sequence based codes to monitor methods of detection and identification of genetic material |
US20070172429A1 (en) * | 2005-08-12 | 2007-07-26 | Xiaolian Gao | Labeling compositions and methods of use for deterrent trackability |
WO2007034499A1 (en) * | 2005-09-26 | 2007-03-29 | Soreq Nuclear Research Center | Probe for tagging valuables based on dna-metal complex |
USH2257H1 (en) * | 2005-09-28 | 2011-06-07 | The United States Of America As Represented By The Secretary Of The Navy | Microtags for detection and identification of materials |
US20140106357A1 (en) * | 2012-10-16 | 2014-04-17 | Applied Dna Sciences, Inc. | Security system and method of marking an inventory item and/or person in the vicinity |
US9790538B2 (en) | 2013-03-07 | 2017-10-17 | Apdn (B.V.I.) Inc. | Alkaline activation for immobilization of DNA taggants |
US10741034B2 (en) | 2006-05-19 | 2020-08-11 | Apdn (B.V.I.) Inc. | Security system and method of marking an inventory item and/or person in the vicinity |
EP2026741B1 (en) * | 2006-06-13 | 2015-08-12 | CSEM Centre Suisse d'Electronique et de Microtechnique SA - Recherche et Développement | Pharmaceutical tablets with diffractive microstructure and compression tools for producing such tablets |
DE102007026958B4 (en) * | 2006-06-13 | 2014-10-09 | Csem Centre Suisse D'electronique Et De Microtechnique S.A. | Press tool with diffractive microstructure and method for producing such a tool and tableting press |
CH699631B1 (en) * | 2007-01-12 | 2010-04-15 | Suisse Electronique Microtech | Realizing a diffractive microstructure in a pill surface. |
WO2008033042A2 (en) * | 2006-09-12 | 2008-03-20 | Agresearch Limited | Method for identifying the origin of a compound biological product |
DE102006044349A1 (en) * | 2006-09-18 | 2008-03-27 | Identif Gmbh | Local pre-authentication process for substance containing nucleic acid involves applying first liquid to surface of solid between stages |
ES2384941T3 (en) | 2007-02-16 | 2012-07-16 | Csem Centre Suisse D'electronique Et De Microtechnique Sa - Recherche Et Developpement | Verification method |
WO2008124936A1 (en) * | 2007-04-16 | 2008-10-23 | Mcmaster University | Method of producing bioactive paper |
EP1990779B1 (en) | 2007-05-07 | 2016-09-14 | CSEM Centre Suisse d'Electronique et de Microtechnique SA - Recherche et Développement | Security device for the identification or authentication of goods and method for securing goods using such a security device |
EP2012293A1 (en) * | 2007-07-06 | 2009-01-07 | Nederlandse Organisatie voor toegepast- natuurwetenschappelijk onderzoek TNO | Method for marking materials |
FR2930063B1 (en) * | 2008-04-14 | 2013-02-15 | Bioquanta | METHOD FOR MARKING A PRODUCT, METHOD FOR IDENTIFYING THE MARKING AND PRODUCT |
US20090269800A1 (en) * | 2008-04-29 | 2009-10-29 | Todd Covey | Device and method for processing cell samples |
US20120003749A1 (en) * | 2008-05-21 | 2012-01-05 | Nec Soft, Ltd. | Nucleic acid molecule capable of binding to 2,4,6-trinitrophenyl skeleton, method for detecting compound having 2,4,6-trinitrophenyl skeleton using the nucleic acid molecule, and use of the nucleic acid molecule |
US20100030719A1 (en) * | 2008-07-10 | 2010-02-04 | Covey Todd M | Methods and apparatus related to bioinformatics data analysis |
US20100014741A1 (en) * | 2008-07-10 | 2010-01-21 | Banville Steven C | Methods and apparatus related to gate boundaries within a data space |
US9183237B2 (en) | 2008-07-10 | 2015-11-10 | Nodality, Inc. | Methods and apparatus related to gate boundaries within a data space |
US20100042351A1 (en) * | 2008-07-10 | 2010-02-18 | Covey Todd M | Methods and apparatus related to management of experiments |
EP2320875B1 (en) | 2008-07-23 | 2019-07-03 | I-Property Holding Corp. | Secure tracking of tablets |
US9034257B2 (en) | 2008-10-27 | 2015-05-19 | Nodality, Inc. | High throughput flow cytometry system and method |
US8940485B2 (en) | 2008-11-12 | 2015-01-27 | Apdn (B.V.I.) Inc. | Methods for genotyping mature cotton fibers and textiles |
US8669079B2 (en) | 2008-11-12 | 2014-03-11 | Cara Therapeutics, Inc. | Methods for genetic analysis of textiles made of Gossypium barbadense and Gossypium hirsutum cotton |
FR2942807B1 (en) * | 2009-03-09 | 2013-10-18 | Commissariat Energie Atomique | METHOD FOR DETECTING, IDENTIFYING AND / OR QUANTIFYING CARBON NANOTUBES |
US8053744B2 (en) * | 2009-04-13 | 2011-11-08 | Src, Inc. | Location analysis using nucleic acid-labeled tags |
GB2472371B (en) * | 2009-04-24 | 2011-10-26 | Selectamark Security Systems Plc | Synthetic nucleotide containing compositions for use in security marking of property and/or for marking a thief or attacker |
US9189728B2 (en) | 2009-07-23 | 2015-11-17 | I-Property Holding Corp. | Method for the authentication of dosage forms |
US8735327B2 (en) | 2010-01-07 | 2014-05-27 | Jeansee, Llc | Combinatorial DNA taggants and methods of preparation and use thereof |
US8703493B2 (en) | 2010-06-15 | 2014-04-22 | Src, Inc. | Location analysis using fire retardant-protected nucleic acid-labeled tags |
US8716027B2 (en) | 2010-08-03 | 2014-05-06 | Src, Inc. | Nucleic acid-labeled tags associated with odorant |
KR101352391B1 (en) * | 2010-09-03 | 2014-01-24 | (주)바이오니아 | Oligonucleotide marker and the material identification or identification methods which employs the same |
KR101350919B1 (en) * | 2011-03-14 | 2014-01-14 | (주)바이오니아 | Method of Identifying Nucleic Acid-Containing Materials |
GB2489714B (en) * | 2011-04-05 | 2013-11-06 | Tracesa Ltd | Fluid Identification Method |
JP2013050941A (en) * | 2011-07-30 | 2013-03-14 | Visionbio Corp | Product inspection method |
US9057712B1 (en) | 2011-10-27 | 2015-06-16 | Copilot Ventures Fund Iii Llc | Methods of delivery of encapsulated perfluorocarbon taggants |
US9297032B2 (en) | 2012-10-10 | 2016-03-29 | Apdn (B.V.I.) Inc. | Use of perturbants to facilitate incorporation and recovery of taggants from polymerized coatings |
US9266370B2 (en) | 2012-10-10 | 2016-02-23 | Apdn (B.V.I) Inc. | DNA marking of previously undistinguished items for traceability |
EP2915098A4 (en) | 2012-10-30 | 2016-07-06 | Certirx Corp | Product, image, or document authentication, verification, and item identification |
US9243283B2 (en) | 2012-11-19 | 2016-01-26 | Src, Inc. | System and method for authentication and tamper detection using nucleic acid taggants |
US9963740B2 (en) | 2013-03-07 | 2018-05-08 | APDN (B.V.I.), Inc. | Method and device for marking articles |
US9428792B2 (en) | 2013-03-14 | 2016-08-30 | Certirx Corporation | Nucleic acid-based authentication and identification codes |
AU2014233373B2 (en) * | 2013-03-15 | 2019-10-24 | Verinata Health, Inc. | Generating cell-free DNA libraries directly from blood |
US20140349861A1 (en) * | 2013-05-22 | 2014-11-27 | Sunpower Technologies Llc | Method for Distinguishing Biological Material Products |
GB201315745D0 (en) * | 2013-09-04 | 2013-10-16 | Maersk Olie & Gas | Enhanced hydrocarbon recovery |
US9904734B2 (en) | 2013-10-07 | 2018-02-27 | Apdn (B.V.I.) Inc. | Multimode image and spectral reader |
US10745825B2 (en) | 2014-03-18 | 2020-08-18 | Apdn (B.V.I.) Inc. | Encrypted optical markers for security applications |
CN106103121B (en) | 2014-03-18 | 2019-12-06 | 亚普蒂恩(B.V.I.)公司 | Encrypted optical marker for security applications |
US9751812B2 (en) | 2014-05-30 | 2017-09-05 | Elwha Llc | Taggant for cement authentication |
US10760182B2 (en) | 2014-12-16 | 2020-09-01 | Apdn (B.V.I.) Inc. | Method and device for marking fibrous materials |
US20180016627A1 (en) * | 2015-03-17 | 2018-01-18 | Apdn (B.V.I.) Inc. | Method for authenticating active pharmaceutical ingredients |
US20180094200A1 (en) * | 2015-04-20 | 2018-04-05 | Apdn (B.V.I.) Inc. | Hydrophobic Nucleic Acid Salts As Security Markers |
JP7051677B2 (en) * | 2015-09-29 | 2022-04-11 | カパ バイオシステムズ, インコーポレイテッド | High Molecular Weight DNA Sample Tracking Tag for Next Generation Sequencing |
US10047235B2 (en) * | 2015-12-08 | 2018-08-14 | Xerox Corporation | Encoding liquid ink with a device specific biomarker |
US20170228826A1 (en) * | 2016-02-08 | 2017-08-10 | Apdn (B.V.I.) Inc. | Identifying marked articles in the international stream of commerce |
CN109070130B (en) | 2016-04-11 | 2022-03-22 | 亚普蒂恩(B V I)公司 | Method for marking cellulose products |
CN110352253A (en) * | 2016-07-22 | 2019-10-18 | 核素示踪有限公司 | The method of amplifying nucleic acid sequence |
US10995371B2 (en) | 2016-10-13 | 2021-05-04 | Apdn (B.V.I.) Inc. | Composition and method of DNA marking elastomeric material |
US20180194796A1 (en) * | 2017-01-12 | 2018-07-12 | Apdn (B.V.I.) Inc. | Traceable nucleic acid marked fertilizer |
GB201701574D0 (en) * | 2017-01-31 | 2017-03-15 | Forecast Tech Ltd | Oil tagging |
US10920274B2 (en) | 2017-02-21 | 2021-02-16 | Apdn (B.V.I.) Inc. | Nucleic acid coated submicron particles for authentication |
WO2019204482A1 (en) * | 2018-04-17 | 2019-10-24 | Invisidex, Inc. | Composition of variegated witness mark |
GB201819256D0 (en) | 2018-11-27 | 2019-01-09 | Crime Solutions Ltd | Security markers |
US20230101409A1 (en) | 2021-09-30 | 2023-03-30 | Microsoft Technology Licensing, Llc | Anti-counterfeit tags using high-complexity polynucleotides |
US20230101083A1 (en) | 2021-09-30 | 2023-03-30 | Microsoft Technology Licensing, Llc | Anti-counterfeit tags using base ratios of polynucleotides |
Family Cites Families (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4359353A (en) * | 1981-05-18 | 1982-11-16 | Hydrocarbon Research, Inc. | Polypeptides as chemical tagging materials |
US4441943A (en) * | 1981-05-18 | 1984-04-10 | Hri Inc. | Polypeptides as chemical tagging materials |
US4786600A (en) * | 1984-05-25 | 1988-11-22 | The Trustees Of Columbia University In The City Of New York | Autocatalytic replication of recombinant RNA |
US4957858A (en) * | 1986-04-16 | 1990-09-18 | The Salk Instute For Biological Studies | Replicative RNA reporter systems |
US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4703011A (en) * | 1985-11-12 | 1987-10-27 | Novagene, Inc. | Thymidine kinase deletion mutants of bovine herpesvirus-1 |
GB8529275D0 (en) * | 1985-11-28 | 1986-01-02 | Whitbread & Co Plc | Dna recombination |
JPH0684474B2 (en) * | 1986-02-26 | 1994-10-26 | 東レ・ダウコ−ニング・シリコ−ン株式会社 | Silica-containing organopolysiloxane composition |
GB8608629D0 (en) * | 1986-04-09 | 1986-05-14 | Biotechnica Ltd | Labelling |
CA1338457C (en) * | 1986-08-22 | 1996-07-16 | Henry A. Erlich | Purified thermostable enzyme |
ZA876216B (en) * | 1986-08-22 | 1989-04-26 | Cetus Corp | Purified thermostable enzyme |
EP0290144A1 (en) * | 1987-05-05 | 1988-11-09 | City of Hope | Method of detecting incipient resistance to therapeutic agents in cancer patients |
NO884048L (en) * | 1988-09-12 | 1990-03-13 | Cheminor As | ELECTROLYSE OF COPPER IN THIN SOLUTIONS CONTAINING LARGE AMOUNTS OF IRON. |
FR2649518B1 (en) * | 1989-07-07 | 1991-10-18 | Bioprobe Systems Sa | HIGH SECURITY ENCRYPTED MARKING METHOD AND DEVICE FOR THE PROTECTION OF VALUABLE OBJECTS |
-
1990
- 1990-05-16 AT AT90908827T patent/ATE142274T1/en not_active IP Right Cessation
- 1990-05-16 JP JP02508504A patent/JP3082942B2/en not_active Expired - Lifetime
- 1990-05-16 AU AU57419/90A patent/AU643217B2/en not_active Expired
- 1990-05-16 WO PCT/US1990/002709 patent/WO1990014441A1/en active IP Right Grant
- 1990-05-16 DK DK90908827.0T patent/DK0477220T3/en active
- 1990-05-16 EP EP90908827A patent/EP0477220B1/en not_active Expired - Lifetime
- 1990-05-16 ES ES90908827T patent/ES2091243T3/en not_active Expired - Lifetime
- 1990-05-16 DE DE69028402T patent/DE69028402T2/en not_active Expired - Lifetime
- 1990-05-18 CA CA002017211A patent/CA2017211C/en not_active Expired - Lifetime
-
1992
- 1992-05-21 US US07/887,424 patent/US5451505A/en not_active Expired - Lifetime
Also Published As
Publication number | Publication date |
---|---|
ATE142274T1 (en) | 1996-09-15 |
JPH04505708A (en) | 1992-10-08 |
DE69028402D1 (en) | 1996-10-10 |
CA2017211A1 (en) | 1990-11-22 |
ES2091243T3 (en) | 1996-11-01 |
AU5741990A (en) | 1990-12-18 |
JP3082942B2 (en) | 2000-09-04 |
WO1990014441A1 (en) | 1990-11-29 |
DK0477220T3 (en) | 1996-10-21 |
US5451505A (en) | 1995-09-19 |
AU643217B2 (en) | 1993-11-11 |
DE69028402T2 (en) | 1997-04-17 |
EP0477220A1 (en) | 1992-04-01 |
EP0477220B1 (en) | 1996-09-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2017211C (en) | Methods for tagging and tracing materials with nucleic acids | |
EP0774012B1 (en) | A security device using an ultrasensitive microtrace for protecting materials, articles and items | |
US20160102215A1 (en) | Incorporating soluble security markers into cyanoacrylate solutions | |
US5643728A (en) | Method of marking a liquid | |
AU2017223821B2 (en) | Methods and compositions for target detection | |
US20040166520A1 (en) | Identifying items with nucleic acid taggants | |
US5665538A (en) | Ultrasensitive microtrace procedure for monitoring the origin of a material | |
CA2311952A1 (en) | Fluorimetric detection system of a nucleic acid | |
US8114207B2 (en) | Marker solution to be applied by means of an inkjet printer | |
EP1171633B9 (en) | Methods of marking materials | |
CA2349810C (en) | Isometric primer extension method and kit for detection and quantification of specific nucleic acid | |
WO2014152775A2 (en) | Nucleic acid-based authentication and identification codes | |
KR101350919B1 (en) | Method of Identifying Nucleic Acid-Containing Materials | |
AU738768C (en) | Methods of labelling a material and of detecting such labelling | |
CN1187455C (en) | Method of using ribonucleic acid as product antifake mark and for verification | |
DE102013213279B4 (en) | Universal method for the detection of various analytes in the form of nucleic acid sequences | |
US11473134B2 (en) | Method for the deconvolution of nucleic acid-containing substance mixtures | |
EP1679381A1 (en) | Isometric primers extension method and kit for detection and quantification of specific nucleic acid | |
Boulet | Application of Capillary Electrophoresis Laser Induced Fluorescence to the Detection of Nucleic Acid Probe Fragments | |
JPH06113897A (en) | Method for measuring nucleic acid | |
JP2011135799A (en) | Method of detecting and/or identifying biopolymer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |